|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 7 (April 1), 1999:
pp. 2327-2335
An Alternatively Spliced Form of CD79b Gene May Account for Altered
B-Cell Receptor Expression in B-Chronic Lymphocytic Leukemia
By
A. Alfarano,
S. Indraccolo,
P. Circosta,
S. Minuzzo,
A. Vallario,
R. Zamarchi,
A. Fregonese,
F. Calderazzo,
A. Faldella,
M. Aragno,
C. Camaschella,
A. Amadori, and
F. Caligaris-Cappio
From Dipartimento di Scienze Biomediche e Oncologia Umana,
Università di Torino; Divisione Universitaria di Immunologia
Clinica e Allergologia, Ospedale Mauriziano Umberto I°, Torino;
Laboratorio di Immunologia Oncologica, IRCC, Candiolo;
IST-Biotechnology Section, Padua; Dipartimento di Scienze Oncologiche e
Chirurgiche, Sezione di Oncologia, Università di Padova, Padova;
and Dipartimento di Scienze Cliniche e Biologiche, Università di
Torino, Torino, Italy.
 |
ABSTRACT |
Several functional anomalies of B-chronic lymphocytic leukemia
(B-CLL) cells may be explained by abnormalities of the B-cell receptor
(BCR), a multimeric complex formed by the sIg homodimer and the
noncovalently bound heterodimer Ig /Ig (CD79a/CD79b). Because the
expression of the extracellular Ig-like domain of CD79b has been
reported to be absent in the cells of most CLL cases, we have
investigated the molecular mechanisms that may account for this defect.
Peripheral blood lymphocytes (PBL) from 50 patients and two cell lines
(MEC1, MEC2) obtained from the PBL of one of them were studied. MEC1,
MEC2, and 75% of CLL cases did not express detectable levels of the
extracellular Ig-like domain of CD79b, which was nevertheless present
in greater than 80% CD19+ cells from normal donors. In
healthy subjects the expression of CD79b was equally distributed in
CD5+ and CD5 B-cell subsets. Reverse
transcription-polymerase chain reaction (RT-PCR) analysis of CD79b RNA
from all patients and from MEC1 and MEC2 cell lines consistently
yielded two fragments of different size (709 bp and 397 bp). The 709-bp
band corresponds to CD79b entire transcript; the 397-bp band
corresponds to an alternatively spliced form lacking exon 3 that
encodes the extracellular Ig-like domain. Both fragments were also
visible in normal PBL. The expression of the 397-bp fragment was
increased in normal activated B cells, while no difference was seen
between CD5+ and CD5 B cells. To obtain a
more accurate estimate of the relative proportions of the two spliced
forms, a radioactive PCR was performed in 13 normal and 22 B-CLL
samples and the results analyzed using a digital imager. The mean value
of the CD79b to the CD79b internally deleted ratio was 0.64 ± 0.20 SD
in normal donors and 0.44 ± 0.27 SD in B-CLL (P = .01).
Direct sequencing of 397-bp RT-PCR products and of genomic DNA
corresponding to exon 3 from MEC1, MEC2, their parental cells, and five
fresh B-CLL samples did not show any causal mutation. Single-strand
conformation polymorphism analysis of exon 3 performed in 18 additional
B-CLL cases showed a single abnormal shift corresponding to a
TGT TGC polymorphic change at amino acid 122. We propose a role
for the alternative splicing of CD79b gene in causing the reduced
expression of BCR on the surface of B-CLL cells. As normal B cells also
present this variant, the mechanism of CD79b posttranscriptional
regulation might reflect the activation stage of the normal B cell from
which B-CLL derives.
© 1999 by The American Society of Hematology.
 |
INTRODUCTION |
B-CHRONIC LYMPHOCYTIC leukemia (B-CLL) is
characterized by the relentless accumulation of monoclonal
CD5+ B cells that express most of the membrane antigens
(Ag) present on mature B cells, including activation markers, and have
a number of distinctive features.1 First, they express
faint to virtually undetectable amounts of surface immunoglobulins
(sIg)2 often reacting to self-Ag.3 Second, they
have an unusual kinetic hyporesponsiveness.4,5 The
mitogenic signals that induce the proliferation of normal B cells are
very weak stimuli for B-CLL cells. Third, an important mechanism of
B-CLL cell accumulation is a defective apoptosis that leads to extended
cell survival.3,5 Finally, B-CLL cells fail to present
soluble and allo-Ag,6,7 whereas normal B cells upon
activation are effective Ag-presenting cells.8
Abnormalities of the B-cell receptor (BCR) may conceivably provide a
common explanation for all of these functional anomalies. The BCR of
mature B cells is a multimeric complex that is formed by the sIg
homodimer and the noncovalently bound heterodimer Ig /Ig (CD79a/CD79b).9,10 Both CD79a and CD79b have an
extracellular part that forms an Ig-like domain and binds to
sIg.11 The heterodimer is both essential and sufficient for
Ig to reach the membrane9-12 and is the signal transducing
unit of the BCR.13-15 Also, CD79a and CD79b function
synergistically to induce apoptosis mediated via the BCR.16
Further, they influence Ag internalization and increase the efficiency
of Ag presentation.17
It was first noted that B-CLL cells have defective BCR-mediated signal
transduction.18 Next, it was shown that the monoclonal antibody (MoAb) SN8,19 which identifies an epitope on the
extracellular domain of CD79b, fails to react with malignant B cells in
more than 95% of B-CLL patients.20 The diminished display
of BCR on the membrane of B-CLL cells has been recently ascribed to
either reduced amounts of CD79b mRNA or the occurrence of somatic
mutations predicted to affect CD79b expression.21
A CD79b truncated form ( CD79b) which arises by alternative splicing
of the CD79b gene has been described in a variety of human B cells and
B-cell lines22,23; of interest, this variant lacks exon 3 that encodes the extracellular Ig-like domain. The precise functional
significance of CD79b is incompletely defined and its potential
significance in B-cell malignancies has not been explored. In the
present work we have investigated the molecular mechanisms that may
account for the absent expression of the extracellular Ig-like domain
of CD79b in CLL and show that all cases are characterized by the
presence of the CD79b mRNA that lacks the extracellular domain.
