|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 7 (April 1), 1999:
pp. 2167-2172
RAPID COMMUNICATION
Nonimmunoglobulin Gene Hypermutation in Germinal Center B Cells
By
Huai-Zheng Peng,
Ming-Qing Du,
Athanasios Koulis,
Antonella Aiello,
Ahmet Dogan,
Lang-Xing Pan, and
Peter G. Isaacson
From the Department of Histopathology, University College London
Medical School, London, UK; and Divisione Di Anatomia Patologica,
Istituto Nazionale Tumori, Milano, Italy.
 |
ABSTRACT |
Somatic hypermutation is the most critical mechanism underlying the
diversification of Ig genes. Although mutation occurs specifically in B
cells during the germinal center reaction, it remains a matter of
debate whether the mutation machinery also targets non-Ig genes. We
have studied mutations in the 5' noncoding region of the Bcl6 gene in
different subtypes of lymphomas. We found frequent hypermutation in
follicular lymphoma (25 of 59 = 42%) (germinal center cell origin)
and mucosa-associated lymphoid tissue (MALT) lymphoma (19 of
45 = 42%) (postgerminal center), but only occasionally in mantle
cell lymphoma (1 of 21 = 4.8%) (pregerminal center). Most
mutations were outside the motifs potentially important for
transcription, suggesting they were not important in
lymphomagenesis but may, like Ig mutation, represent an inherent feature of the lymphoma precursor cells. Therefore, we investigated their normal cell counterparts microdissected from a reactive tonsil.
Bcl6 mutation was found in 13 of 24 (54%) clones from the germinal
centre but only in 1 of 24 (4%) clones from the naive B cells of the
mantle zone. The frequency, distribution, and nature of these mutations
were similar to those resulting from the Ig hypermutation process. The
results show unequivocal evidence of non-Ig gene hypermutation in
germinal center B cells and provide fresh insights into the process of
hypermutation and lymphomagenesis.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
THE GENERATION of highly diverse
antibodies with high affinity is the key element of acquired immunity.
This is primarily achieved by sequential somatic alterations of the Ig
genes during B-cell development.1 Functional Ig genes are
first generated by recombination of the germline Ig building blocks,
ie, the variable (V), diversity (D), and joining (J) segments, during
which random nucleotides are inserted into the VD and DJ junctions to
increase diversity.1,2 After antigen exposure, somatic
hypermutations are introduced into the rearranged Ig
genes.1 B cells expressing antibodies with high affinity to
exogenous antigens are positively selected, whereas those failing to
express high-affinity antibodies or expressing those recognizing
autoantigens are eliminated.1,3
Somatic hypermutations occur specifically in B cells during the
germinal center reaction and are exclusively found within 2 kb
downstream of the Ig promoter, with the great majority in and around
the rearranged V genes.3,4 The mutation process appears to
target certain specific sequence motifs, such as RGYW (A/G G C/T
A/T).5 In addition, the nucleotides vulnerable for mutation
may be associated with the features of the neighboring sequences, such
as repeat sequences and/or palindromic
structures.6,7 Although the mechanisms underlying the
mutation process are not fully understood, the research to date
indicates that mutation activity is coupled with the transcription
process but does not depend specifically on the presence of the Ig
promoter or the Ig coding sequence.8,9 Whether the mutation
process depends specifically on the Ig enhancer elements remains to be
tested. Somatic hypermutation of the Ig gene is believed to be a
locus-specific, differentiation-stage specific, and lineage-specific
phenomenon. However, in view of the fact that the Ig promoter and
coding sequence are not specifically required, the hypermutation
process may not target only the Ig gene. We have studied mutations in
the 5' noncoding region of the Bcl6 gene in various B-cell lymphomas
and different cell populations microdissected from normal lymphoid
follicles and found unequivocal evidence of non-Ig gene mutation in
normal germinal center but not in naive mantle B cells.
| |
MATERIALS AND METHODS |
Materials.
