|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 7 (April 1), 1999:
pp. 2253-2260
Molecular Analysis of the ERGIC-53 Gene in 35 Families With
Combined Factor V-Factor VIII Deficiency
By
M. Neerman-Arbez,
K.M. Johnson,
M.A. Morris,
J.H. McVey,
F. Peyvandi,
W.C. Nichols,
D. Ginsburg,
C. Rossier,
S.E. Antonarakis, and
E.G.D. Tuddenham
From the Department of Genetics and Microbiology, Division of Medical
Genetics, University of Geneva Medical School; Haemostasis Research
Group, MRC Clinical Sciences Centre, Imperial College School of
Medicine, London, UK; the Division of Medical Genetics, Cantonal
Hospital of Geneva, Switzerland; Bonomi Haemophilia and Thrombosis
Center, IRCCS Maggiore Hospital and University of Milano, Italy; and
the Department of Medicine, Howard Hughes Medical Institute, University
of Michigan, Ann Arbor, MI.
 |
ABSTRACT |
Combined factor V-factor VIII deficiency (F5F8D) is a rare,
autosomal recessive coagulation disorder in which the levels of both
coagulation factors V and VIII are diminished. The F5F8D locus was
previously mapped to a 1-cM interval on chromosome 18q21. Mutations in a candidate gene in this region, ERGIC-53, were recently found to be associated with the coagulation defect in nine Jewish families. We performed single-strand conformation and
sequence analysis of the ERGIC-53 gene in 35 F5F8D families of
different ethnic origins. We identified 13 distinct mutations
accounting for 52 of 70 mutant alleles. These were 3 splice site
mutations, 6 insertions and deletions resulting in translational
frameshifts, 3 nonsense codons, and elimination of the translation
initiation codon. These mutations are predicted to result in synthesis
of either a truncated protein product or no protein at all. This study
revealed that F5F8D shows extensive allelic heterogeneity and all
ERGIC-53 mutations resulting in F5F8D are "null." Approximately 26% of the mutations have not been identified, suggesting that lesions
in regulatory elements or severe abnormalities within the introns may
be responsible for the disease in these individuals. In two such
families, ERGIC-53 protein was detectable at normal levels in
patients' lymphocytes, raising the further possibility of defects at
other genetic loci.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
COMBINED FACTOR V-factor VIII deficiency
(F5F8D) (MIM 227310) is a rare, recessive coagulation disorder
characterized by reduction in levels of both factor V and factor VIII,
to less than 20 U/dL.1-4 The severity ranges
from mild (factor V and VIII levels of 10 to 20 U/dL) to moderate
(levels 5 to 10 U/dL).5 Linkage of the F5F8D locus to human
chromosome 18q was reported in nine nonAshkenazi Jewish families by
homozygosity mapping6 and by classical linkage analysis in
19 families of Irani, Pakistani, and Algerian origin.7 The
same locus was, therefore, implicated in different ethnic groups. The
difference in clinical severity and the lack of a specific haplotype in
the second group of families,7 in contrast to two distinct
founder haplotypes reported by Nichols et al,6 suggested
the existence of allelic heterogeneity, ie, that more than one mutation
was responsible for the disease in this sample of families. Critical
recombination events localized the F5F8D gene to an interval of
approximately 1 cM, between markers D18S849 and
D18S1103.7 ERGIC-53, which had been previously mapped to
this region8 and codes for a 53-kD transmembrane protein
resident in the endoplasmic reticulum-Golgi intermediate compartment,9 was shown by mutation analysis to be the gene responsible for F5F8D.1 Two mutations were identified. All Sephardic Jewish patients from five families tested were homozygous for
a donor splice site mutation leading to premature protein truncation,
and all patients from four Middle Eastern Jewish families had a single
base pair insertion at codon 30. In Epstein-Barr virus (EBV)
transformed cell lines from these patients, Western blotting and
immunofluorescence analysis indicated complete absence of ERGIC-53
expression.1 To investigate the molecular origin of this
coagulation disorder we have studied 35 additional F5F8D families from
different ethnic backgrounds by single-strand conformational analysis
(SSCA) and sequencing of polymerease chain reaction (PCR) products of
exons 1-13 and flanking intronic sequences of the ERGIC-53 gene. As
expected from our previous haplotype analysis,7 numerous
mutations in the ERGIC-53 gene were found to be responsible for the disease. All 13 identified discrete mutations were predicted to
lead to a deficiency or absence of functional protein. These mutations
accounted for a total of 52 of 70 mutant alleles (74%). In addition, a
number of polymorphisms were identified, some of which result in amino
acid changes.
| |
MATERIALS AND METHODS |
Description of families.
Blood was collected from 16 families from Iran, 6 families of Pakistani
origin, 8 from Italy, 2 of Chinese origin, and 1 each from Algeria,
Britain, and South Africa (Table
1). Informed consent was
obtained from all families. The majority of Iranian and Pakistani families were consanguineous (19 of 22) involving first cousin marriages. Factor V and factor VIII assays were performed by a one-stage procedure by using congenitally deficient plasma substrates and normal pooled plasma as reference.10 The levels of
factor V:C and factor VIII:C detected in the plasma of affected
individuals are shown in Table 1.