Direct sequencing of B-CLL samples did not reveal causal mutations of
the CD79b gene. We propose a role for the alternative splicing of CD79b
gene in causing the reduced expression of BCR on the surface of B-CLL cells.
 |
MATERIALS AND METHODS |
Cells and cell lines.
Peripheral blood lymphocytes (PBL) from 50 patients with B-CLL were
studied. According to the Rai staging system,24 8 patients were stage 0, 7 stage I, 13 stage II, 7 stage III, and 15 stage IV. All
patients were studied either before or at least 3 months after chemotherapy.
Two B-CLL cell lines, MEC1 and MEC2, that grew spontaneously on two
subsequent occasions from the PB of a patient with B-CLL in
prolymphocytoid transformation (A. Stacchini, F. Caligaris-Cappio, manuscript submitted) were analyzed. The patient was
Epstein-Barr virus (EBV)-seropositive, his leukemic cells were
Epstein-Barr nuclear antigen (EBNA) , but
the spontaneously grown cell lines are EBNA-2+ as judged by
polymerase chain reaction (PCR). In liquid culture MEC1 cells grow
adherent to the container wall and as tiny clumps; MEC2 cells do not
adhere and form large clumps. The doubling time of MEC1 is 40 hours and
of MEC2 is 31 hours. Both cell lines express the same light ( ) and
heavy chains (µ, ) as the fresh parental B-CLL cells at the same
high intensity and share the expression of mature B-cell markers (CD19,
CD20, CD21, CD22). CD5 is negative on MEC1 cells (as on the vast
majority of parental cells) and it has been lost by MEC2. The tumor
origin of MEC1 and MEC2 has been shown by Southern Blot analysis of the
IgH loci and by Ig gene DNA sequencing. The cells use the VH4 Ig
family, have 94.8% homology with germ-line Ig gene 4-59, and display a
complex karyotype.
The controls were: (1) Daudi, Raji, and Jurkatt cell lines; (2) four
EBV-induced cell lines (lymphoblastoid cell lines [LCL]) obtained
from four different normal donors; (3) fresh unstimulated PBL from 14 normal donors; (4) B lymphocytes purified from the PB of three normal
donors and stimulated in vitro with murine fibroblastic L cells stably
expressing both human CD40 ligand (L) and CD32/Fc RII (CD40L/CD32-L
cells, kind gift of Dr J. Banchereau, Dardilly, France) (see below);
and (5) CD5+ B cells purified from tonsils of three young
adults undergoing tonsillectomy after antibiotic treatment.
Cell separation.
PBL were obtained by separation on Ficoll-Hypaque (FH; Pharmacia-LKB,
Uppsala, Sweden) gradient and washed twice in phosphate-buffered saline (PBS).
Tonsils were teased with blunt forceps: cell suspensions were washed
with RPMI 1640 medium and adhered to plastic for 1 hour. The
nonadherent cells were rosetted with Sheep red blood cells (SRBC) and
spun onto FH for 30 minutes. The cells at the interphase (SRBC , adherent cell-depleted and thus B-cell-enriched
lymphocytes) were further reacted with a cocktail of CD3 (Leu 4; Becton
Dickinson, Mountain View, CA; cat. no. 7340), CD11b (Leu 15; Becton
Dickinson; cat. no. 7550), CD14 (Leu M3; Becton Dickinson;
cat. no. 7490) MoAbs. CD3+, CD11b+, and
CD14+ cells were removed by goat (G)-anti-mouse
(m)-IgG-coated magnetic beads. The remaining elements (>96%
CD19+ B cells) were reacted with CD5 MoAb and fractionated
into CD19+, CD5+, and CD19+,
CD5 cells by G-anti-m-IgG-coated
magnetic beads. The same technique was used to purify, within
B-cell-enriched populations, CD19+, SN8+ from
CD19+, SN8 cells.
Cell phenotyping.
An aliquot of cells was resuspended in PBS containing 1% bovine serum
albumin (BSA; Sigma, St Louis, MO) and 0.02% sodium azide (staining
medium) at the concentration of 10 × 106/mL. An
appropriate amount of fluorochrome-labeled antibody (Ab), at optimal
concentration, was added to 100 µL cell suspension. Negative controls
were incubated with isotype irrelevant Abs. After 30 minutes of
incubation at 4°C, cells were washed twice with 2 mL of staining
medium and resuspended for flow cytometric analysis.
Different combinations of Abs were used in direct or indirect
immunofluorescence (IF). G antisera to human (h) µ, , , and chains, directly conjugated with fluorescein-isothiocyanate (FITC;
Tago, Burlingame, CA; cat. no. 4202, 4205, 4206, 4208). The m MoAbs
used were CD5-FITC (Leu1; Becton Dickinson; cat. no. 7303),
CD19-phycoerythrin (PE) (Leu12; Becton Dickinson; cat. no. 9209),
CD23-PE (Leu20; Becton Dickinson, cat. no. 7797), CD3-FITC (Leu 4;
Becton Dickinson; cat. no. 92-0001), HLA-DR-PE (Becton Dickinson; cat.
no. 7367), CD79b-FITC (clone SN8; Dako, Glostrup, Denmark; cat. no.