Frozen and paraffin-embedded tissue blocks from 125 cases of lymphoma
were retrieved from the Department of Histopathology, University
College London Medical School. They comprised 59 follicular, 45 mucosa-associated lymphoid tissue (MALT), and 21 mantle cell lymphomas.
Frozen tonsil tissue from a 25-year-old woman was also retrieved from
the departmental tissue bank.
Microdissection and DNA extraction.
The percentage of malignant cells was estimated by histological
examination. The follicular and mantle cell lymphomas
contained at least 60% tumor cells, whereas most MALT
lymphomas contained only 10% to 60% of tumor cells. For
these latter cases, tumor cells were enriched by
microdissection.10 Germinal center and mantle B cells
were separately microdissected from a frozen section of tonsil
immuno-stained for IgD (Fig 1). DNA
extraction was performed as described elsewhere.10,11
View larger version (125K):
[in this window]
[in a new window]
| Fig 1.
Microdissection of germinal center (A) and naive B cells
(B) of the mantle zone. Frozen sections of a tonsil were immuno-stained
for IgD to highlight mantle cells. Germinal center cells were directly
microdissected (the hole), whereas mantle cells were first isolated
(the island) then harvested.
|
|
Polymerase chain reaction-single strand conformation polymorphism
(PCR-SSCP).
The 5' noncoding region (a 1.3-kb fragment 112 bp downstream of the
promoter) of the Bcl6 gene was amplified by five different overlapped
PCR reactions using the previously published primer sets (E1.7, E1.8,
E1.10, E1.11, and E1.12, Fig
2A).12 The PCR reaction mix
consisted of 1 µL DNA extract, 10 mmol/L Tris (pH 8.3), 50 mmol/L
KCl, 1.5 mmol/L MgCl2, 0.1% Triton X-100, 200 µmol/L of
each dNTP, 5 pmol of each primer, 0.001% gelatin, and 0.25 U Taq
polymerase (Promega, Southampton, UK) in a total volume of 25 µL.
Amplification was performed on a thermal cycler (Hybaid, Teddington,
UK) using a hot-start procedure,13 followed by a touch down
program, comprising a cycle of 94°C for 30 seconds, 66°C (then
reducing 1°C per cycle to 56°C) for 30 seconds and 72°C for 45 seconds, and 35 further cycles with an annealing temperature of 55°C.
PCR products (3 µL) were checked for yield and size on 1% agarose
gels before further analysis.
View larger version (53K):
[in this window]
[in a new window]
| Fig 2.
The schematic illustration of the positions of the PCR
primers (A) and the distribution of the somatic mutation in the 5'
noncoding region of the Bcl6 gene (B). MCL, mantle cell lymphoma; FL,
follicular lymphoma; MALT, MALT lymphoma; MC, mantle cell; FC, follicle
centre cell. ( ) Mutation.
|
|
For cell populations microdissected from tonsil, the 1.3-kb fragment of
the 5' noncoding region of the Bcl6 gene was amplified using primers
GGAAAGCAAAGCGCACTC and CACGATACTTCATCTCATC. In addition, a fragment of
151 bp from the coding region of the house-keeping gene iduronate
2-sulfatase (IDS) (humids.gp_pr) was amplified as a control,
using primers CCAAAGAAGGGAGGGTCCAC and AGACCAGCTATACGGAGAATCACC. Both
Bcl6 and IDS PCR products were cloned into pGEM-T vector and transformed into JM109 competent cells (Promega). The resulting colonies were boiled in 50 µL of distilled water at 95°C for 10 minutes before a brief centrifuge and 1 µL of the subsequent
supernatant was used as template for PCR amplification as above.
For SSCP analysis, 2 µL of PCR products was mixed with 4 µL
sequencing loading buffer (98% formamide, 10 mmol/L NaOH, 20 mmol/L EDTA, 0.05% bromophenol blue, and 0.05% xylene cyanol FF), denatured at 99°C for 5 minutes on a hot plate, and separated on the Genphor electrophoresis system (Amersham-Pharmacia Biotech, Little Chalfont, UK) under 15 W constant power for 2 to 3 hours at 5°C.