DNA isolation and PCR amplification.
Genomic DNA was purified from blood leukocytes, according to standard
protocols. The ERGIC-53 gene structure was determined by PCR and
sequence analysis as described in another report (Nichols et
al,11 this issue). For the mutation screening,
one affected patient from each family (35 individuals) and four normal
individuals were used. The ERGIC-53 gene was analyzed by PCR
amplification of all 13 exons, including intron-exon junctions (with
the exception of the intron 7-exon 8 junction). The primers used for
the PCR amplifications (5' > 3') are shown in Table
2.
Single-strand conformational analysis.
Each sample was analyzed independently with either small- or
large-format polyacrylamide gels:
(1) PCR was performed from genomic DNA in a total volume of 15 µL,
containing 2.6 pmol of each primer, 1.3 µmol/L of each dNTP, and 0.25 U Taq polymerase. After denaturation at 94°C, the amplification
program consisted of 10 touchdown cycles of 30 seconds denaturation at
94°C, 30 seconds annealing between 60 and 50°C, and 30 seconds
elongation at 72°C followed by 20 cycles (30 seconds 94°C, 30 seconds 50°C, 30 seconds 72°C). Ten additional cycles were then
performed in a new reaction on an aliquot (2 µL) of the first PCR to
reduce the amount of genomic DNA versus amplified product before SSCA.
PCR products were denatured with an equal volume of denaturation buffer
(95% formamide, 0.05% xylene cyanol, 0.05% bromophenol blue) for 10 minutes at 94°C. A 6-µL sample of each was then loaded on a 12.5%
GeneGel Excel (Pharmacia Biotech, St Albans, UK).
Electrophoresis was at 600 V at 12°C for 3 hours (for fragments of
approximately 300 bp: ie, exons 1, 2, 6, 7, 9, 11, 12, 13) or 2 hours
(for fragments of approximately 200 bp: ie, exons 3, 4, 5, 8, 10). The
gels were stained by DNA silver staining (Pharmacia Biotech). SSCA
variants were purified and directly sequenced with the primers used for
the amplification with a semiautomated sequencer (ABI 377; Perkin-Elmer
Applied Biosystems, Foster City, CA), using standard
protocols. Mutant alleles of heterozygous patients were cloned by using
TA cloning (Invitrogen, La Jolla, CA) and purified and sequenced as
previously described.
(2) PCR was performed from genomic DNA in a total volume of 50 µL of
50 mmol/L KCl, 10 mmol/L Tris-HCl pH 8.8, 1.5 mmol/L MgCl2,
0.1% Triton X-100 containing 150 ng of each primer, 200 µmol/L of each dNTP and 1 U of Red Hot DNA polymerase (Advanced Biotechnologies, Epsom, UK). After denaturation at 94°C for 7 minutes, 30 cycles of denaturation: 94°C, 1 minute; annealing: either
50°C or 55°C, 1 minute; extension: 72°C, 3 minutes were performed
followed by a final extension at 72°C for 10 minutes. PCR products
were labeled by the incorporation of  -33Pd-ATP (56 kBq/50 µL reaction, 377-110 Tbq/mmol; Amersham Life Science, Little
Chalfont, UK). SSCA was performed as described by Michaelides et
al12 on a 40-cm polyacrylamide gel run at 4°C. PCR
products were purified by filtration by using a Microcon 100 spin
column (Amicon, Stonehouse, UK) before direct sequencing with the
thermosequenase dye terminator cycle sequencing kit (Amersham Life
Science) according to the manufacturer's instructions and analyzed on
an Applied Biosystems 373A DNA automated sequencer (Perkin-Elmer
Applied Biosystems, Warrington, UK). The primers used for PCR and
direct sequence analysis were as in Table 2, with the exception of
(5' > 3') exon 1, F:TCGCGTTCCAGAATCCAAG, R:AGCACACCAGGGTAGCCG; exon
6, F:AGTCATAAAATGGATCGATTG, R:TTCCCAATAAAACACACCTC; and exon 8, F:TGTTAACCTTTCCGTAGTGG, R:GCTAGGCAACACAGACTCAA.
Allele-specific PCR.
The 822G > A mutation was analyzed by allele-specific PCR
amplification using the following primers: (5' > 3'):
GTAATCTCCTATGGAACTTTT and either the wild-type TTGAAAATATGTAAAATTACT or
mutant TTGAAAATATGTTTGTAAAATTACC. After denaturation at 94°C for 7 minutes, 30 cycles of denaturation: 94°C, 1 minute; annealing:
53°C, 1 minute; extension: 72°C, 3 minutes were performed followed
by a final extension at 72°C for 10 min. The products were analyzed
by electrophoresis on 2% agarose gels.
Analysis of intragenic polymorphic markers.
The G3R polymorphism was analyzed by restriction digestion of the exon
1 PCR product with BamH1 (G3, BamH1 site; R3, no
BamH1 site). Similarly, the R14Q polymorphism was analyzed by
restriction digestion of the exon 1 PCR product with EagI (R14
EagI site; Q14, no EagI site). The R117 polymorphism
was studied by SSCA of the exon 2 PCR product.