F7137), and CB3-125 (kind gift of M.D. Cooper, Howard
Hughes Medical Institute, Birmingham, AL). Cell populations were
considered CD79b+ if greater than 30% of the cells stained
with the MoAb.20 The degree of intensity of sIg, SN8, and
CB3-1, analyzed according to Matutes et al,26 was estimated
in a histogram data display and compared to the control without Ab
selecting the log scale in the fluorescence axis and geometric
statistics. Accordingly, the staining intensity was defined weak (w)
when the positive peak was within the first logarithmic percentile and
bright (b) when the peak was within the third percentile or more.
To evaluate the possibility that the epitope detected by SN8 might be
present in the cytoplasm, cells were first preincubated with 20 µL
unconjugated SN8 (Dako; cat. no. 7136) to saturate CD79b molecules
present on the membrane. After 30 minutes cells were washed with
staining medium, fixed, and permeabilized with the Caltag Fix and Perm
Cell Permeabilization kit (Caltag Laboratories, San Francisco, CA)
according to the manufacturer's instructions. Permeabilized cells were
incubated with 10 µL CD79b-FITC for 30 minutes at 4°C, washed, and
resuspended for flow cytometric analysis. Negative controls were
performed by incubating cells with isotype irrelevant Abs: m-IgG1
(Dako; cat. no. x931) and m-IgG1-FITC (Dako; cat. no. x0927).
Flow cytometric analysis.
All samples were analyzed using a FACScan Research cytometer (Becton
Dickinson) equipped with a 488 nm argon ion laser (Becton Dickinson Immunocytometry Systems [BDIS], Mountain
View, CA). Data acquisition was performed using the FACScan Research
Software (BDIS). Forward light scattering, orthogonal light scattering, and two fluorescence signals were determined for each cell and stored
in listmode data files. Each measurement contained at least 5,000 cells. In all samples a gate was used on both light scattering parameters to obtain more events of lymphocyte populations.
Analysis of the fluorescence histograms was performed by the
Kolmogorov-Smirnov test.27 The test was used for the
calculation of the D value with the FACScan software, version 2.1-3/89
(Becton Dickinson). The D value corresponded to the maximum difference between the two summation curves computed from the histograms, whereas
D/S(n) indicated the similarity of the two noncompared curves. The
closer D/S(n) was to zero, the more alike the two curves were. The
formula was: S(n) = (n1 + n2)/n1 × n2, where n1 equalled the number of events in
the first graph and n2 equalled the number of events in the
second graph. A D/S(n) value >10 was considered statistically
significant.27
Lymphocyte stimulation.
PBL from normal donors were left for 1 hour to allow cell adherence to
the plastic. The nonadherent cells were rosetted with SRBC and spun
onto FH for 30 minutes. The cells at the interphase (SRBC lymphocytes) were collected, washed twice with
RPMI medium, and reacted with a cocktail of CD3, CD11b, CD14 MoAbs.
CD3+, CD11b+, and CD14+ cells were
removed by G-anti-m-IgG-coated magnetic beads. The remaining cells
were greater than 95% CD19+ and were cultured in 96-well
flat-bottom plates (Falcon, Oxnard, CA) at the concentration of 5 × 104 cells/well in the presence of 5 × 103
irradiated (7,500 rad) CD40L/CD32-L cells and 100 U/mL interleukin-4 (IL-4) as described.28
RNA isolation and Northern blot analysis.
Total cellular RNA was isolated by RNAzolB procedure (Biotecx
Laboratories, Friendswood, TX). Denatured total RNA
samples (15 µg/well) were fractionated on a 1.5% formaldehyde
containing agarose gel, transferred to a nitrocellulose filter, and
hybridized with 32dCTP-labeled probe corresponding to the
coding region of the CD79b gene (709-bp fragment, see Fig
1) in 3× SSC (1× SSC = 0.15 mol/L NaCl, 0.015 mol/L Na citrate, pH 7.0), 0.2% sodium dodecyl sulfate (SDS), 1× Denhart's solution, 100 µg/mL denatured
salmon sperm DNA, and 50% formamide, at 42°C for 18 hours. The
filters, washed twice under stringent conditions (0.1% SSC, 0.1% SDS)
at 54°C, were exposed to Kodak X-OMAT films (Eastman Kodak,
Rochester, NY) for 1 to 14 days at 80°C.

View larger version (34K):
[in this window]
[in a new window]
| Fig 1.
Strategy to amplify CD79b cDNA by RT-PCR and results.
(Top) Numbers above the cDNA scheme represent nucleotide (nt) position
(with 1 corresponding to the initiation ATG codon). Numbers below the
scheme indicate amino acid (Aa) position. Ig domain indicates the
extracellular domain, TM the transmembrane, and CYTO the cytoplasmic
segment. Positions of the primers are shown by the arrows. (Bottom)
RT-PCR analysis showing the two detected fragments: 709 bp and 397 bp.
Lanes 1 through 3 and 5 through 8, different CLL cases; lane 4, normal
PBL.
|
|
Reverse transcription-(RT-PCR) and cDNA analysis.