Sequencing and sequence analysis.
The PCR products showing altered SSCP patterns were purified using the
Wizard PCR purification system (Promega) and directly sequenced using
an ABI 377 sequencer (Perkin Elmer, Warrington, UK) with dye
terminators, according to the manufacturer's protocol. Mutations were
identified by comparison with the published Bcl6 gene sequence (Z79581)
using web-based BLAST programme (http://www.ncbi.nih.gov/blast). The
RGYW hot motif and features of the neighboring sequences, such as
repeat sequences and palindromic structures, in the region with
mutations were analysed by sequence searching and/or using Wisconsin
GCG software (Human Genomic Mapping Project, Cambridge, UK), as
described previously.5-7
| |
RESULTS |
Bcl6 gene is mutated in lymphomas derived from antigen experienced but
not in those from naive B cells.
Following a recent report of somatic mutation in the 5' noncoding
region of the Bcl6 gene in follicular lymphoma,12 we
screened this region for mutation in various lymphomas derived from B
cells at different maturation stages using PCR-SSCP and sequencing. Mutation was frequently found in follicular (25 of 59 = 42%) and MALT (19 of 45 = 42%) lymphomas, both of which are derived from antigen-experienced B cells. However, mutation was only occasionally observed in mantle cell (1 of 21 = 4.8%) lymphomas, which originate from naive B cells (Table 1). Most
mutations were outside the motifs potentially important for
transcription. Details of these mutations are presented below.
Bcl6 is mutated in normal germinal center but not in naive B cells.
To examine whether Bcl6 mutation also occurs in normal B cells, the
1.3-kb fragment of the 5' noncoding region of the Bcl6 gene, together
with a fragment of 151 bp of the housekeeping gene IDS, was
PCR-amplified and cloned from microdissected germinal center and mantle
B cells. In initial experiments, DNA from four colonies was mixed and
subjected to PCR-SSCP and a total of 96 clones from each cell
population were screened for Bcl6 mutation. Single or multiple abnormal
SSCP bands were observed in each mixture from germinal center B cells,
but in only one from the naive B cells of the mantle zone.
Subsequently, we repeated the PCR-SSCP analysis of the Bcl6 gene on 24 single colonies from each cell population, followed by sequencing.
Mutation was found in 13 clones (13 of 48 = 54%) from the germinal
center but only in 1 (1 of 24 = 4%) from mantle cells (Fig
3). However, no mutation was found in 48 clones of the control gene IDS from either cell population.
View larger version (138K):
[in this window]
[in a new window]
| Fig 3.
PCR-SSCP analysis of the 5' noncoding region E1.11 of the
Bcl6 gene in a reactive tonsil. Abnormal SSCP bands were shown in
clones 1, 2, 4, 5, 10, 16, and 17 from follicular center cell (B), but
in none from mantle cell (A) populations.
|
|
Bcl6 mutations resemble those found in the rearranged Ig gene.
Because the Bcl6 mutations found in follicular and MALT lymphoma most
likely inherited from their malignant precursor cells, like the Ig gene
mutation, and there was no significant difference in the
characteristics of Bcl6 mutation between these lymphomas and germinal
center B cells as shown by separate analysis, the data were thus
combined. In total, 103 mutations were found among 56 Bcl6 sequences
(mutations from mantle cell lymphoma and normal mantle cells were not
included). The distribution of these mutations was nonrandom. The great
majority (83 of 103 = 80.6%) were localized in a region of 603 bp
spanning the E1.10 and E1.12 (Fig 2B) and the overall frequency of
mutation in this region was 11.3 × 10 4/bp. The details
of the mutation frequency in different lymphomas and normal cell
populations of a reactive tonsil are shown in Table 1. Mutations were
nearly exclusively single substitutions, with only one being a
deletion. The majority of the substitutions (60%) were caused by
transition mutations, of which a major portion were T to C. Details of
these mutations are presented in Table 2. A
substantial proportion of substitutions (48%) were within or flanked
by the mutation hot motif RGYW (A/G G C/T A/T) found in the Ig gene on
both sides.5 Interestingly, all mutations were also within
the stem of an imperfect palindromic (hairpin) structure, and/or close
to a repeat sequence, by the previous described
standards6,7 (Fig 4). Multiple
mutations (2-4), frequently within a short sequence (<100 bp), were
observed in 31 Bcl6 sequences, accounting for 54% of the mutants.