RT-PCR analysis.
Polyadenylated RNA was isolated from EBV transformed lymphocytes and
first-strand cDNA synthesis performed according to standard techniques
(Amersham Pharmacia Biotech, St Albans, UK) with 200 ng of an ERGIC-53
exon 8 specific antisense primer: 5'-TTTATCCAATTCTTGTTGAAAG-3'. Five
microliters of the reaction was used for PCR amplification with an
ERGIC-53 exon 6 specific oligonucleotide primer:
5'-AATGATCAATAATGGCTTTACA-3' and the exon 8 specific primer used for
the cDNA synthesis under the following conditions: (1) Initial
denaturation 95°C, 5 minutes then 25 cycles of denaturation, 94°C,
30 seconds; (2) Annealing, 57°C, 30 seconds; (3) Elongation, 72°C,
30 seconds, and (4) A final elongation step at 72°C, 10 minutes. A
further 5 µL of the reverse transcription (RT) was used for PCR
amplification of GAPDH by using the following oligonucleotides:
5'-TGAGTACGTCGTGGAGTCCAC-3' and 5'-ACCAGGAAATGAGCTTGACA-3'. The
products were analyzed by 2% agarose gel electrophoresis.
Western blot analysis.
ERGIC-53 protein was detected by Western blot analysis as previously
described1 on EBV transformed cell lines from affected and
carrier individuals in families A18, A19, A20, A21, A22, A25, A27, and A29.
| |
RESULTS |
A total of 35 patients, ie, one affected individual per family, were
analyzed for mutations in the ERGIC-53 gene. Each of the 13 exons and
the adjacent intron-exon boundaries of the ERGIC-53 gene were amplified
by PCR and analyzed in two laboratories by SSCA with both small and
large format polyacrylamide gels. Representative SSCA patterns of nine
mutations are shown in Fig 1. In families for whom no mutation was identified by SSCA, each exon (complete with
the flanking intronic sequences) was sequenced.
View larger version (77K):
[in this window]
[in a new window]
| Fig 1.
Examples of SSCA for nine discrete mutations in ERGIC-53.
SSCA was performed according to protocol 1 in Materials and Methods. In
each panel, the abnormal pattern caused by the mutation is in the
middle lane surrounded by two controls.
|
|
Many variant SSCA patterns were identified. For each discrete pattern,
the appropriate fragment was subjected to nucleotide sequencing. In all
cases, a particular SSCA pattern was associated with a unique sequence
difference. All heterozygous sequence variants were characterized by
direct DNA sequencing of both strands of the PCR products and, in some
cases, the PCR products were cloned and sequenced.
A total of 13 definite mutations, representing 52 of 70 F5F8D alleles,
were identified (Table 1, Fig 2). We have
confirmed the high degree of allelic heterogeneity suggested by our
previous haplotype analysis,7 which is in marked contrast
to the founder effect observed in Jewish families by Nichols et
al.1,6 The majority of the patients in whom mutations were
identified are true homozygotes rather than compound heterozygotes (25 of 26), largely because of the high degree of consanguinity found in
the parents of patients with this rare, autosomal recessive disease (Table 1).
View larger version (15K):
[in this window]
[in a new window]
| Fig 2.
Schematic representation of the ERGIC-53 gene showing
mutations causing combined F5F8D (above the gene) and normal
polymorphisms (below). Exons, indicated by rectangles, are numbered
from 1 to 13 and are drawn to scale. The coding portion of the gene is
shaded, with the white portion of exon 1 representing the 5' UTR and
the white portion of exon 13 the 3' UTR, the exact size of which is
unknown. The introns are indicated by narrow lines and are not to
scale.
|
|
Nonsense mutations.
Three different nonsense mutations were found, in exons 5, 8, and 11, accounting for a total of 20 F5F8D alleles (27% of all mutant alleles)
(Table 1, Fig 2). One of these, K302X (AAA > TAA), was homozygous
in five of the six Pakistani families studied. The other two, R202X and
R456X, were CGA to TGA mutations in accordance with the known CpG to
TpG hypermutability.13 The R456X was found in both Chinese
and Pakistani families on a different haplotype (A19 homozygous for
R117R cgg; A27 homozygous for R117R cga) showing recurrence of this mutation.
Deletions and insertions.
A total of six small deletions and insertions leading to disruption of
the reading frame and premature termination of translation were
identified, on 14 different mutant alleles (Table 1, Fig 2). These were
in exon 1, 23delG (in a G4 tract), 31delG (in a G3 tract), 89-90insG
(in a G4 tract); in exon 8, 912-913insA (in an A8 tract); in exon 10, 1208-1209insT, and 1214-1218delAAATG (deletion of one of two copies of
a repeated pentanucleotide). The 89-90insG mutation, which we found in
two Iranian families, is the common mutation of Middle Eastern Jewish
families.1
Missense mutation in the initiator ATG.
A mutation of particular interest was found in the translation
initiation codon in two Italian families from our study (Table 1, Fig
2), and four Italian families in the report by Nichols et
al.11 This ATG > ACG mutation is predicted to abolish
translation since the next in frame ATG in the coding sequence is found
in exon 6, thus leading to the complete absence of ERGIC-53, as
confirmed by Western blotting.