Two micrograms of total cellular RNA was reverse-transcribed using 12.5 U of AMV-RT (Promega, Madison, WI) and 0.5 µg of
(oligo)dT as primer for 45 minutes at 42°C.
PCR was performed in a 50-µL reaction mixture containing 5 µL of
the obtained cDNA fragments, 25 pmol of primers, 1 U of Thermus Aquaticus (Taq) polymerase (AmpliTaq; Perkin-Elmer, Branchburg, NJ), 200 mmol/L of dNTPs (Pharmacia Biotech, Uppsala, Sweden), and GENE
Amp 10× PCR Buffer II (Perkin-Elmer). The conditions of PCR were: 1 cycle at 95°C for 3 minutes, followed by 25 cycles at 94°C for 1 minute-65°C for 30 seconds-72°C for 1 minute and a final extension
cycle at 72°C for 7 minutes. Amplified products were analyzed by
1.5% agarose electrophoresis gel and visualized under UV rays after
ethidium bromide staining.
Primers used to amplify CD79b cDNA were designed to encompass all the
coding region as shown in Fig 1. Their sequence was: A = 5'
GTGACCATGGCCAGGCTGGCGTTGT 3' and B = 5' GGCGACCTGGCTCTCACTCCTGGC 3'
corresponding, respectively, to nucleotides 11-35 and nucleotides 696-719 in the cDNA sequence29 (accession no. M80461). To amplify the 3' UTR region the primers used were: C = 5'
GGAAGAGTCCCAGAACGAAT 3' at nucleotide position 304-323 and D = 5'
GCCTCCCTGGGGGTGGGAGTGGTT 3' corresponding to nucleotides 1117-1140.
In a set of experiments primer A was end-labeled with
33PATP (Amersham, Little Chalfont, UK) for 1 hour at
37°C using T4 polynucleotide kinase (USB, Cleveland, OH). Reaction
conditions for radioactive PCR with primers A/B were identical to those
described above. PCR products were electrophoresed on 5%
polyacrylamide gels. After electrophoresis, gels were dried at 80°C,
and analyzed by Instant Imager (Camberra-Packard, Grove Hills, IL) to
quantify the CD79b/CD79b ratio.
Analysis of CD79b genomic DNA.
The genomic sequences corresponding to CD79b exon 3 were analyzed by
single-strand conformation polymorphism (SSCP) and direct sequencing.
The primers used were designed on genomic sequences.30 Exon
3 was amplified into two overlapping fragments using the following primers: Ex3I F: 5' GAATGCTGAGCCTGACCTTG 3' (position 2176-2195); ex3I R: 5' TTGTCCTCAAACCGGATGCC 3' (2418-2437) (ref 30);
Ex3II F: 5' GGAAGAGTCCCAGAACGAAT 3' (2375-2394); ex3II R: 5'
GCTCTCCTGAGTGCTCTAG 3' (2601-2619) (ref 30).
SSCP of exon 3 was performed using one fifth of the PCR product adding
1 µL of 35S-dATP (Amersham) and 0.2 U of Taq polimerase
for 10 more cycles.31 After denaturation at 95°C for 5 minutes, 1 µL of the mixture was loaded on a 6% polyacrylamide gel
in the absence of glycerol. Gels were dried and exposed for 3 days at
80°C.
Direct sequencing.
Five microliters of PCR fragments was incubated with 10 U of
exonuclease I and 2 U of shrimp alkaline phosphatase (SAP) for 15 minutes at 37°C, followed by heating at 80°C for 15 minutes to
inactivate the enzymes. One microliter of the mixture was directly sequenced using a ThermoSequenase sequencing kit (Amersham Life Science, Cleveland, OH).
Restriction enzyme digestion.
PCR products were digested with the restriction enzyme CAC8 I (New
England Biolabs, Beverly, MA), according to the manufacturer's recommendations.
Statistical analysis.
The CD79b/ CD79b ratio in CLL patients versus healthy donors was
compared by both the Mann-Whitney-Wilcoxon and the Kruskal-Wallis statistical tests.
 |
RESULTS |
CD79b protein expression.
We used SN8 MoAb in double staining with CD19 to evaluate the
expression of the extracellular domain of CD79b on the cell surface of
MEC1 and MEC2 cell lines, and 40 fresh CLL samples (Table
1). All cases coexpressed CD5, CD19, and
CD23 on the surface of most cells. Thirty-one samples had faint sIgM;
12 of them also expressed very low levels of sIgD. In 4 cases the sIg
amount was too low to be discernible. The remaining 5 cases expressed µ (3 cases) or µ, (2 cases) heavy chains with strong intensity.
The two cell lines MEC1 and MEC2, obtained from the PBL of one of these
patients (patient 34, Table 1), retained the same intensity of sIg
expression as fresh PBL.
MEC1 and MEC2 were SN8 (<1% positive cells); the
proportion of SN8+ elements among parental cells was 3.6%.
Consistent with the observation of a larger study,20 30 of
40 CLL cases (75%) were SN8 (Table 1; Fig
2). However, in a number of cases (10 of
40: 25%) more than 30% of the cells stained (albeit weakly) with SN8,
thereby indicating a variability more pronounced than expected (Table 1). Such a variability may merely reflect the smaller number of cases
analyzed compared with literature data.20 SN8 positivity was unrelated to disease stage as well as to sIg isotype and intensity. In 10 cases CD19+ malignant cells were tested in double
staining with both SN8 and CB3.1 MoAbs. Only minor differences in the
percentage of positive cells were detected. In 12 SN8
cases, the cells were also permeabilized and stained to explore the
possibility that the SN8-reactive epitope might be located in the
cytoplasm. No cytoplasmic reactivity was detected (Fig 3).