Among germinal center B cells, two distinct mutations were shared by
two pairs of clones, respectively.
View larger version (10K):
[in this window]
[in a new window]
| Fig 4.
A T > A mutation in a follicular lymphoma (FL). The
proximity of the mutation to a (TTA)n repeat sequence (underlined) and
its localization to the stem of an imperfect hairpin structure in the
germline (GL) sequence were shown in (A) and (B), respectively.
|
|
| |
DISCUSSION |
Following a recent report of somatic mutation in the 5' noncoding
region of the Bcl6 gene in follicular lymphoma,12 we
examined the same region for mutation in various lymphomas derived from B cells at different maturation stages. Mutation was frequently found
in lymphomas deriving from antigen-experienced B cells, namely
follicular and MALT lymphomas, but only occasionally in mantle cell
lymphomas originating from naive B cells. Most of these mutations were
outside the motifs potentially important for Bcl6
transcription.14 This, together with the rarity or absence of t(3;14)(q27;q32) and Bcl6 rearrangement in
these low-grade lymphomas,15-17 suggests that the observed
mutations were not important in lymphomagenesis but may, like Ig
mutation, represent an inherent mutation signature of the lymphoma
precursor cells.18 To investigate this, we therefore
examined their normal cell counterparts.
As expected, similar Bcl6 mutations were found in germinal center but
not in naive B cells of the mantle zone. Most or all of these mutations
were of somatic origin rather than due to a PCR error, because no
mutations were found in 48 IDS clones and the estimated PCR error rate
is less than 0.01% in our experimental system.19,20
Several features of these Bcl6 mutations resemble those found in the Ig
gene as follows. (1) Nonrandom distribution: the majority of Bcl6
mutations localize in a region of 603 bp, 723 bp downstream of the
promoter, which is in line with that of the rearranged Ig gene. In
addition, 48% of mutations are within or flanked by the Ig mutation
hot motif RGYW. (2) High frequency: the incidence of mutation in the
hot region of the Bcl6 gene was 11.3 × 104/bp, which
is far above the estimated PCR error rate in our
system,19,20 although about 100 times lower than that of
the Ig gene in the germinal center B cells (about
10%).8,21,22 (3) Nature of the mutations: like the Ig
mutation, most Bcl6 mutations were single substitutions, mainly due to
transitions. (4) Clustering: multiple mutations within a short stretch
of sequence were frequently found in the Bcl6 gene. More strikingly,
some of the Bcl6 sequences from the germinal center B cells showed both
common and unique mutations, resembling the intraclonal variations of
the Ig gene found in normal germinal center B cells.22 (5)
Effects of neighboring sequences: Mutation of the Bcl6 gene was
frequently within the stem of an imperfect hairpin structure or close
to a repeat sequence. Although these structures may not template the
mutation because mismatch repair is not closely involved in the
hypermutation process,23-25 it may induce pausing of RNA
polymerase during transcription elongation and then result in the
transfer of the putative mutator factor to this region.8
Therefore, it appears likely that Bcl6 mutation may result from the Ig
hypermutation process.
While preparing this paper, two studies have reported the occurrence of
Bcl6 mutations in normal B cells.26,27 Unlike our approach
of examining microdissected germinal center and mantle cells, they used
isolated normal B cells from peripheral blood or from tonsil and found
Bcl6 mutation in 30% to 42% of the memory but none in the naive B
cells. The complimentary data from this and the above-mentioned studies
clearly indicate that the Bcl6 mutations are introduced in germinal
center B cells and are subsequently inherited by their normal and
malignant derivatives.