Splice site mutations.
Two different splice site mutations predicted to result in severe
abnormality of RNA processing and one putative splice site mutation
were identified in three different exons accounting for a total of 14 F5F8D alleles (Table 1, Fig 2). In intron
5, a G > T substitution at the invariant GT dinucleotide of the donor splice site (GT > TT) was found in homozygosity in families A34 and
A35, both from Italy. In intron 9, the donor splice site invariant dinucleotide GT was mutated to GG in both alleles of the affected members of family A4 from Iran. Both of these mutations are expected to
result in abnormal splicing of the ERGIC-53 mRNA.14 Indeed, a different mutation in the same donor splice site of intron 9 (GT > GC) was previously identified in five Sephardic Jewish
families, resulting in an apparently complete block of splicing of this intron.1
Another modification, a G > A change in the last nucleotide of exon 7 (822G > A), ie, in the  1 position of the donor splice site
consensus sequence of intron 7 was found in homozygosity in four
Iranian families: A2, A6, A9, and A12 (Table 1, Fig 2). This mutation
does not change the amino acid corresponding to the modified codon as
both CCG and CCA code for proline. However, it is possible that
abnormal splicing occurs at least in some mRNA molecules because the
sequence surrounding the splice site is modified. We screened the DNA
of 24 unaffected and the remaining 13 affected Iranians by
allele-specific PCR; none carried the mutation.
To determine the consequences of this mutation on ERGIC-53
mRNA we isolated polyadenylated RNA from lymphoblastoid cell lines from
patients: A2, A12 (both homozygous 822G > A), A24 and A25 (homozygous M1T), and one unaffected individual. cDNA synthesis was
primed by using an oligonucleotide corresponding to the antisense sequence of exon 8. RT-PCR between exons 6 and 8 followed by sequencing of the products confirmed that in A2 and A12, exons 6 and 8 were directly contiguous after the skipping of exon 7; no normal cDNA was
present. No skipping of exon 7 was observed in the other tested individuals (Fig 3). Skipping of exon 7 leads to absence of ERGIC-53 protein in lymphoblasts (Table 1, A2 and
A12).
View larger version (44K):
[in this window]
[in a new window]
| Fig 3.
(A) Cartoon representation of intron 6-intron 8 of the
ERGIC-53 gene. The primers used for the RT-PCR analysis are indicated
by an arrow and the asterisk indicates the position of the IVS7-1
mutation. Potential RT-PCR products resulting from normal splicing,
inclusion of intron 7 or skipping of exon 7 are shown. (B) Agarose gel
electrophoresis of the RT-PCR products after amplification of
polyadenylated RNA with ERGIC-53 exon 6-exon 8 specific primers and
glyceraldehyde 3-phosphate dehydrogenase (GAPDH) specific primers. The
GAPDH amplification was a control for mRNA integrity. The cDNA
synthesis was primed with the exon 8 specific primer and oligo dT. Lane
M, markers; lane 1, individual A2 (homozygous 822G > A); lane 2, individual A12 (homozygous 822G > A); lane 3, human endothelial
cell line; lane 4, unaffected individual; lanes 5, 6, and 7, affected
individuals with the M1T mutation; lane 8, no DNA control. The arrow
marks the normally spliced product. The asterisk marks the incorrectly
spliced product. (C) DNA sequence chromatograms of: 1, the incorrectly
spliced product, resulting from skipping of exon 7, observed in RT-PCR
of polyadenylated lymphoblastoid RNA from individual A12; 2, the major
product observed in RT-PCR of polyadenylated RNA from a human
endothelial cell line. The exon boundaries are indicated by an arrow.
|
|
Polymorphisms.
The SSCA and nucleotide sequence analysis showed several common
polymorphisms in the ERGIC-53 gene that result in amino acid substitutions. These substitutions are not associated with nor do they
cause F5F8D because they were found in homozygosity in normal
individuals, or in affected alleles in which another, deleterious, mutation was also present. These polymorphisms are R14Q (CGG to CAG),
V39A (GTC to GCC), T153S (ACT to TCT), and M410L (ATG to TTG) (Fig 2).
In addition there is a common CGA to CGG polymorphism at the Arg codon
117 that does not result in an amino acid substitution. Furthermore, a
deletion of 2 Ts at nucleotides 16-17 of IVS4 was also commonly
observed. These polymorphisms may be useful in linkage studies
involving chromosome 18q21. In our study, these polymorphisms allowed
us to confirm the compound heterozygosity (ie, two different mutations
on the two ERGIC-53 alleles) observed in the Iranian patient A3 (Table
1) because this patient was also heterozygous for the R14Q and R117 polymorphisms.
In Iranian family A14, there was a nucleotide substitution G to A at
codon 3 resulting in an amino acid substitution glycine to arginine.
This substitution is within the hydrophobic 30-amino acid signal
sequence. This substitution was not present in the DNA of any other
affected individual from the Iranian sample and was not present in 24 unaffected Iranian individuals tested.
Western blot analysis of ERGIC-53 protein levels.