View larger version (28K):
[in this window]
[in a new window]
| Fig 2.
Cytofluorimetric analysis of CD79b expression by SN8 MoAb
in a number of different representative CLL cases. The numbers in the
upper right corner of each panel are the percentage of
CD19+, SN8+ cells.
|
|

View larger version (33K):
[in this window]
[in a new window]
| Fig 3.
Cytofluorimetric analysis of CD79b expression by SN8
MoAb. Membrane staining in CLL fresh cells, normal control, LCL, Daudi,
and Jurkatt cell lines. In the same CLL cells the possibility that the
epitope detected by SN8 might be present in the cytoplasm (Cy-CLL) was
ruled out.
|
|
Unstimulated CD19+ cells from 20 normal donors were greater
than 80% SN8+ (and CB3.1, data not shown) (Table 1 and Fig
3); the expression of SN8 was equally distributed in CD5+
and CD5 tonsil B cells (data not shown). In three normal
CD19+ B-cell samples stimulated by the CD40L/CD32-L cell
system the percentage of CD19+, SN8+ cells was
as low as 19%, 21%, and 18%, respectively. The proportion of
SN8+ cells of the four LCL cell lines from normal
individuals was less than 5% (Fig 3). Daudi (Fig 3) and Raji cells
reacted very strongly with SN8, while Jurkatt cells were completely
negative (Fig 3).
CD79b transcript analysis.
The absence or reduced expression of CD79b membrane protein led us to
examine the CD79b transcript. In agreement with literature data,32 Northern blot analysis of MEC1 and MEC2 cell lines
and five fresh B-CLL samples showed significant amounts of CD79b mRNA (data not shown).
To investigate the type of CD79b mRNA present in B-CLL, total RNA from
50 fresh samples (including the 40 cases analyzed by flow cytometry)
was retrotranscribed to cDNA and amplified by PCR using primers able to
detect the two alternatively spliced transcripts (Fig 1). Two fragments
of different size (709 bp and 397 bp) were found (Fig 1). The 709-bp
band corresponds to the expected CD79b entire transcript and the 397-bp
band corresponds to the alternatively spliced form lacking exon 3, which codes for amino acids (aa) 40-143 of the extracellular domain
(Fig 1).23 In all 50 samples examined, as well as in MEC1
and MEC2 cell lines, the 397-bp band was always detectable. The 397-bp
fragment was virtually undetectable in the Raji cell line that shows
very high levels of SN8 reactivity. As for normal PBL, both fragments
were visible. Although PCR-based techniques are not quantitative, a coamplification of two fragments using the same primers offers a rough
estimate of the amount of the corresponding template. A comparison of
normal and B-CLL samples show that the 397-bp fragment was generally
more evident in B-CLL. In normal B cells stimulated in vitro by the
CD40L/CD32-L cell system as well as in the four LCL examined, the
expression of the 397-bp fragment was increased (not shown).
Estimation of the CD79b/ CD79b mRNA ratio.
To obtain a more accurate estimate of the relative proportions of the
two spliced forms, a radioactive PCR was performed and the results were
analyzed using a digital imaging system in 13 normal and 22 B-CLL
samples. As shown in Table 2, the mean
value of the CD79b/ CD79b ratio was 0.64 ± 0.20 SD in normal donors and 0.44 ± 0.27 SD in B-CLL. The difference was statistically significant (P = .01). However, no statistically significant
correlation was observed between SN8 expression and CD79b/ CD79b
ratio.
CD79b and CD79b mRNA in normal CD5+
B cells.
Considering that most CLL are believed to originate from the
CD5+ B-cell subset,3 we investigated whether
CD79b RNA expression could be a feature of this population. To this
end, we analyzed the transcript expression on tonsil CD5+
and CD5 purified B-cell populations from three different
healthy subjects. As shown in Table 3, the
results of radioactive PCR analyzed by a digital system revealed that
both fragments were present in both B-cell subsets. Thus, the presence
on the membrane of CD5 does not discriminate B cells prevalently
expressing one of the two fragments. The relative prevalence of one of
the two forms is variable on an individual basis.
In one sample, the relative proportions of the two fragments were also
estimated on purified CD19+, SN8+ and
CD19+, SN8 cells. As shown in Fig
4, CD19+, SN8+
cells had an increased prevalence of the 709-bp band (ratio 1.51), while CD19+, SN8 cells had an increased
prevalence of the 397-bp fragment (ratio 0.52).

View larger version (75K):
[in this window]
[in a new window]
| Fig 4.
CD79b and CD79b transcript expression in normal
CD5+ compared with CD5 B cells and
CD19+, SN8+ compared with
CD19+, SN8 normal B cells. One
representative experiment of three consecutive samples is shown.
|
|
CD79b cDNA and DNA sequencing.
mRNA from MEC1 and MEC2, their parental cells (Table 1: patient 34),
five additional fresh B-CLL samples (Table 1: patients 1, 17, 18, 30, 33), and normal donor PBL amplified in RT-PCR reactions were directly
sequenced. Because of technical difficulties in obtaining material from
the 709-bp fragment sufficient for direct sequencing, the strategy
devised was to sequence the 397-bp band followed by sequencing of
genomic DNA corresponding to exon 3 to cover the coding region not
represented in the 397-bp fragment. In cell lines the 3' UTR region was
also investigated up to position 1110.