The Ig hypermutation process may also target non-Ig genes of the
germinal center cells of non-B-lineage. Zheng et al28
examined germinal center T cells of the spleen from immunized mice and found frequent somatic hypermutation in T-cell receptor (TCR)  , but
not in  , chain gene. Cheynier et al29 studied T cells of
splenic white pulp from human immunodeficiency virus (HIV)-1-positive patients and demonstrated hypermutation in a proportion of TCR gene
clones. The frequency of these TCR mutations (1 to
5 × 104/bp) is similar to those seen in the Bcl6
gene of the germinal center B cells. As in the Bcl6 mutations, the TCR
gene mutations resemble those of the Ig genes.
Although several features of Bcl6 and TCR mutations resemble those of
the Ig genes, there are important differences in both the proportion of
germinal center B cells with mutations and the mutation frequency in
the affected cells between the Ig and non-Ig genes. In adults, the
rearranged Ig gene is mutated in most germinal center
cells,18,21 whereas the Bcl6 gene is mutated in only 30%
to 50% and the TCR gene is only mutated in 10% to 50% of germinal center T cells.28,29 The frequency of both Bcl6 and TCR
mutation are 100 times lower than that of the Ig gene of the germinal
center B cells. It thus appears that the Ig hypermutation process may target non-Ig genes in both germinal center B and T cells, but in an
inefficient manner. This may explain the heterogeneous incidence of
Bcl6 mutations in germinal center cells and their derivatives, and may
also underlie the lack of somatic mutations in other genes expressed in
germinal centers such as c-myc and S14 shown by Shen et
al.26 Study of the cis-acting element shared by the
Ig and Bcl6 genes but not by c-myc and S14 may provide fresh
insights into the mechanism of Ig hypermutation.26
The finding of non-Ig gene hypermutation in normal germinal center B
cells suggests imperfection of the Ig hypermutation process. Theoretically, mutation could occur in the coding region of other cellular genes, which are potentially important in cell growth and
survival. It is possible that in the case of lethal mutation, the cell
affected will die naturally, whereas in the case of nonlethal mutation
causing important cellular biological alterations, such as growth
properties, the cell affected will usually be detected and deleted.
However, if the mutation escapes from immune surveillance, it may
initiate lymphomagenesis. In this context, it is particularly interesting to note that follicular lymphomas, which are derived from
germinal center B cells, are the most common B-cell malignancy. Furthermore, a number of B-cell lymphoma subtypes such as follicular and MALT show intimate interaction of tumor cells with lymphoid follicles,30 where tumor cells frequently show high-grade
transformation30,31 and occasionally exhibit positive p53
staining.32 It is tempting to speculate that the
"infidelity" of the Ig hypermutation machinery to other cellular
genes may underlie, at least in part, the genesis and progression of
B-cell lymphomas associated with the germinal center microenvironment.
| |
ACKNOWLEDGMENT |
We thank Dr T.C. Diss (Department of Histopathology, University College
London Medical School, London, UK) for critical reading of the
manuscript. We are also grateful to Daniela Papini (Divisione Di
Anatomia Patologica, Istituto Nazionale Tumori, Milano, Italy) for her
excellent support in sequencing.
| |
FOOTNOTES |
Submitted November 12, 1998; accepted January 18, 1999.
Supported by the Cancer Research Campaign (CRC, Grant No. SP1758,
United Kingdom) and Leukemia Research Fund (LRF, 9609, United Kingdom),
and Associazionr Italiana per la Ricerca sul Cancro (AIRC, Italy).
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Ming-Qing Du, PhD, Department of
Histopathology, University College London Medical School,
Rockefeller Bldg, University St, London WC1E 6JJ, UK;
e-mail:m.du{at}ucl.ac.uk.
| |
REFERENCES |
1.
Rajewsky K:
Clonal selection and learning in the antibody system.
Nature
381:751, 1996[Medline]
[Order article via Infotrieve]
2.
Pascual V, Capra JD:
Human Immunoglobulin heavy-chain variable region genes: organization, polymorphism, and expression.
Advances in Immunology
49:1, 1991[Medline]
[Order article via Infotrieve]
3.