Western blot hybridization confirmed the absence of detectable
ERGIC-53 protein for two nonsense mutations (K302X, R456X) and one missense mutation (M1T), (Table 1 and Fig
4). It also showed the presence of
detectable ERGIC-53 protein in individuals A21 and A29, two patients
with no detectable mutation in the ERGIC-53 coding sequence and
flanking intron-exon boundaries.
View larger version (44K):
[in this window]
[in a new window]
| Fig 4.
Western blot analysis of ERGIC-53 protein levels in
selected families with F5F8D (see Table 1 for the nature of the
ERGIC-53 mutation present in each affected individual). N indicates a
normal control, lanes C1 and C2 are two different mutations from
reference 1 (C1: 86-89insG; C2 IVS9 + 2 T > C). The arrow
indicates the position of the ERGIC-53 protein band. Normal levels of
ERGIC-53 protein were also found in two unaffected family members from
family A19.
|
|
| |
DISCUSSION |
In this study we have analyzed the ERGIC-53 gene in 35 families with
F5F8D. We have confirmed that mutations in the ERGIC-53 gene are
definitely responsible for the deficiency in 74% of the families
analyzed. In contrast to the two distinct founder mutations found to be
responsible for the disorder in Sephardic and Middle Eastern Jewish
families, we identified 13 distinct mutations accounting for 52 mutant
alleles in F5F8D families of multiple ethnic origins. There were 3 different splice site mutations, 6 insertions and deletions resulting
in translational frameshifts, 3 nonsense mutations, and a missense
mutation in the initiator methionine. In addition we also identified
several amino acid polymorphisms.
One of the splice site mutations, found in homozygosity in four Iranian
families but absent in 74 other Iranian alleles tested, was situated at
position 1 of the donor splice site consensus sequence of intron 7 (822G > A). At this position in the consensus donor splice site, G
is found in 78% and A in only 10% of mammalian genes; therefore, we
confirmed by RT-PCR analysis that this modification leads to exon
skipping and loss of the open reading frame. There are 56 known G to A
mutations in the 1 nucleotide of the donor splice site in human
genes associated with disorders14 (Human Gene Mutation
Database; http://www.uwcm.ac.uk/uwcm/mg/hgmd0.html), including factor
V, factor VII, factor VIII, and factor IX. Abnormal splicing was
studied in several of these cases and the resulting exon skipping
ranged from 30% to 100%. In addition, use of cryptic donor splice
sites has been reported as resulting in translational frameshift and
abnormal protein.14,16
One of the sequence differences, G3R, which was found in homozygosity
in one Iranian family (A14) but was absent in 80 other Iranian alleles
tested, is within the 30-amino acid signal sequence and may be either a
polymorphism or a causative mutation. This position is not highly
conserved. For example, the rat sequence contains valine at position 3 (Genbank no. U44129). The G3R substitution does not change the
probability that the first 30 amino acids is a signal peptide
(http://psort.nibb.ac.jp; http://www.cbs.dtu.dk/services/SignalP). However, it is now recognized that signal sequences have a more complex
structure than previously anticipated, allowing for multiple and
independent interactions with the translocation machinery17 (see Note Added in Proof).
There appears to be little or no correlation between the precise
mutation and the severity of the F5F8D phenotype because (1) all
identified mutations are predicted to lead to an absence of mature
protein and (2) some recurrent mutations were found in association with
strikingly different levels of factor V and factor VIII (compare, for
example, families A6 and A12 or families A26 and A30).
The human ERGIC-53 is a 53-kD transmembrane resident protein of the
ER-Golgi intermediate compartment, a distinctive vesicular organelle in
the secretory pathway.18 The protein is homologous to
leguminous lectins, presenting mannose-selective and calcium-dependent binding.19-21 Additional ERGIC-53 homologues have
been identified in the rat, Xenopus laevis, and
Caenorhabditis elegans22,23 (Genbank accession
no. Z81097). The importance of ERGIC-53 protein in the efficient
secretion of the coagulation factors V and VIII has clearly been
established by its causative role in F5F8D (data presented in this
report, the accompanying report by Nichols et al,11 and
reference 1). Factor V and factor VIII are homologous proteins that
share a conserved domain structure, having derived from a common
ancestor molecule, with the A and C domains of the two factors showing
40% sequence identity.24,25 Both factor V and factor VIII
are subject to extensive posttranslational modification, which includes
the addition of multiple oligosaccharide residues, predominantly in the
B-domain. Therefore, ERGIC-53 most probably interacts with the
B-domains of factor V and factor VIII via a lectin like linkage. All of
the mutations in ERGIC-53 described to date are null mutations.
However, there is still some factor V and factor VIII activity in the
plasma of the affected individuals, suggesting that there may be
several bypass mechanisms for the transport of factor V and factor VIII
from the ER to the Golgi. ERGIC-53 may also be required for the
secretion of many other glycoproteins whose loss is not sufficient to
cause a clinically recognizable phenotype.