Sequence analysis of the 379-bp fragment exactly matched the reported
CD79b sequence29 and, as expected, lacked nucleotides 118-429 corresponding to exon 3. As for the genomic exon 3 analysis, at
variance with the reported sequence (30), a TGT TGC change was
observed in the third exon at position corresponding to aa 122 in all
but one of the samples examined. This silent substitution does not
change the codified cysteine and was already reported as a normal
sequence.21,29 The 3' UTR region investigated by sequencing
the two B-CLL cell lines was normal.
To confirm the absence of mutations, SSCP analysis of exon 3 was
performed in 18 further B-CLL cases. An abnormal shift was commonly
observed and shown to correspond to the TGT TGC change at aa 122. Restriction enzyme analysis with CAC8 II endonuclease, whose cleavage
site is affected by the nucleotide change, was then performed in 18 B-CLL and 6 normal samples. This analysis confirmed that that the
T C substitution is a common polymorphism.
 |
DISCUSSION |
CD79b is a crucial component of the BCR.9-17 The largest
series of B-CLL so far studied provides evidence that the membrane expression of CD79b is greatly diminished or even absent in most typical B-CLL.20 Although a certain degree of variability
exists among different series21,33 (and Table 1),
conceivably because of different MoAbs, number of patients, and
laboratory techniques, a general consensus exists on the fact that the
majority of CLL cells express low to undetectable amounts of the
extracellular epitope of CD79b. Because CD79b is essential for the
transport of Ig to the membrane,9-11 signal
transduction,13-15 and the process of
apoptosis,16 it is reasonable to predict that its absence has a central role in the pathophysiology of the disease. In this work
we have investigated the mechanisms that may cause the lack of CD79b
expression and show that CLL cells consistently have two mRNA forms:
one that corresponds to the full coding region and a form that lacks
the extracellular Ig-like domain ( CD79b). The CD79b RNA, which is
the product of alternative splicing, has been shown in a variety of
human B cells and B-cell lines using an RNAse protection
assay.22,23 Experiments of BCR reconstitution have shown
that murine fibroblast L cells transfected with CD79b cDNA fail to
express CD79b on the membrane, whereas L cells transfected with the
entire CD79b cDNA do express membrane CD79b.23 These findings establish an unequivocal relationship between the presence of
internally deleted mRNA and the absence of detectable CD79b on the
membrane. On this basis it is tempting to speculate that the formation
of CD79b mRNA lacking the extracellular domain plays a role in the BCR
phenotypic abnormalities in B-CLL.
A large array of mutations preventing the formation of functional CD79b
in mRNA clones or undetectable CD79b mRNA levels has been recently
proposed as an explanation of the reduced or absent expression of CD79b
in B-CLL.21 However, in the RT-PCR systems used,21 the internally deleted variant escaped detection as forward primers partially encompassed the deleted Ig-like domain. It is
also intriguing that no attempt was made in this study to confirm the
mutations detected on mRNA clones in the patient's genomic
DNA.21 In our experiments, direct sequencing of CD79b coding region in six B-CLL and two B-CLL cell lines did not show causal
mutations. Direct sequencing of PCR products prevents the possibility
of identifying artefactual nucleotide changes that may occur when
sequencing clones of PCR products. In addition, mutation screening by
SSCP, focused on the region encompassing exon 3, showed in our series a
single abnormal shift corresponding to a polymorphic change. Finally,
in agreement with previous findings using Northern blot,32
we have observed normal levels of CD79b mRNA in both B-CLL cell lines
and fresh samples. Taken together, our findings exclude, at least in
our ethnic group, the presence of causal mutations.
The possibility that alternative splicing may have a role in the
mechanisms that lead to the lack of CD79b expression in B-CLL is
supported by the observations on normal B lymphocytes. Resting normal B
cells, which express the CD79b extracellular epitope in more than 80%
of the elements, have been shown to have low amounts of
CD79b.23 Also, both SN8 and CD79b (Table 3) are equally distributed in normal CD5+ and CD5 B
cells, indicating that their expression is not restricted to a
phenotypically distinct B-cell subset. SN8+ normal B cells
have a prevalence of the mRNA that corresponds to the full coding
region, whereas CD79b prevails in SN8 normal B cells
(Fig 4). Our semiquantitative experiments (Table 2) document that lower
amounts of CD79b are expressed by normal unactivated B cells
compared with B-CLL cells. Activated B cells have higher levels of
internally deleted mRNA23: in these cells we have observed
that the proportion of elements that fail to express the extracellular
epitope of CD79b is also increased. High levels of CD79b are
observed in activated B cells irrespective of the activation stimuli
delivered, as they are found with the CD40L/CD32-L cell stimulation
system, with EBV and with lipopolysaccharide (LPS),23
suggesting that the process of B-cell activation per se favors the
posttranscriptional negative regulation of CD79b. In keeping with this
possibility, LCL obtained from patients with acquired immunodeficiency
syndrome (AIDS) have a decreased expression of
BCR.34,35 Even more important, lymphoid
tissue sections stained with CD79b MoAb reveal a strong staining of
mantle zone cells and a barely detectable staining of germinal centers
(GC),36 indicating that in vivo-activated GC cells are
essentially CD79b . All of these observations concur to
suggest that the mechanism of alternative splicing which produces a
CD79b form lacking the Ig-like extracellular domain is a physiological
mechanism during B-cell activation. Posttranscriptional regulation
through alternative splicing is a general mechanism that operates in
several gene systems, including the T-cell receptor37 and
several cytokine receptors,38-40 to modulate gene
expression according to the cell requirement.41 Thus, it is
conceivable that B cells physiologically use alternative splicing to
downregulate BCR expression upon activation. This would allow
proliferation and differentiation to proceed undisturbed after the
encounter with an individual triggering Ag. On these bases, it becomes
consequent to conclude that the lack of CD79b in B-CLL is not causal to
the disease, but likely reflects the state of activation of the B cell
where the malignant transformation has occurred.
The final point that needs to be discussed is the abnormality of BCR
formation that appears to characterize CLL cells. It remains to be
explained why CD79b extracellular epitope is not expressed (or
expressed at very low levels) despite the presence of some amounts of
the normal mRNA species and, conversely, why in some cases the cells
express normal levels of membrane CD79b despite the presence of the
short-sized mRNA fragment. In terms of rank distribution, the
correlation between SN8 positivity and the CD79b/ CD79b ratio is not
as strict as one would expect. However, the biochemical properties of
the protein encoded by the CD79b transcript are unknown and the half
life of both CD79b protein and mRNA are undefined. Likewise, the
dynamics of the assembly of the BCR components has been explored in
detail in Ramos cell line,34 where it has been shown that
the association of Ig heavy and light chains together with CD79a and
CD79b is required and sufficient to permit the exit of BCR complex out
of the endoplasmic reticulum.34 The dynamics and features
of BCR assembly in human fresh normal and malignant B cells are
unknown. It is possible that a threshold level of CD79b has to be
reached to disturb the proper assembly of the BCR components, a process
that appears to be profoundly disturbed in CLL cells. Irrespective of
the mechanisms operating, the emerging abnormalities of BCR
organization appear to be central to the pathophysiology of B-CLL cells
by influencing the behavior of the malignant cell population.
 |
ACKNOWLEDGMENT |
The secretarial assistance of G. Tessa, Fondazione R. Favretto, is
gratefully acknowledged.
 |
FOOTNOTES |
Submitted March 7, 1998; accepted November 17, 1998.
The first two authors contributed equally to this work.
Supported by A.I.R.C., Milano; PF Biotechnologie, CNR; MURST 40%;
MURST 60%; Grant EC-Biotec BI04CT950100.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to A. Amadori, MD, Dipartimento di Scienze
Oncologiche e Chirurgiche, Sezione di Oncologia, Via Gattamelata 64, 35128 Padova, Italy; e-mail: albido{at}uxl.unipd.it.
 |
REFERENCES |
1.
Rozman C, Montserrat E:
Chronic lymphocytic leukemia.
N Engl J Med
333:1052, 1995[Free Full Text]
2.
Ternynck T, Dighiero G, Follezou JY, Binet JL:
Comparison of normal and CLL lymphocyte surface Ig determinants using peroxidase-labeled antibodies. I. Detection and quantitation of light chain determinants.
Blood
43:789, 1974[Abstract/Free Full Text]
3.
Caligaris-Cappio F:
B-chronic lymphocytic leukemia: a malignancy of anti-self B cells.
Blood
87:2615, 1996[Free Full Text]
4.
Andreeff M, Darzynkiewicz Z, Sharpless TK, Clarkson BD, Melamed MR:
Discrimination of human leukemia subtypes by flow cytometric analysis of cellular DNA and RNA.
Blood
55:282, 1980[Abstract/Free Full Text]
5.
Nilsson K:
The control of growth and differentiation in chronic lymphocytic leukemia (B-CLL) cells, in
Cheson BD
(ed):
Chronic Lymphocytic Leukemia, Scientific Advances and Clinical Developments. New York, NY, Dekker, 1992, p 33.
6.
Ranheim EA, Kipps TJ:
Activated T cells induce expression of B7/BB1 on normal or leukemic B cells through a CD40-dependent signal.
J Exp Med
177:925, 1993[Abstract/Free Full Text]
7.
Dazzi F, D'Andrea E, Biasi G, De Silvestro G, Gaidano G, Schena M, Tison T, Vianello F, Girolami A, Caligaris-Cappio F:
Failure of B cells of chronic lymphocytic leukemia in presenting soluble and alloantigens.
Clin Immunol Immunopathol
75:26, 1995[Medline]
[Order article via Infotrieve]
8.
Lanzavecchia A:
Antigen-specific interactions between T and B cells.
Nature
314:537, 1985[Medline]
[Order article via Infotrieve]
9.
Reth M:
Antigen receptors on B lymphocytes.
Annu Rev Immunol
10:97, 1992[Medline]
[Order article via Infotrieve]
10.
van Noesel CI, van Lier RA:
Architecture of the human B-cell antigen receptors.
Blood
82:363, 1993[Free Full Text]
11.
Pleiman CM, D'Ambrosio D, Cambier JC:
The B-cell antigen receptor complex: Structure and signal transduction.
Immunol Today
15:393, 1994[Medline]
[Order article via Infotrieve]
12.
Venkitaraman AR, Williams GT, Dariavach P, Neuberger MS:
The B-cell antigen receptor of the five immunoglobulin classes.
Nature
352:777, 1991[Medline]
[Order article via Infotrieve]
13.
Clark MR, Campbell KS, Kazlauskas A, Johnson SA, Hertz M, Potter TA, Pleiman C, Cambier JC:
The B cell antigen receptor complex. Association of Ig and Ig with distinct cytoplasmic effectors.
Science
258:123, 1992[Abstract/Free Full Text]
14.
Lin J, Justement LB:
The MB-I/B29 heterodimer couples the B cell antigen receptor to multiple src family protein tyrosine kinases.
J Immunol
149:1548, 1992[Abstract]
15.
Sanchez M, Misulovin Z, Burkhardt AL, Mahajan S, Costa T, Franke R, Bolen IB, Nussenzweig M:
Signal transduction by immunoglobulin is mediated through Ig and Ig .
J Exp Med
178:1049, 1993[Abstract/Free Full Text]
16.
Tseng J, Eisfelder BJ, Clark MR:
B-cell antigen receptor-induced apoptosis requires both Ig and Ig .
Blood
89:1513, 1997[Abstract/Free Full Text]
17.
Bonnerot C, Lankar D, Hanau D, Spehner D, Davoust J, Salamero J, Fridman WH:
Role of B cell receptor Ig and Ig subunits in MHC class II-restricted antigen presentation.
Immunity
3:335, 1995[Medline]
[Order article via Infotrieve]
18.
Lankester AC, van Schijndel GMW, van der Schoot CE, van Oers MHJ, van Noesel CJM, van Lier RAW:
Antigen receptor nonresponsiveness in chronic lymphocytic leukemia B cells.
Blood
86:1090, 1995[Abstract/Free Full Text]
19.
Okazaki M, Luo Y, Han T, Yoshida M, Seon BK:
Three new monoclonal antibodies that define a unique antigen associated with prolymphocytic leukemia/non-Hodgkin's lymphoma and are effectively internalised after binding to the cell surface antigen.
Blood
81:84, 1993[Abstract/Free Full Text]
20.
Zomas AP, Matutes E, Morilla R, Owusu-Ankomah K, Seon BK, Catovsky D:
Expression of the immunoglobulin-associated protein B29 in B cell disorders with the monoclonal antibody SN8 (CD79b).
Leukemia
10:1966, 1996[Medline]
[Order article via Infotrieve]
21.
Thompson AA, Talley JA, Do HN, Kagan HL, Kunbel L, Berenson J, Cooper MD, Saxon A, Wall R:
Aberrations of the B-cell receptor B29 (CD79b) gene in chronic lymphocytic leukemia.
Blood
90:1387, 1997[Abstract/Free Full Text]
22.
Hashimoto S, Chiorazzi N, Gregersen PK:
Alternative splicing of CD79a (Ig-alpha/mb-1) and CD79b (Ig-beta/B29) RNA transcripts in human B cells.
Mol Immunol
32:651, 1995[Medline]
[Order article via Infotrieve]
23.
Koyama M, Nakamura T, Higashihara M, Herren B, Kuwata S, Shibata Y, Okumura K, Kurokawa K:
The novel variants of mb-1 and B29 transcripts generated by alternative mRNA splicing.
Immunol Lett
47:151, 1995[Medline]
[Order article via Infotrieve]
24.
Rai KR, Sawitsky A, Cronkite EP, Chanana AD, Levy RN, Pasternack BS:
Clinical staging of chronic lymphocytic leukaemia.
Blood
46:219, 1975[Abstract/Free Full Text]
25.
Nakamura T, Kubagawa H, Cooper MD:
Heterogeneity of immunoglobulin-associated molecules on human B cells identified by monoclonal antibodies.
Proc Natl Acad Sci USA
89:8522, 1992[Abstract/Free Full Text]
26.
Matutes E, Owusu-Ankomah K, Morilla R, Garcia Marco J, Houlihan A, Que TH, Catowsky D:
The immunological profile of B-cell disorders and proposal of a scoring system for the diagnosis of CLL.
Leukemia
8:1640, 1994[Medline]
[Order article via Infotrieve]
27.
Young IT:
Proof without prejudice: use of the Kalmogorov-Smirnov test for the analysis of the histograms from flow systems and other sources.
J Histochem Cytochem
25:935, 1977[Abstract]
28.
Banchereau J, Bazan F, Blanchard D, Briere F, Galizzi JP, van Kooten C, Liu YJ, Rousset F, Saeland S:
The CD40 antigen and its ligand.
Annu Rev Immunol
12:881, 1994[Medline]
[Order article via Infotrieve]
29.
Muller B, Cooper L, Terhorst C:
Cloning and sequencing of the cDNA encoding the human homologue of the murine immunoglobulin-associated protein B29.
Eur J Immunol
22:1621, 1992[Medline]
[Order article via Infotrieve]
30.
Hashimoto S, Chiorazzi N, Gregersen PK:
The complete sequence of the human CD79b (Ig /B29) gene: Identification of a conserved exon/intron organization, immunoglobulin-like regulatory regions, and allelic polymorphism.
Immunogenetics
40:145, 1994[Medline]
[Order article via Infotrieve]
31.
Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T:
Detection of polymorphisms of human DNA by gel electrophoresis as single strand conformation polymorphisms.
Proc Natl Acad Sci USA
86:2766, 1989[Abstract/Free Full Text]
32.
Verschuren MCM, Comans-Bitter WM, Kapteijn CAC, Mason DY, Brouns GS, Borst J, Drexler HG, van Dongen JJM:
Transcription and protein expression of mb-1 and B29 genes in human hematopoietic malignancies and cell lines.
Leukemia
7:1939, 1993[Medline]
[Order article via Infotrieve]
33.
Rassenti LZ, Padmanabha S, Kipps TJ:
Expression of the B cell receptor Ig beta (CD79b) in chronic lymphocytic leukemia.
Blood
90:454a, 1997
34.
Br |