Storb U:
Progress in understanding the mechanism and consequences of somatic hypermutation.
Immunol Rev
162:5, 1998[Medline]
[Order article via Infotrieve]
4.
Dorner T, Foster SJ, Brezinschek H, Lipsky PE:
Analysis of the targeting of the hypermutational machinery and the impact of subsequent selection on the distriburtion of nucleotide changes in human VHDJH rearrangements.
Immunol Rev
162:161, 1998[Medline]
[Order article via Infotrieve]
5.
Rogozin IB, Kolchanov NA:
Somatic hypermutagenesis in immunoglobulin genes. II. Influence of neighbouring base sequences on mutagenesis.
Biochim Biophys Acta
1171:11, 1992[Medline]
[Order article via Infotrieve]
6.
Golding GB, Gearhart PJ, Glickman BW:
Patterns of somatic mutations in immunoglobulin variable genes.
Genetics
115:169, 1987[Abstract/Free Full Text]
7.
Winter DB, Gearhart PJ:
Dual enigma of somatic hypermutation of immunoglobulin variable genes: Targeting and mechanism.
Immunol Rev
162:89, 1998[Medline]
[Order article via Infotrieve]
8. Storb U, Peters A, Klotz E, Kim N, Shen HM, Hackett J, Rogerson
B, Martin TE: Cis-acting sequences that affect somatic hypermutation of
Ig genes. Immunol Rev 153, 1998
9.
Neuberger MS, Ehrenstein MR, Klix N, Jolly CJ, Yelamos J, Rada C, Milstein C:
Monitoring and interpreting the intrinsic features of somatic hypermutation.
Immunol Rev
162:107, 1998[Medline]
[Order article via Infotrieve]
10.
Pan LX, Diss TC, Peng HZ, Isaacson PG:
Clonality analysis of defined B-cell populations in archival tissue sections using microdissection and the polymerase chain reaction.
Histopathology
24:323, 1994[Medline]
[Order article via Infotrieve]
11.
Diss TC, Peng HZ, Wotherspoon AC, Isaacson PG, Pan L:
Detection of monoclonality in low-grade B-cell lymphomas using the polymerase chain reaction is dependent on primer selection and lymphoma type.
J Pathol
169:291, 1993[Medline]
[Order article via Infotrieve]
12.
Migliazza A, Martinotti S, Chen W, Fusco C, Ye BH, Knowles DM, Offit K, Chaganti RS, Dalla Favera R:
Frequent somatic hypermutation of the 5' noncoding region of the BCL6 gene in B-cell lymphoma.
Proc Natl Acad Sci USA
92:12520, 1995[Abstract/Free Full Text]
13.
Peng H, Chen G, Du M, Singh N, Isaacson PG, Pan L:
Replication error phenotype and p53 gene mutation in lymphomas of mucosa-associated lymphoid tissue.
Am J Pathol
148:643, 1996[Abstract]
14.
Migliazza A, Ye BH, Fracchiolla N, Neri A, Baldi L, Chaganti RSK, Dalla Favera R:
Mutations of the 5' non-coding region of the BCL-6 are common in B cell malignancies and can deregulate BCL-6 expression.
Blood
90:780, 1997 (abstr)
15.
Bernardin F, Collyn D, Quief S, Bastard C, Leprince D, Kerckaert JP:
Small deletions occur in highly conserved regions of the LAZ3/BCL6 major translocation cluster in one case of non-Hodgkin's lymphoma without 3q27 translocation.
Oncogene
14:849, 1997[Medline]
[Order article via Infotrieve]
16.
Dalla Favera R, Ye BH, Lo Coco F, Chang CC, Cechova K, Zhang J, Migliazza A, Mellado W, Niu H, Chaganti S, Chen W, Rao PH, Parsa NZ, Louie DL, Offit K, Chaganti RSK:
BCL-6 and the molecular pathogenesis of B-cell lymphoma.
Cold Spring Harb Symp Quant Biol
59:117, 1994[Medline]
[Order article via Infotrieve]
17.
Otsuki T, Yano T, Clark HM, Bastard C, Kerckaert JP, Jaffe ES, Raffeld M:
Analysis of LAZ3 (BCL-6) status in B-cell non-Hodgkin's lymphomas: results of rearrangement and gene expression studies and a mutational analysis of coding region sequences.
Blood
85:2877, 1995[Abstract/Free Full Text]
18.
Klein U, Goossens T, Fischer M, Kanzler H, Braeuninger A, Rajewsky K, Kuppers R:
Somatic hypermutation in normal and transformed human B cells.
Immunol Rev
162:261, 1998[Medline]
[Order article via Infotrieve]
19.
Ling LL, Keohavong P, Dias C, Thilly WG:
Optimization of the polymerase chain reaction with regard to fidelity: modified T7, Taq, and vent DNA polymerases.
PCR Methods Appl
1:63, 1991[Medline]
[Order article via Infotrieve]
20.
Eckert KA, Kunkel TA:
DNA polymerase fidelity and the polymerase chain reaction.
PCR Methods Appl
1:17, 1991[Medline]
[Order article via Infotrieve]
21.
Kuppers R, Zhao M, Hansmann ML, Rajewsky K:
Tracing B cell development in human germinal centres by molecular analysis of single cells picked from histological sections.
EMBO J
12:4955, 1993[Medline]
[Order article via Infotrieve]
22.
Jacob J, Kelsoe G, Rajewsky K, Weiss U:
Intraclonal generation of antibody mutants in germinal centres [see comments].
Nature
354:389, 1991[Medline]
[Order article via Infotrieve]
23.
Kim N, Storb U:
The role of DNA repair in somatic hypermutation of immunoglobulin genes.
J Exp Med
187:1729, 1998[Free Full Text]
24.
Wiesendanger M, Scharf MD, Edelmann W:
Somatic hypermutation, transcription, and DNA mismatch repair.
Cell
94:415, 1998[Medline]
[Order article via Infotrieve]
25.
Kelsoe G:
V(D)J hypermutation and DNA mismatch repair: Vexed by fixation.
Proc Natl Acad Sci USA
95:6576, 1998[Free Full Text]
26.
Shen HM, Peters A, Baron B, Zhu X, Storb U:
Mutation of BCL-6 gene in normal B cells by the process of somatic hypermutations of Ig genes.
Science
280:1750, 1998[Abstract/Free Full Text]
27.
Pasqualucci L, Migliazza A, Fracchiolla N, William C, Neri A, Baldini L, Chaganti RS, Klein U, Kuppers R, Rajewsky K, Dalla Favera R:
BCL-6 mutations in normal germinal center B cells: evidence of somatic hypermutation acting outside Ig loci.
Proc Natl Acad Sci USA
95:11816, 1998[Abstract/Free Full Text]
28.
Zheng B, Xue W, Kelsoe G:
Locus-specific somatic hypermutation in germinal centre T cells.
Nature
372:556, 1994[Medline]
[Order article via Infotrieve]
29.
Cheynier R, Henrichwark S, Wain Hobson S:
Somatic hypermutation of the T cell receptor V beta gene in microdissected splenic white pulps from HIV-1-positive patients.
Eur J Immunol
28:1604, 1998[Medline]
[Order article via Infotrieve]
30.
Isaacson PG:
Malignant lymphomas with a follicular growth pattern.
Histopathology
28:487, 1996[Medline]
[Order article via Infotrieve]
31.
Peng H, Du M, Diss TC, Isaacson PG, Pan L:
Genetic evidence for a clonal link between low and high-grade components in gastric MALT B-cell lymphoma.
Histopathology
30:425, 1997[Medline]
[Order article via Infotrieve]
32.
Du M, Peng H, Singh N, Isaacson PG, Pan L:
The accumulation of p53 abnormalities is associated with progression of mucosa-associated lymphoid tissue lymphoma.
Blood
86:4587, 1995[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. L. Duquette, M. D. Huber, and N. Maizels
G-Rich Proto-Oncogenes Are Targeted for Genomic Instability in B-Cell Lymphomas
Cancer Res.,
March 15, 2007;
67(6):
2586 - 2594.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y.-W. Chen, X.-T. Hu, A. C. Liang, W.-Y. Au, C.-C. So, M. L. Wong, L. Shen, Q. Tao, K.-M. Chu, Y.-L. Kwong, et al.
High BCL6 expression predicts better prognosis, independent of BCL6 translocation status, translocation partner, or BCL6-deregulating mutations, in gastric lymphoma
Blood,
October 1, 2006;
108(7):
2373 - 2383.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Liso, D. Capello, T. Marafioti, E. Tiacci, M. Cerri, V. Distler, M. Paulli, A. Carbone, G. Delsol, E. Campo, et al.
Aberrant somatic hypermutation in tumor cells of nodular-lymphocyte-predominant and classic Hodgkin lymphoma
Blood,
August 1, 2006;
108(3):
1013 - 1020.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Dijkman, C. P. Tensen, M. Buettner, G. Niedobitek, R. Willemze, and M. H. Vermeer
Primary cutaneous follicle center lymphoma and primary cutaneous large B-cell lymphoma, leg type, are both targeted by aberrant somatic hypermutation but demonstrate differential expression of AID
Blood,
June 15, 2006;
107(12):
4926 - 4929.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
O. Margalit, H. Amram, N. Amariglio, A. J. Simon, S. Shaklai, G. Granot, N. Minsky, A. Shimoni, A. Harmelin, D. Givol, et al.
BCL6 is regulated by p53 through a response element frequently disrupted in B-cell non-Hodgkin lymphoma
Blood,
February 15, 2006;
107(4):
1599 - 1607.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. S. Abramson and M. A. Shipp
Advances in the biology and therapy of diffuse large B-cell lymphoma: moving toward a molecularly targeted approach
Blood,
August 15, 2005;
106(4):
1164 - 1174.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Pasqualucci, R. Guglielmino, J. Houldsworth, J. Mohr, S. Aoufouchi, R. Polakiewicz, R. S. K. Chaganti, and R. Dalla-Favera
Expression of the AID protein in normal and neoplastic B cells
Blood,
November 15, 2004;
104(10):
3318 - 3325.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Katzenberger, G. Ott, T. Klein, J. Kalla, H. K. Muller-Hermelink, and M. M. Ott
Cytogenetic Alterations Affecting BCL6 Are Predominantly Found in Follicular Lymphomas Grade 3B with a Diffuse Large B-Cell Component
Am. J. Pathol.,
August 1, 2004;
165(2):
481 - 490.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Gaidano, L. Pasqualucci, D. Capello, E. Berra, C. Deambrogi, D. Rossi, L. Maria Larocca, A. Gloghini, A. Carbone, and R. Dalla-Favera
Aberrant somatic hypermutation in multiple subtypes of AIDS-associated non-Hodgkin lymphoma
Blood,
September 1, 2003;
102(5):
1833 - 1841.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Niu, G. Cattoretti, and R. Dalla-Favera
BCL6 Controls the Expression of the B7-1/CD80 Costimulatory Receptor in Germinal Center B Cells
J. Exp. Med.,
July 21, 2003;
198(2):
211 - 221.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Pasqualucci, A. Migliazza, K. Basso, J. Houldsworth, R. S. K. Chaganti, and R. Dalla-Favera
Mutations of the BCL6 proto-oncogene disrupt its negative autoregulation in diffuse large B-cell lymphoma
Blood,
April 15, 2003;
101(8):
2914 - 2923.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Gurrieri, P. McGuire, H. Zan, X.-J. Yan, A. Cerutti, E. Albesiano, S. L. Allen, V. Vinciguerra, K. R. Rai, M. Ferrarini, et al.
Chronic Lymphocytic Leukemia B Cells Can Undergo Somatic Hypermutation and Intraclonal Immunoglobulin VHDJH Gene Diversification
J. Exp. Med.,
September 2, 2002;
196(5):
629 - 639.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
TOP
ABSTRACT
INTRODUCTION