Although we have identified approximately 74% of the mutations
responsible for F5F8D in our patient sample, 26% of the mutations have
not been identified despite screening by SSCA with two different experimental conditions and sequencing the entire coding sequence and
intron-exon boundaries of the ERGIC-53 gene. These results are similar
to those reported by Nichols et al11 in the accompanying report, with no mutations found in the ERGIC-53 gene in 8 of 19 families. A number of explanations are possible for this incomplete detection. The missing mutations may be located within intronic regions
that were not analyzed in the current study, leading, for example, to
aberrant splicing or other RNA anomalies, or in regulatory regions
situated up to several hundred kilobases away from the ERGIC-53 gene.
Such mutations could only be identified by detailed investigation of
ERGIC-53 transcripts in the remaining families.
However, a number of observations strongly support an alternative
explanation, which is the existence of mutations at other, currently
unidentified, loci. First, in all but one of the consanguineous families in whom we have identified ERGIC-53 mutations, as
expected the patients are true homozygotes. In contrast, in two of the three consanguineous (first-cousin marriage) families in whom no
mutations were identified, the affected individuals are heterozygous for the ERGIC-53 gene according to intragenic and flanking
polymorphisms7 (families A5: heterozygous for R14Q and
R117, and A13: heterozygous for R14Q and M410L). Secondly, affected
individuals from another two families with no identified ERGIC-53
mutations (A21 and A29) have normal levels of ERGIC-53 according to
Western blotting. The existence of further loci responsible for F5F8D
is currently under investigation.
| |
NOTE ADDED IN PROOF |
Immunofluorescence analysis of cells expressing introduced genes for
ERGIC-53 with wild-type or mutated (G3R) leader sequences showed no
difference in signal peptide cleavage or distribution of protein.
Hence, G3R cannot be the cause of disease in family A14. (Hans-Peter
Hauri, personal communication, Basel, Switzerland.)
| |
ACKNOWLEDGMENT |
We thank all members of these families for their cooperation and for
donating blood samples for our study. We are grateful to Dr L. Tengborn, Salgrenska University Hospital, Göteborg, Sweden; Dr
E.A.C. Chalmers, Royal Hospital for Sick Children, Glasgow, UK; Dr S.D.
Wright, Watford General Hospital, Watford, UK; Dr P. Giangrande, Oxford
Haemophilia Centre, Oxford, UK; Dr M. Makris, Sheffield Haemophilia and
Thrombosis Centre, Sheffield, UK; Dr L.A. Parapia,
Bradford Royal Infirmary, Bradford, UK; Dr J. Wilde, Haemophilia Unit,
University Hospital, Birmingham, UK; Dr M.J. Strevens, Walsgrave
Hospital, Coventry, UK; Dr Steven P. Field, South African Blood
Transfusion Service, Johannesburg, South Africa. Prof L.C. Chan,
University of Hong Kong, Hong Kong; Dr M. Morfini, Haemophilia Centre,
Florence, Italy; Dr A. Gringeri, Haemophilia and Thrombosis Centre,
Milan, Italy; Dr J. Reynaud, Hopitaux de St-Etienne, France, for the
collection of families, and to Drs S. Zeinali, M. Akhtari, M. Lak, and
R. Sharifan, Haemophilia Center and Haematology
Department, Imam Khomeini Hospital, Tehran, Iran for their generous
assistance to EGDT and FP. We also thank Dr H-P. Hauri (Biozentrum,
Basel, Switzerland) for the gift of the anti-ERGIC-53 antibody and
ERGIC-53 cDNA. We thank Dr Philip Chandler for his help in establishing
lymphoblastoid cell lines and Dr Anni Schönbörner for DNA extractions.
| |
FOOTNOTES |
Submitted September 6, 1998; accepted November 12, 1998.
M.N.-A. and K.M.J. contributed equally to this study.
M.N.-A. is a recipient of a Marie Heim-Voegtlin grant from the Swiss
National Science Foundation. Supported by National Institutes of Health
(NIH) Grant No. HL38165, funds from the University and Cantonal
Hospital of Geneva and grant FN 31-49815.96 from the Swiss National
Science Foundation (M.A.M.). Haemostasis Research Group is supported by
the UK Medical Research Council. W.C.N. and D.G. are supported by NIH
Grants No. R01-HL39693 and P01-HL57346. D.G. is a Howard Hughes Medical
Institute Investigator.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to E.G.D. Tuddenham, MD, Haemostasis Research
Group, MRC Clinical Sciences Centre, Imperial College School of
Medicine, DuCane Rd, London W12 ONN, e-mail: etuddenh{at}hgmp.mrc.ac.uk.
| |
REFERENCES |
1.
Nichols WC, Seligsohn U, Zivelin A, Terry VH, Hertel CE, Wheatley MA, Moussalli MJ, Hauri H-P, Ciavarella N, Kaufman RJ, Ginsburg D:
Mutations in the gene for ERGIC-53, a protein of the endoplasmic reticulum-Golgi intermediate compartment, cause combined deficiency of coagulation factors V and VIII.
Cell
93:61, 1998[Medline]
[Order article via Infotrieve]
2.
Seligsohn U, Ramot B:
Combined factor V and factor VIII deficiency: Report of four cases.
Br J Haematol
16:475, 1969[Medline]
[Order article via Infotrieve]
3.
Mazzone D, Fichera A, Pratico G, Sciacca F:
Combined congenital deficiency of factor V and factor VIII.
Acta Haematol
68:337, 1982[Medline]
[Order article via Infotrieve]
4.
Ozsoylu S:
Combined congenital deficiency of factor V and factor VIII.
Acta Haematol
70:207, 1983[Medline]
[Order article via Infotrieve]
5.
Seligsohn U:
Combined factor V and factor VIII deficiency, in
Seghatchian J,
Savidge GT
(eds):
Factor VIII-von Willebrand factor. New York, NY, CRC, 1989, p 89.
6.
Nichols WC, Seligsohn U, Zivelin A, Terry VH, Arnold ND, Siemieniak DR, Kaufman RJ, Ginsburg D:
Linkage of combined factors V and VIII deficiency to chromosome 18q by homozygosity mapping.
J Clin Invest
99:596, 1997[Medline]
[Order article via Infotrieve]
7.
Neerman-Arbez M, Antonarakis SE, Blouin J-L, Zeinali S, Afshar Y, Tuddenham EGD:
The locus for combined factor V-factor VIII deficiency (F5F8D) maps to 18q21, between D18S849 and D18S1103.
Am J Hum Genet
61:143, 1997[Medline]
[Order article via Infotrieve]
8.
Arar C, Mignon C, Mattei M, Monsigny M, Roche A, Legrand A:
Mapping of the MR60/ERGIC-53 gene to human chromosome 18q21.3-18q22 by in situ hybridization.
Mamm Genome
7:791, 1996[Medline]
[Order article via Infotrieve]
9.
Schindler R, Itin C, Zerial M, Lottspeich F, Hauri H-P:
ERGIC-53, a membrane protein of the ER-Golgi intermediate compartment, carries an ER retention motif.
Eur J Cell Biol
61:1, 1993[Medline]
[Order article via Infotrieve]
10.
Dacie JV, Lewis SM:
Practical Haematology (ed 8). Edinburgh, UK, Churchill Livingstone, 1995, p 326.
11.
Nichols WC, Terry VH, Wheatley MA, Yang A, Zivelin A, Ciavarella N, Stefanile C, Matsushita T, Saito H, de Bosch NB, Ruiz-Saez A, Torres A, Thompson AR, Feinstein DI, White GC, Negrier C, Vinciguerra C, Aktan M, Kaufman RJ, Ginsburg D, Seligsohn U:
ERGIC-53 gene structure and mutation analysis in 19 combined factors V and VIII deficiency families.
Blood
93:2261, 1999[Abstract/Free Full Text]
12.
Michaelides K, Schwaab R, Lalloz MRA, Schmidt W, Tuddenham EGD:
Mutational analysis: New mutations, in
McPherson MJ,
Hames BD,
Taylor GR
(eds):
PCR2. A Practical Approach. Oxford, UK, IRL, Oxford University Press, 1995, p 255.
13.
Youssoufian H, Kazazian HH Jr, Phillips DG, Tsiftis G, Brown VA, Antonarakis SE:
Recurrent mutations in haemophilia A give evidence for CpG mutation hotspots.
Nature
324:380, 1986[Medline]
[Order article via Infotrieve]
14.
Krawczak M, Reiss J, Cooper DN:
The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: Causes and consequences.
Hum Genet
90:41, 1992[Medline]
[Order article via Infotrieve]
15.
Krawczak M, Cooper DN:
The Human Gene Mutation Database.
Trends Genet
13:121, 1997[Medline]
[Order article via Infotrieve]
16.
Sakuraba H, Eng CM, Desnick RJ, Bishop DF:
Invariant exon skipping in the human alpha-galactosidase A pre-mRNA: A g + 1 to t substitution in a 5'-splice site causing Fabry disease.
Genomics
12:643, 1991
17.
Belin D, Bost S, Vassalli JD, Strub K:
A two-step recognition of signal sequences determines the translocation efficiency of proteins.
EMBO J
15:468, 1996[Medline]
[Order article via Infotrieve]
18.
Schweizer A, Fransen JAM, Matter M, Kreis TE, Ginsel L, Hauri H-P:
Identification of an intermediate compartment involved in protein transport from endoplasmic reticulum to Golgi apparatus.
Eur J Cell Biol
53:185, 1990[Medline]
[Order article via Infotrieve]
19.
Fiedler K, Simons K:
A putative novel class of animal lectins in the secretory pathway homologous to leguminous lectins.
Cell
77:625, 1994[Medline]
[Order article via Infotrieve]
20.
Arar C, Carpentier V, Le Caer JP, Monsigny M, Legrand A, Roche AC:
ERGIC-53, a membrane protein of the endoplasmic reticulum-Golgi intermediate compartment, is identical to MR60, an intracellular mannose-specific lectin of myelomonocytic cells.
J Biol Chem
270:3551, 1995[Abstract/Free Full Text]
21.
Itin C, Roche AC, Monsigny M, Hauri H-P:
ERGIC-53 is a functional mannose-selective and calcium-dependent human homologue of leguminous lectins.
Mol Biology Cell
7:483, 1996[Abstract]
22.
Lahtinen U, Hellman U, Wernstedt C, Saraste J, Pettersson RF:
Molecular cloning and expression of a 58-kDa cis-Golgi and intermediate compartment protein.
J Biol Chem
271:4031, 1996[Abstract/Free Full Text]
23.
Saraste J, Palade GE, Farquhar MG:
Antibodies to rat pancreas Golgi subfractions: Identification of a 58-kD cis-Golgi protein.
J Cell Biol
105:2021, 1987[Abstract/Free Full Text]
24.
Gitschier J, Wood WI, Goralka TM, Wion KL, Chen EY, Eaton DH, Vehar GA, Capon DJ, Lawn RM:
Characterization of the human factor VIII gene.
Nature
312:326, 1984[Medline]
[Order article via Infotrieve]
25.
Cripe LD, Moore KD, Kane WH:
Structure of the gene for human coagulation factor V.
Biochemistry
31:3777, 1992[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
B. Zhang, M. Spreafico, C. Zheng, A. Yang, P. Platzer, M. U. Callaghan, Z. Avci, N. Ozbek, J. Mahlangu, T. Haw, et al.
Genotype-phenotype correlation in combined deficiency of factor V and factor VIII
Blood,
June 15, 2008;
111(12):
5592 - 5600.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Nyfeler, Y. Kamiya, F. Boehlen, K. Yamamoto, K. Kato, P. de Moerloose, H.-P. Hauri, and M. Neerman-Arbez
Deletion of 3 residues from the C-terminus of MCFD2 affects binding to ERGIC-53 and causes combined factor V and factor VIII deficiency
Blood,
February 1, 2008;
111(3):
1299 - 1301.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Zhang, B. McGee, J. S. Yamaoka, H. Guglielmone, K. A. Downes, S. Minoldo, G. Jarchum, F. Peyvandi, N. B. de Bosch, A. Ruiz-Saez, et al.
Combined deficiency of factor V and factor VIII is due to mutations in either LMAN1 or MCFD2
Blood,
March 1, 2006;
107(5):
1903 - 1907.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Spatuzza, M. Renna, R. Faraonio, G. Cardinali, G. Martire, S. Bonatti, and P. Remondelli
Heat Shock Induces Preferential Translation of ERGIC-53 and Affects Its Recycling Pathway
J. Biol. Chem.,
October 8, 2004;
279(41):
42535 - 42544.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. M. Mannucci, S. Duga, and F. Peyvandi
Recessively inherited coagulation disorders
Blood,
September 1, 2004;
104(5):
1243 - 1252.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Z. Miao, N. Sirachainan, L. Palmer, P. Kucab, M. A. Cunningham, R. J. Kaufman, and S. W. Pipe
Bioengineering of coagulation factor VIII for improved secretion
Blood,
May 1, 2004;
103(9):
3412 - 3419.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
O. Nufer, S. Mitrovic, and H.-P. Hauri
Profile-based Data Base Scanning for Animal L-type Lectins and Characterization of VIPL, a Novel VIP36-like Endoplasmic Reticulum Protein
J. Biol. Chem.,
April 25, 2003;
278(18):
15886 - 15896.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
O. Nufer, S. Guldbrandsen, M. Degen, F. Kappeler, J.-P. Paccaud, K. Tani, and H.-P. Hauri
Role of cytoplasmic C-terminal amino acids of membrane proteins in ER export
J. Cell Sci.,
January 2, 2002;
115(3):
619 - 628.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Neerman-Arbez, P. de Moerloose, C. Bridel, A. Honsberger, A. Schonborner, C. Rossier, K. Peerlinck, S. Claeyssens, D. Di Michele, R. d'Oiron, et al.
Mutations in the fibrinogen Aalpha gene account for the majority of cases of congenital afibrinogenemia
Blood,
July 1, 2000;
96(1):
149 - 152.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Hauri, F Kappeler, H Andersson, and C Appenzeller
ERGIC-53 and traffic in the secretory pathway
J. Cell Sci.,
January 2, 2000;
113(4):
587 - 596.
[Abstract]
[PDF]
|
|
|
|
|
|
|
K. Kaushansky
Blood: New designs for a new millennium
Blood,
January 1, 2000;
95(1):
1 - 6.
[Full Text]
[PDF]
|
|
|
|
|
|
|
U. Hedner, D. Ginsburg, J. M. Lusher, and K. A. High
Congenital Hemorrhagic Disorders: New Insights into the Pathophysiology and Treatment of Hemophilia
Hematology,
January 1, 2000;
2000(1):
241 - 265.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Moussalli, S. W. Pipe, H.-P. Hauri, W. C. Nichols, D. Ginsburg, and R. J. Kaufman
Mannose-dependent Endoplasmic Reticulum (ER)-Golgi Intermediate Compartment-53-mediated ER to Golgi Trafficking of Coagulation Factors V and VIII
J. Biol. Chem.,
November 12, 1999;
274(46):
32539 - 32542.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W. C. Nichols, V. H. Terry, M. A. Wheatley, A. Yang, A. Zivelin, N. Ciavarella, C. Stefanile, T. Matsushita, H. Saito, N. B. de Bosch, et al.
ERGIC-53 Gene Structure and Mutation Analysis in 19 Combined Factors V and VIII Deficiency Families
Blood,
April 1, 1999;
93(7):
2261 - 2266.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION