Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hibino, H.
Right arrow Articles by Asano, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hibino, H.
Right arrow Articles by Asano, S.
Related Collections
Right arrow Gene Therapy
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 93 No. 9 (May 1), 1999: pp. 2839-2848

The Common Marmoset as a Target Preclinical Primate Model for Cytokine and Gene Therapy Studies

By Hitoshi Hibino, Kenzaburo Tani, Kenji Ikebuchi, Ming-Shiuan Wu, Hajime Sugiyama, Yukoh Nakazaki, Tsuyoshi Tanabe, Satoshi Takahashi, Arinobu Tojo, Shuzo Suzuki, Yoshikuni Tanioka, Yoshikazu Sugimoto, Tatsutoshi Nakahata, and Shigetaka Asano

From the Departments of Hematology/Oncology and Clinical Oncology, The Institute of Medical Science, The University of Tokyo, Tokyo; the Research Department, Hokkaido Red Cross Blood Center, Sapporo; the Central Institute for Experimental Animals, Kawasaki; the Cancer Chemotherapy Center, Japanese Foundation for Cancer Research, Tokyo; Japan.


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Nonhuman primate models are useful to evaluate the safety and efficacy of new therapeutic modalities, including gene therapy, before the inititation of clinical trials in humans. With the aim of establishing safe and effective approaches to therapeutic gene transfer, we have been focusing on a small New World monkey, the common marmoset, as a target preclinical model. This animal is relatively inexpensive and easy to breed in limited space. First, we characterized marmoset blood and bone marrow progenitor cells (BMPCs) and showed that human cytokines were effective to maintain and stimulate in culture. We then examined their susceptibility to transduction by retroviral vectors. In a mixed culture system containing both marmoset stromal cells and retroviral producer cells, the transduction efficiency into BMPCs and peripheral blood progenitor cells (PBPCs) was 12% to 24%. A series of marmosets then underwent transplantation with autologous PBPCs transduced with a retroviral vector carrying the multidrug resistance 1 gene (MDR1) and were followed for the persistence of these cells in vivo. Proviral DNA was detectable by polymerase chain reaction (PCR) in peripheral blood granulocytes and lymphocytes in the recipients of gene transduced progenitors up to 400 days posttransplantation. To examine the function of the MDR1 gene in vivo, recipient maromsets were challenged with docetaxel, an MDR effluxed drug, yet the overall level of gene transfer attained in vivo (<1% in peripheral blood granulocytes) was not sufficient to prevent the neutropenia induced by docetaxel treatment. Using this model, we safely and easily performed a series of in vivo studies in our small animal center. Our results show that this small nonhuman primate, the common marmoset, is a useful model for the evaluation of gene transfer methods targeting hematopoietic stem cells.
© 1999 by The American Society of Hematology.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

THE DEVELOPMENT of new therapeutic modalities such as cytokine therapy and gene therapy has opened a new era in the treatment of intractable diseases such as genetic disorders, cancer, and acquired immunodeficiency syndrome (AIDS). Preclinical animal models are important for evaluating the safety and therapeutic efficacy of such modalities. Murine models have been commonly used for the study of cytokine and gene transfer technology, yet murine models may not reliably predict biology in larger animals and humans. Nonhuman primate models have emerged as desirable models from both a pathophysiologic and pharmacokinetic viewpoint. Particularly in the field of gene therapy, the study of nonhuman primates can provide important information on the suitability of gene transfer vector systems in vivo before human trials are undertaken. Gene transfer studies using large nonhuman primates have been reported by several institutions.1-4 However, a practical, economical primate model is needed for institutions without the space or resouces to support a large primate colony. Such a model would accelerate basic studies of gene therapy.

For this reason, we have recently focused on a small New World monkey, the common marmoset (Callithrix jacchus). This monkey has several advantages that make it suitable for use in preclinical studies. It is small (200 to 500 g), relatively inexpensive, easy to breed, and does not require special facilities or a well-trained breeder. Furthermore, marmosets are available from inbred colonies and their use lessens the risk of infections, which may be imported from foreign countries.5 Because their basic biology is relatively close to humans, marmosets will likely provide a powerful preclinical model for gene therapy.

Several studies on the physiology and immunology of marmosets have been reported.6-9 Based on the results of these studies, the marmoset has been used in toxicology studies of new reagents, including human interleukin-6 (IL-6).10 Although various human cytokines have been studied in large nonhuman primates,11,12 there have been very few such studies in New World monkeys. Moreover, relatively little is known about the characteristics of marmoset hematopoietic stem and progenitor cells or about the effects of new reagents on marmoset hematopoiesis. Before the results of newly developed cytokines or gene therapy vectors can be extrapolated from marmosets to humans, a systematic characterization of marmoset hematopoietic stem and progenitor cells is necessary. The physiologic differences between humans and marmosets must also be elucidated.

Recent advances in the field of gene therapy have facilitated the study of various intractable disorders including hematologic disorders (eg, adenosine deaminase deficiency, thalassemia, and leukemia/lymphoma), and a number of reports have demonstrated successful gene transfer into long-term reconstituting hematopoietic stem cells in both murine and canine models.13,14 In addition, several investigators have used nonhuman primate models for evaluating the safety and efficacy of retroviral vector systems.15-18 However, the overall levels of vector containing cells attainable in both human and nonhuman primates by transplantation of hematopoietic stem cells transduced by retroviral vectors remains low compared with that of mice.1 To evaluate the in vivo efficacy of newly developed vectors for human use, it is important to first establish the optimal conditions for gene transduction into hematopoietic stem cells using nonhuman primates both in vitro and in vivo.

We first characterized marmoset bone marrow progenitor cells (BMPCs) using various human cytokines. We then determined the optimal conditions for transduction of marmoset BMPCs and peripheral blood progenitor cells (PBPCs) using a retroviral vector carrying a selectable marker gene, the multidrug resistance 1 gene (MDR1). We also showed the suitability of marmosets as a preclinical animal model for hematopoietic stem cell-based gene therapy by infusing autologous MDR1 gene-transduced PBPCs after conditioning radiation, followed by the systemic administration of an MDR-effluxed chemotherapeutic agent, docetaxel. Our results suggest that the marmoset is an appropriate model for the study of hematopoietic stem cell-based gene transfer methods suitable for laboratories where resources and space do not permit the use of larger nonhuman primate models.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Animals and preparation of bone marrow mononuclear cells.   Common marmosets were bred in the Central Institute for Experimental Animals, Kawasaki, Japan. This primate center was established in 1952 and has bred common marmosets for over 20 years. All experiments were performed according to the guidelines of The Institute of Medical Science, The University of Tokyo. Bone marrow mononuclear cells (MNCs) were isolated from femoral bone marrow cells by Ficoll-Hypaque density gradient centrifugation. Cells were frozen using a programmed freezer and stored in liquid nitrogen until use. Human bone marrow cells were collected from healthy volunteers after obtaining informed consent and prepared and frozen as described above.

Granulocyte colony-stimulating factor (G-CSF) mobilization of peripheral blood progenitor cells.   Four marmosets were treated with human G-CSF (10 µg/kg/d) subcutaneously for 5 days. Peripheral blood (500 µL to 1 mL) was obtained from the femoral vein and the number of leukocytes, neutrophils, red blood cells, platelets, hematocrit level, and hemoglobin concentration were measured with an automatic blood cell analyzer (Sysmex K-1000; Toa-iyoudenshi, Kobe, Japan). MNCs were isolated and progenitor cell assays performed in the presence of human cytokines as described below.

Progenitor cell assays.   Erythropoietin (Epo) and G-CSF were provided by Chugai Pharmaceutical Co (Tokyo, Japan); granulocyte-macrophage CSF (GM-CSF) by Hoechst Japan (Tokyo, Japan); stem cell factor (SCF) and IL-3 by Amgen (Thousand Oaks, CA); thrombopoietin (Tpo) by Kirin Brewery Co (Maebashi, Japan); and IL-6 and IL-11 by Ajinomoto Co (Kawasaki, Japan) and Genetic Institute (Cambridge, MA), respectively.

Bone marrow and peripheral blood MNCs were cultured under standard methylcellulose culture conditions. Briefly, MNCs were plated in 35-mm petri dishes in 1 mL of alpha -minimal essential medium (alpha -MEM; GIBCO-BRL, Grand Island, NY) containing 1.2% methylcellulose (Wako Chemical, Osaka, Japan), 30% fetal bovine serum (FBS; Hyclone, Logan, UT), 1% bovine serum albumin (BSA; Sigma, St Louis, MO), and 10-4 mol/L 2-mercaptoethanol (Wako Chemical) with human SCF (10 ng/mL), IL-3 (10 ng/mL), Epo (2 U/mL), and G-CSF (10 ng/mL). For serum-free cultures, MNCs were incubated with 1 mL of alpha -MEM containing 1.2% methylcellulose, 1% BSA, 10-4 mol/L 2-mercaptoethanol, 300 µg/mL iron-saturated human transferrin (Sigma), 160 µg/mL soybean lecithin (Sigma), 96 µg/mL cholesterol (Sigma), and 10-4 mol/L sodium selenite (Sigma) in the presence of various human cytokines. To examine the colony-forming effects of each cytokine, cells were incubated at 37°C for 7 to 14 days in 5% CO2, in the presence of G-CSF or GM-CSF, and in 5% CO2, 5% O2, in the presence of Epo, IL-3, or SCF. Burst-forming unit-erythroid (BFU-E), colony-forming unit-granulocyte (CFU-G), colony-forming unit-macrophage (CFU-M), colony-forming unit-granulocyte/macrophage (CFU-GM), and colony-forming unit-granulocyte/erythroid/megakaryocyte/macrophage (CFU-Mix) were enumerated following the morphologic criteria for human colonies. For colony-forming unit-megakaryocyte (CFU-MK) assays, bone marrow MNCs were cultured in a methylcellulose mixture (1.2% methylcellulose, 1% BSA, 30% human plasma, and 10-4 mol/L 2-mercaptoethanol). Human platelet-poor plasma was collected from a healthy volunteer after obtaining informed consent. Culture dishes were incubated at 37°C in 5% CO2 for 7 to 10 days. To confirm each colony component, several representative colonies were picked up and stained by standard May-Grünwald-Giemsa staining.

Gene transduction of bone marrow and peripheral blood progenitor cells.   An amphotropic retroviral vector, HaMDR1, carrying wild-type MDR1 driven by the Harvey murine sarcoma virus long terminal repeat19,20 was produced in the PA317 packaging cell 1ine. The producer cell line (PA317-HaMDR1) was maintained in Dulbecco's modified Eagle's medium (DMEM; GIBCO) with 10% FBS.

When the producer cells reached 80% confluence, the culture medium was renewed and the supernatant harvested after 24 hours. The viral supernatant was then filtered fresh through a 0.45 µm filter unit (Millipore, Bedford, MA) and used for transduction experiments. Target hematopoietic cells were cultured with or without allogeneic marmoset bone marrow stromal cells (prepared in advance) in fresh viral supernatant containing 4 µg/mL protamine sulfate (Sigma) and human cytokines (100 ng/mL SCF, 20 ng/mL IL-3, 80 ng/mL IL-6). The medium was renewed four times at 24-hour intervals. For gene transduction by cocultivation, bone marrow or peripheral blood MNCs were cultured directly on the retroviral producer cells or on a mixed population of retroviral producer cells and allogeneic marmoset bone marrow stromal cells at a ratio of 1:1 in DMEM supplemented with 10% FBS. The culture medium was supplemented with 4 µg/mL protamine sulfate, with or without human cytokines (SCF, IL-3, IL-6), and was changed every 48 hours. The cultures were maintained for 48 to 144 hours. The feeder layers were treated with 5 µg/mL mitomycin C (Sigma) over 2 hours before cocultivation with bone marrow or peripheral blood MNCs. The cells were then cultured in alpha -MEM with 10% FBS with or without cytokines for 48 hours after the cessation of infection, and then successively plated in methylcellulose culture medium as described above. Colony formation was assayed with or without 10 ng/mL vincristine (VCR; Sigma). The inhibitory effect of VCR on colony formation in untransduced bone marrow and peripheral blood MNCs was examined at increasing concentrations of VCR, with complete inhibition of colony formation at a concentration of 10 ng/mL of VCR. To confirm the correspondence between VCR resistance and the integrated MDR1 gene, representative VCR-resistant colonies were picked up and assayed by polymerase chain reaction (PCR) for the provirus as described below. The transduction efficiencies among various culture conditions were compared using a Student's t-test.

Transplantation of peripheral blood progenitor cells.   Four 2-year-old marmosets (three males and one female), bred in the Central Institute for Experimental Animals, were used in the transplantation studies. The schedule for peripheral blood progenitor cell transplantation (PBPCT) is described in Fig 1. Autologous PBPCs were obtained from G-CSF-treated marmosets at 2 months and 1 month before PBPCT. Briefly, 10 µg/kg/d of G-CSF was subcutaneously administered to individual marmosets for 5 days. Peripheral blood was then collected from each marmoset once a day for 5 consecutive days after the final G-CSF administration. MNCs were isolated by Ficoll-Hypaque centrifugation, frozen using a programmed freezer, and stored in liquid nitrogen until use. Two thirds (nos. 2 and 3) or nine tenths (no. 4) of the peripheral blood MNCs obtained from three marmosets were transduced with the MDR1 gene by the cocultivation method. Briefly, cells were cultured on feeder cells consisting of the same number of retroviral producer and stromal cells in the presence of human cytokines (IL-3, IL-6, SCF) and 4 µg/mL protamine sulfate for 48 hours from day -2 to day 0. All four marmosets received two fractionated doses (2.5 Gy each) of total body irradiation from a 60Co source on days -1 and 0. The marmosets were then infused intravenously with the transduced and untransduced PBPCs via the femoral vein within 2 hours of the second irradiation. One control marmoset received only untransduced peripheral blood MNCs, while the other three marmosets received a mixture of transduced and untransduced peripheral blood MNCs. All marmosets were orally administered 1.5 × 104 U/body polymyxin B (Pfizer, Tokyo, Japan) and 0.5 mg/body fluconazole (Pfizer) daily from day -5 and a daily intramuscular injection of 5 mg/body ampicillin (Meiji-Seika, Tokyo, Japan) from day 0 until the peripheral neutrophil count exceeded 500/µL. Peripheral blood was collected in tubes containing EDTA every 2 or 3 days from day 0 to day 30, and thereafter, every 1 or 2 weeks. Complete blood cell counts were measured for each blood sample. The S+L- assay was performed on peripheral blood samples obtained on day 46 or day 58, to rule out the appearance of replication-competent retrovirus (RCR) using PG4 cells, as described elsewhere.21


View larger version (16K):
[in this window]
[in a new window]
 
Fig 1. Protocol for MDR1 transduction, transplantation of gene transduced or untransduced marmoset peripheral blood progenitor cells, and treatment with Docetaxel.

PCR analysis of transduced gene in transplanted animals.   The presence of proviral HaMDR1 DNA was assayed by PCR analysis of genomic DNA extracted from peripheral blood or bone marrow cells in the transplanted marmosets. DNA was extracted from whole peripheral blood cells, granulocytes, or lymphocytes using a DNA extraction kit (Microtubogen; Invitrogen, San Diego, CA). A 353-bp DNA sequence specific for the HaMDR1 provirus was amplified using the sense-strand primer (F12) TGTTTCAGAATGGCAGAGTCA and the antisense-strand primer (R24) AAACAGAAAGGCGAGCAGAGA. The F12 primer is specific for the MDR1 region and the R24 primer is specific for the viral long terminal repeat region in the Ha vector. An equal amount of DNA from each sample was separately amplified using beta -globin specific primers (sense-strand primer GAAGAGCCAAGGACAGGTAC, antisense-strand primer CATCAGGAGTGGACAGATCC) yielding a 485-bp fragment of the beta -globin gene and was used as an internal control. PCR amplification was performed under the following conditions: initial denaturation at 94°C (5 minutes), followed by 35 cycles of 94°C denaturation (45 seconds), 60°C annealing (45 seconds), and 72°C extension (1 minute). The PCR products were electrophoresed on a 3% NuSieve (FMC, Rockland, ME) agarose gel and transferred to a nylon membrane (Hybond N; Amersham, Little Chalfont, UK). The membranes were then UV cross-linked. Hybridization was performed overnight at 65°C in Church's phosphate buffer containing 1 mmol/L EDTA and 7% sodium dodecyl sulfate (SDS) using a 32P-labeled MDR1 cDNA probe. The amplified products were visualized by autoradiography. Using a Bio-Imaging Analyzer (FUJIX, Tokyo, Japan), the copy number of these samples was densitometrically compared with those of a standard curve generated by amplification of a series of dilutions of DNA from the packaging cell line (PA317-HaMDR1) containing a single copy of the provirus per cell.

Treatment with Docetaxel.   Docetaxel (Rhône-Poulenc Rorer, Vitry sur Seine, France) was dissolved in ethanol, followed by the addition of polysorbate 80 (Sigma), and its final dilution was prepared in a 5% glucose (Wako) solution (1:1:18 dH2O; vol/vol/vol). Three marmosets, including one control and two recipients of gene-transduced cells in whom the proviral DNA was detectable (nos. 1, 3, and 4), were intravenously administered 2 mg/kg Docetaxel. Complete blood cell counts were obtained every 2 or 3 days, and the animals received daily intramuscular injections with 5 mg/body ampicillin until the peripheral neutrophil count reached 500/µL. The Docetaxel treatment was repeated three times at 4-week intervals.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Responses of marmoset bone marrow progenitor cells to human cytokines.   To investigate the cross-reactivity of human IL-3, GM-CSF, G-CSF, and Epo on marmoset BMPCs, we examined the effects of IL-3 on CFU-GM and BFU-E formation, GM-CSF on CFU-GM formation, G-CSF on CFU-G formation, and Epo on CFU-E formation in serum-free cultures. IL-3 and GM-CSF stimulated CFU-GM formation in a dose-dependent manner (Fig 2A and C). IL-3 also stimulated BFU-E formation (Fig 2B). The formation of CFU-G and CFU-E was stimulated in a dose-dependent manner by G-CSF and Epo, respectively (Fig 2D and E). The marmoset and human response patterns of BMPCs to human cytokines were similar. However, the frequency of CFU-GM formation in the presence of IL-3 and GM-CSF and CFU-E formation in the presence of Epo were both higher in marmoset than in human BMPCs. The frequency of BFU-E formation in the presence of IL-3 and Epo was higher in human than in marmoset BMPCs. The number of CFU-MK increased in a dose-dependent manner by treatment with Tpo (Fig 2F), and the frequency of CFU-MK formation in BMPCs was higher in marmosets than in humans.


View larger version (23K):
[in this window]
[in a new window]
 
Fig 2. Effects of human cytokines on colony formation of marmoset (bullet ) and human (open circle ) BMPCs. The effects of IL-3 on CFU-GM (A) and BFU-E (B) formation in the presence of 2 U/mL Epo, GM-CSF on CFU-GM formation (C), G-CSF on CFU-G formation (D), and Epo on CFU-E formation in the presence of 10 ng/mL IL-3 (E) were examined in serum-free cultures. The effects of Tpo were assessed using human platelet-poor plasma (F). The human cytokines effectively stimulated colony formation dose-dependently. The response patterns of BMPCs to human cytokines was similar in marmosets and humans. Data are expressed as the mean ± standard error of mean (SEM) from three separate triplicate experiments.

We next examined the effects of human SCF in the presence of other cytokines to determine the best conditions for the proliferation of more primitive progenitor cells. SCF demonstrated significant activity on marmoset BMPCs, and with IL-3 or GM-CSF, increased CFU-GM formation by 2.0-fold and 2.2-fold compared with the value obtained in the absence of SCF, respectively (Table 1). Similarly, SCF enhanced colony formation of BFU-E and CFU-Mix with IL-3 and Epo. Culture in the presence of SCF plus Epo and SCF plus IL-3 and Epo increased BFU-E formation by 2.7-fold and 3.6-fold, respectively, compared with culture with Epo alone. The combination of SCF, IL-3, and Epo increased the formation of CFU-Mix relative to SCF plus IL-3 or SCF plus Epo (Table 1). SCF also enhanced the effects of both Tpo and Tpo plus IL-3 in forming CFU-MK (Table 1). IL-6 and IL-11 also enhanced the formation of CFU-MK, but to a lesser extent. The number of CFU-MK was 11.3 ± 1.6 (/1 × 104 cells) in the presence of IL-6 and 10.3 ± 1.5 (/1 × 104 cells) in the presence of IL-11, about half the level obtained with Tpo.

                              
View this table:
[in this window]
[in a new window]
 
Table 1. Effects of Human SCF on Colony Formation of Marmoset Bone Marrow Progenitor Cells

G-CSF mobilization of peripheral blood progenitor cells.   Both the total white blood cell and neutrophil counts increased immediately after the administration of G-CSF and remained high during treatment (Fig 3A). The numbers of CFU-GM, BFU-E, and CFU-Mix in peripheral blood were highest on day 8 and were approximately 21-fold, 25-fold, and 13-fold increased over their unstimulated values, respectively (Fig 3B and C). The PBPCs increased in number from days 6 to 8 and persisted until day 10. These results show that G-CSF has potent mobilizing activity at 10 µg/kg/d in marmosets, suggesting the availability of G-CSF-mobilized PBPCs for autologous hematopoietic progenitor cell transplantation.


View larger version (18K):
[in this window]
[in a new window]
 
Fig 3. Changes of leukocytes (bullet ) and neutrophils (open circle ) in G-CSF-treated marmosets (A). Changes of CFU-GM (bullet ) (B), BFU-E (bullet ), and CFU-Mix (open circle ) (C) in peripheral blood of G-CSF-treated marmosets. First, 10 µg/kg/d of human G-CSF was administered subcutaneously for 5 days. The maximal numbers of CFU-GM, BFU-E, and CFU-Mix in peripheral blood were obtained on day 8 and were approximately 21-fold, 25-fold, and 13-fold, respectively, of the value obtained in the unstimulated state. The data shown were obtained from four animals and are expressed as the mean ± SEM.

Efficiency of transduction into bone marrow and peripheral blood progenitor cells.   The inhibitory effects of VCR on bone marrow colony formation were examined using four different marmosets, and the results are shown in Fig 4. A total of 10 ng/mL of VCR completely inhibited the colony formation, and this concentration was chosen for all subsequent experiments. After demonstrating the presence of provirus by PCR analysis in all randomly sampled VCR-resistant colonies, the appearance of VCR-resistant colonies was used for estimating gene transduction efficiency. With the supernatant transduction method, 1.7% of CFU-GM colonies became VCR-resistant. The transduction efficiency increased when the cells were transduced with the viral supernatant in the presence of bone marrow stromal cells, although the difference was not statistically significant (Table 2). The frequency of VCR-resistant colonies obtained by cocultivation with the retroviral producer cells was low despite an extended culture period (Table 2). In an attempt to increase the transduction efficiency, we mixed marmoset bone marrow stromal cells with retroviral producer cells. The frequency of VCR-resistant colonies was significantly higher when target cells were cocultured with viral producer cells and bone marrow stromal cells for each transduction period. Under these conditions, human cytokines significantly enhanced the transduction efficiency at both 96 and 144 hours (Table 2).


View larger version (13K):
[in this window]
[in a new window]
 
Fig 4. Inhibitory effects of VCR on the colony formation from normal marmoset bone marrow MNCs. A total of 10 ng/mL of VCR completely inhibited colony formation. The data shown here were obtained from four different animal experiments and are expressed as the mean ± SEM.


                              
View this table:
[in this window]
[in a new window]
 
Table 2. Efficiency of Transduction Into Marmoset Hematopoietic Progenitor Cells

The coculture of target cells on retroviral producer cells and stromal cells was also effective for the transduction of PBPCs. The frequency of VCR-resistant colonies was approximately 15% regardless of the transduction period, either 48 or 96 hours (Table 2). These results indicate that cocultivation using mixed populations of retroviral producer cells and stromal cells enhances the efficiency of transduction of the MDR1 gene into marmoset BMPCs and PBPCs.

Transplantation of gene transduced or untransduced peripheral blood progenitor cells.   The total number of autologous peripheral blood MNCs and CFU-GM harvested and frozen ranged from 2.6 × 107 to 4.5 × 107 cells and from 2.0 × 104 to 1.4 × 105 cells, respectively. The actual numbers of peripheral blood MNCs and CFU-GM transplanted into the four marmosets are summarized in Table 3. One control animal was transplanted with untransduced cells only. Three marmosets were transplanted with both transduced and a fraction of untransduced cells to ensure engraftment. In vitro progenitor cell assays showed that 6.7%, 5.9%, and 13.7% of the CFU-GM in the transduced fractions from marmoset nos. 2, 3, and 4 became VCR-resistant after MDR1 gene transduction, respectively. The total numbers of CFU-GM were decreased during the culture and transduction procedure. The calculated percentage of transduced CFU-GM infused into each animal was 2.5%, 2.1%, and 8.9%, respectively, given the coadministration of the untransduced fraction of cells. Recovery of hematopoiesis was observed in all four animals. The peripheral neutrophil count reached 500/µL on days 25, 39, and 33 in recipients of gene-transduced cells, and on day 35 in the control marmoset. The platelet count reached 5 × 104/µL on days 28, 39, and 33 in the recipients of gene-transduced cells, and on day 28 in the control marmoset. No RCR was detected in serum obtained on day 46 or day 58 in any animal by the S+L- assay using PG4 cells. One marmoset (no. 2) who received gene transduced cells died suddenly on day 63, possibly of a mechanically induced ileus due to ingestion of vinyl fragments. Autopsy of this animal showed full recovery of bone marrow hematopoiesis.

                              
View this table:
[in this window]
[in a new window]
 
Table 3. Summary of Transplanted MNC, CFU-GM, and Hematologic Recovery

Detection of transduced gene in transplanted animals.   DNA from peripheral blood or bone marrow cells from recipients of MDR1 transduced PBPCs was extracted and examined for the presence of the proviral DNA by vector specific PCR followed by Southern blotting analysis. In marmoset no. 2, peripheral blood cells from day 28 posttransplantation showed the appearance of proviral DNA, which was also detected on day 53, just before the animal's death (Fig 5A). The estimated percentage of MDR1 positive peripheral blood cells ranged from 0.2% to 0.4% by densitometric comparison with the standard DNA curve. The provirus was also detected in the blood cells of marmoset no. 3 on day 35 and on day 81 (Fig 5A). In this animal, the provirus was detected in DNA isolated from peripheral blood granulocytes and lymphocytes on day 142, and the provirus was also detected on day 412. The percentage of MDR1 positive granulocytes and lymphocytes ranged from 0.2% to 1.0%. Additionally, a bone marrow aspiration was performed on day 105, and the provirus was detected in both bone marrow MNCs and in pooled colonies (10 colonies) derived from the bone marrow MNCs (Fig 5A). In marmoset no. 4, the provirus was detected in granulocytes and lymphocytes on days 36, 74, 158, and 216 (Fig 5B). The estimated percentage of MDR1 positive granulocytes and lymphocytes ranged from 0.2% to 0.9%. These results indicate that the MDR1 gene-transduced PBPCs were capable of engraftment and prolonged contribution to hematopoiesis in vivo.


View larger version (32K):
[in this window]
[in a new window]
 
Fig 5. Detection of provirus DNA in peripheral blood cells or bone marrow cells of the transplanted marmosets. On the indicated days, DNA was obtained from each sample and analyzed for the presence of provirus DNA and beta -globin DNA as an internal control by PCR, followed by Southern blot analysis. Peripheral blood cells from day 28 and day 53 of transplantation showed the presence of provirus DNA in marmoset no. 2. The provirus was detected in marmoset no. 3 in peripheral blood cells on day 35 and day 81. In this animal, the provirus was detected both in peripheral blood granulocytes and lymphocytes on day 142 (just before the first treatment with Docetaxel) and on day 245 (just after the third treatment with Docetaxel), and the provirus was also detected on day 412. A bone marrow biopsy was performed on this marmoset on day 105; the provirus was detected in bone marrow MNCs and in pooled colonies (10 colonies) (A). The provirus DNA in granulocytes and lymphocytes was also detected from day 36 to day 216 in marmoset no. 4. Day 74 was the day before the first treatment with Docetaxel, and day 158 was the day after the third treatment with Docetaxel (B). The standard provirus DNA sample was obtained from serial dilutions of DNA from the packaging cell line, PA317-HaMDR1, containing a single copy of the provirus per cell (C). The standard beta -globin DNA sample was obtained from serial fivefold to 10-fold dilutions of DNA from normal PB (D).

Changes of peripheral blood neutrophils and transduced cells after Docetaxel treatment.   Docetaxel was administered to three marmosets after the presence of proviral DNA was confirmed in granulocytes and lymphocytes by vector-specific PCR in the two recipients of MDR1 gene-transduced PBPCs. Docetaxel treatment began on day 168 in marmosets no. 1 (negative control) and no. 3 and on day 78 in marmoset no. 4. A reduction in the neutrophil count was observed in all marmosets after each cycle of Docetaxel treatment. The period required for the recovery of neutrophil count to baseline level after each Docetaxel treatment was not significantly different among the three marmosets (data not shown). The percentage of MDR1-positive neutrophils after three courses of Docetaxel in the two recipients of MDR1 gene-transduced PBPCs increased slightly relative to the pretreatment level (Fig 5A and B), but remained less than 1%.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Nonhuman primate models are invaluable as tools for the preclinical evaluation of both cytokine and gene therapy applications. However, studies using large nonhuman primates are difficult to perform and are currently being performed only in large primate centers. We have recently introduced a small primate, the common marmoset, as a model for hematologic research. These animals are relatively inexpensive compared with large primates such as the macaque or baboon, and the cost of marmosets in Japan is about one third to one half of that of macaques because of the large number of colonies available. Marmosets usually bear two to four offspring per year and have a 140 to 150 day gestation period. They become sexually active at the age of 18 months and require one half to one third the cage size required for macaques. Moreover, it is possible to breed two animals per cage. The handling of marmosets is relatively simple and requires no special training, another advantage of this model. However, little published information regarding the hematologic characteristics of marmosets exists. We therefore analyzed the hematologic characteristics of common marmosets to clarify the advantages and disadvantages of their use as a primate model for preclinical studies.

Transduction of hematopoietic cells by retroviral vectors requires cell division, and the majority of transduction methods achieve in vitro stimulation by culture in the presence of cytokines. Gene transfer efficiency has been reported to be enhanced by culture in multicytokine combinations such as SCF, IL-3, and IL-6.13,22,23 In this study, we first compared the responsiveness of marmoset BMPCs with human cytokines in serum-free conditions. Our results show that both marmoset and human BMPCs respond in a similar, dose-dependent manner to human IL-3, GM-CSF, G-CSF, and Epo. It is well known that both the human IL-3 and GM-CSF react in a species-specific manner.24,25 In the present study, however, we show that marmoset BMPCs respond appropriately to both human IL-3 and GM-CSF in vitro. Human SCF, also known to be highly species-specific,26 is also active on marmoset BMPCs, stimulating colony formation in the presence of other human cytokines. There have been several reports concerning the effects of human cytokines in Old World monkeys.10-12 The present findings strongly support the use of New World monkeys for such investigations, which in contrast to other large animal models such as canine or swine models,27,28 does not require the cloning of species-specific cytokines to stimulate hematopoietic cells for gene transduction. In addition, our in vivo results show that marmoset hematopoietic progenitor cells are effectively mobilized into the peripheral blood circulation by human G-CSF, and that these cells are capable of restoring hematopoiesis after irradiation as previously reported in humans.29

Although hematopoietic stem cells, including PBPCs, are considered to be important targets for gene therapy applications, the efficiency of transduction of hematopoietic stem cells in human and nonhuman primates remains low compared with that in mice.1 The evaluation of new strategies in a relevant animal model is therefore essential to the eventual goal of clinical gene therapy in humans. A previous report showed that the transduction of hematopoietic cells by retroviral vectors was generally more efficient in the presence of viral producer cells than viral supernatant alone.30 Furthermore, others have reported increased efficiency of transduction into hematopoietic stem cells in the presence of bone marrow stromal cells or extracellular matrix molecules.31-33 As both the supernatant and cocultivation methods were not effective in increasing the transduction efficiency into marmoset BMPCs and PBPCs, we designed a novel transduction system to exploit the advantages of both cocultivation and stromal cell support with improved transduction efficiency using this method for both BMPCs and PBPCs.

Based on these findings, we performed PBPCT in marmosets using MDR1 gene-transduced PBPCs. Hematologic recovery after PBPCT was observed in all animals. Our preliminary studies showed that irradiation with 7.5 Gy was uniformly lethal in marmosets. In animals irradiated with 5.5 Gy, hematologic recovery was delayed (neutrophil count <500/µL on day 50), yet all survived. These results suggested that 5.0 Gy of irradiation was a suitable dose for our studies, and hematologic reconstitution was accelerated by PBSCT. Provirus was detected in DNA from granulocytes and lymphocytes in marmosets nos. 3 and 4 up to day 412 and day 216, respectively. These results suggested that the MDR1 gene had been introduced into long-term reconstituting cells and proved that our novel transduction method resulted in successful genetic modification detectable in vivo. However, the hematologic recovery seen in these animals was slower than is typical for PBPCT in humans. We presume that the number of transplanted progenitor cells were few, or that primitive progenitor cells differentiated during the transduction procedure. Thus, further study is required to clarify the relationship between the number of transplanted PBPCs and hematologic recovery in marmosets.

Previous reports in murine models suggest that the MDR1 gene can be used as a selectable marker gene in vivo allowing enrichment for cells transduced with the MDR1 gene by treatment with chemotherapeutic agents such as paclitaxel.34-37 Additionally, inclusion of a second gene with the MDR1 gene using a bicistronic vector enhanced its expression after the transduced cells were treated with VCR.38 We administered Docetaxel to marmoset recipients of gene-transduced progenitors to examine whether in vivo selection of MDR1 transduced cells was feasible in our primate model. While paclitaxel-induced leukopenia can be completely prevented in murine recipients of MDR1 gene transduced progenitors,39,40 Docetaxel-induced neutropenia was not completely prevented in our animals. The percentage of MDR1-positive neutrophils was slightly increased in our marmosets after treatment with Docetaxel, but the percentage was still very low. These low levels were not considered to be high enough to prevent the neutropenia induced by Docetaxel treatment. Similar results have recently been reported in human cancer patients undergoing autologous transplantation with MDR1-transduced progenitor cells despite a relatively high transduction efficiency into CD34+ cells.33,41

Finally, RCR was not detected in any of the recipients of gene-transduced progenitors by the S+L- assay, nor did we detect any simian retrovirus in these animals (data not shown). Development of lymphoma by contaminating RCR in macaques transplanted with gene-transduced bone marrow cells has been reported previously17; therefore, studies to prove the safety of new retroviral vectors using primates are essential. Because the common marmoset is available at a lower cost than the macaque, the marmoset can also be used to detect RCR for newly developed retroviral vectors.

In summary, our results show that a small New World primate, the common marmoset, is a useful alternative to large primates for the evaluation of hematopoietic stem cell based gene transfer methodologies in vivo. This animal model can be used for nonhuman primate studies in institutions without special primate centers and will potentially contribute to the future development of successful human gene therapy.


    FOOTNOTES

Submitted January 21, 1998; accepted December 12, 1998.

Supported in part by grants from the Ministry of Health and Welfare, the Ministry of Education, Science and Culture, and the Science and Technology Agency, Japan.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

Address reprint requests to Kenzaburo Tani, MD, PhD, 4-6-1 Shirokanedai Minato-ku, Tokyo 108, Japan; e-mail: taniken{at}ims.utokyo.ac.jp.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Van Beusechem VW, Valerio D: Gene transfer into hematopoietic stem cells of nonhuman primates. Hum Gene Ther 7:1649, 1996[Medline] [Order article via Infotrieve]

2. Kantoff PW, Gillio AP, Mclachlin JR, Bordignon C, Eglits MA, Kernan NA, Moen RC, Kohn DB, Yu S-F, Karson E, Karlsson S, Zwiebel JA, Gilboa E, Blaese RM, Nienhuis A, O'Reilly RJ, Anderson WF: Expression of human adenosine deaminase in nonhuman primates after retrovirus-mediated gene transfer. J Exp Med 166:219, 1987[Abstract/Free Full Text]

3. Bodine DM, Moritz T, Donahue RE, Luskey BD, Kessler SW, Martin DIK, Orkin SH, Nienhuis AW, Williams DA: Long-term in vivo expression of murine adenosine deaminase gene in rhesus monkey hematopoietic cells of multiple lineages after retroviral mediated gene transfer into CD34+ bone marrow cells. Blood 82:1975, 1993[Abstract/Free Full Text]

4. Van Beusechem VW, Bart-Baumeister JAK, Bakx TA, Kaptein LCM, Levinsky RJ, Valerio D: Gene transfer into nonhuman primate CD34+CD11b- bone marrow progenitor cells capable of repopulating lymphoid and myeloid lineages. Hum Gene Ther 5:295, 1994[Medline] [Order article via Infotrieve]

5. Sasagawa A, Inayoshi T, Nakamura F, Suzuki M, Honjo S: Absence of antibodies against SV5, measles and herpes simplex in indoor colony-bred cynomolgus monkeys. Jpn J Med Sci Biol 34:381, 1981[Medline] [Order article via Infotrieve]

6. Crawford DH, Janossy G, Hetherington CM, Francis GE, Edwards AJ, Hoffbrand AV, Prentice HG: Immunological characterization of hematopoietic cells in the common marmoset, rhesus monkey, and man. In search of a model for human marrow transplantation. Transplantation 31:245, 1981[Medline] [Order article via Infotrieve]

7. Yamaguchi A, Kohno Y, Yamazaki T, Takahashi N, Shinki T, Horiuchi N, Suda T, Koizumi H, Tamioka Y, Yoshiki S: Bone in the marmoset: A resemblance to vitamin D-dependent rickets, type II. Calcif Tissue Int 39:22, 1986[Medline] [Order article via Infotrieve]

8. Picus J, ldrich W, Letvin NL: A naturally occurring bone-marrow chimeric primate. I. Integry of its immuno system. Transplantation 39:297, 1985[Medline] [Order article via Infotrieve]

9. Quint DJ, Buckham SP, Bolton EJ, Solari R, Champion BR, Zanders ED: Immunoregulation in the common marmoset, Callithrix jacchus: Functional properties of T and B lymphocytes and their response to human interleukins 2 and 4. Immunology 69:616, 1990[Medline] [Order article via Infotrieve]

10. Ryffel B, Car BD, Woerly G, Weber M, Dipadova F, Kammuller M, Klug S, Neubert R, Neubert D: Long-term interleukin-6 administration stimulates sustained thrombopoiesis and acute-phase protein synthesis in a small primate---The marmoset. Blood 83:2093, 1994[Abstract/Free Full Text]

11. Donahue RE, Seehra J, Metzger M, Lefebvra D, Rock B, Carbone D, Nathan DG, Garnick M, Sehgal PK, Laston D, LaVallie E, McCoy J, Schendel PF, Norton C, Turner K, Yang YC-C, Clark SC: Human IL-3 and GM-CSF act synergistically in stimulating hematopoiesis in primates. Science 241:1820, 1988[Abstract/Free Full Text]

12. Andrews RG, Bartelmez SH, Knitter GH, Myerson D, Bernstein ID, Appelbaum FR, Zsebo KM: A c-kit ligand, recombinant human stem cell factor, mediates reversible expansion of multiple CD34+ colony-forming cell types in blood and marrow of baboons. Blood 80:920, 1992[Abstract/Free Full Text]

13. Luskey BD, Rosenblatt M, Zsebo K, Williams DA: Stem cell factor, interleukin-3, and interluekin-6 promote retroviral-mediated gene transfer into murine hematopoietic stem cells. Blood 80:396, 1992[Abstract/Free Full Text]

14. Carter RF, Abrams-Ogg ACG, Dick JE, Kruth SA, Valli VE, Kamel-Reid S, Dube ID: Autologous transplantation of canine long-term marrow culture cells genetically marked by retroviral vectors. Blood 79:356, 1992[Abstract/Free Full Text]

15. Wieder R, Cornetta K, Kessler SW, Anderson WF: Increased efficiency of retroviral-mediated gene transfer and expression in primate bone marrow progenitors after 5-fluorouracil-induced hematopoietic suppression and recovery. Blood 77:448, 1991[Abstract/Free Full Text]

16. Bodine DM, McDonagh KT, Brandt SJ, Ney PA, Agricola B, Byrne E, Nienhuis AW: Development of a high-titer retrovirus producer cell line capable of gene transfer into rhesus monkey hematopoietic stem cells. Proc Natl Acad Sci USA 87:3738, 1990[Abstract/Free Full Text]

17. Donahue RE, Kessler SW, Bodine D, McDonagh K, Dunbar C, Goodman S, Agricola B, Byrne E, Raffeld M, Moen R, Bacher J, Zsebo KM, Nienhuis AW: Helper virus induced T cell lymphoma in nonhuman primates after retroviral mediated gene transfer. J Exp Med 176:1125, 1992[Abstract/Free Full Text]

18. Van Beusechem VW, Bart-Baumeister JAK, Hoogerbrugge PMB, Valerio D: Influence of interleukin-3, interleukin-6, and stem cell factor on retroviral transduction of rhesus monkey CD34+ hematopoietic progenitor cells measured in vitro and in vivo. Gene Ther 2:245, 1995[Medline] [Order article via Infotrieve]

19. Pastan I, Gottesman MM, Ueda K, Lovelace E, Rutherford A, Willingham MC: A retrovirus carrying a MDR1 cDNA confers multidrug resistance and polarized expression of P-glycoprotein in MDCK cells. Proc Natl Acad Sci USA 85:4486, 1988[Abstract/Free Full Text]

20. Kioka N, Tsubota J, Kakehi Y, Komano T, Gottesman MM, Pastan I, Ueda K: P-glycoprotein gene (MDR1) cDNA from human adrenal: Normal P-glycoprotein carries Gly185 with an altered pattern of multidrug resistance. Biochem Biophys Res Commun 162:224, 1989[Medline] [Order article via Infotrieve]

21. Haapala DK, Robey WG, Oroszlan SD, Tsai TP: Isolation from cats of an endogenous type C virus with nobel envelope glycoprotein. J Virol 53:827, 1985[Abstract/Free Full Text]

22. Bodine DM, Karlsson S, Nienhuis AW: Combination of interleukins 3 and 6 preserves stem cell function in culture and enhances retrovirus-mediated gene transfer into hematopoietic stem cells. Proc Natl Acad Sci USA 86:8897, 1989[Abstract/Free Full Text]

23. Nolta JA, Crooks GM, Overell RW, Williams DE, Kohn D: Retroviral vector-mediated gene transfer into primitive human hematopoietic progenitor cells: Effects of mast cell growth factor (MGF) combined with other cytokines. Exp Hematol 20:1065, 1992[Medline] [Order article via Infotrieve]

24. Dorssers LCJ, Burger H, Bot FJ, Delwel R, Geurts van Kessel AHM, Lowenberg B, Wagemaker G: Characterization of a human multilineage-colony-stimulating factor cDNA clone identified by a conserved noncoding sequence in mouse interleukin-3. Gene 55:115, 1987[Medline] [Order article via Infotrieve]

25. Metcalf D: The molecular biology and functions of the granulocyte-macrophage colony-stimulating factors. Blood 67:257, 1986[Abstract/Free Full Text]

26. Martin FH, Suggs SV, Langley KE, Lu HS, Ting J, Okino KH, Morris CF, McNiece IK, Jacobsen F, Mendiaz EA, Birkett NC, Smith KA, Johanson WF, Parker VP, Flores JC, Patel AC, Fisher EF, Erjavec HO, Herrera CJ, Wypych J, Sachdev RK, Pope JA, Leslie I, Wen D, Lin C-H, Cupples RL, Zsebo KM: Primary structure and functional expression of rat and human stem cell factor DNAs. Cell 63:203, 1990[Medline] [Order article via Infotrieve]

27. Shull RM, Suggs SV, Langley KE, Okino KH, Jacobsen FW, Martin FH: Canine stem cell factor (c-kit ligand) supports the survival of hematopoietic progenitors in long-term canine marrow culture. Exp Hematol 20:1118, 1992[Medline] [Order article via Infotrieve]

28. Emery DW, Shafer GE, Karson EM, Sachs DH, LeGuern C: Retrovirus-mediated transfer and expression of an allogeneic major histocompatibility complex class II DRB c DNA in swine bone marrow cultures. Blood 81:2460, 1993[Abstract/Free Full Text]

29. Duhrsen U, Villeval J-L, Boyd J, Kannourakis G, Morstyn G, Metcalf D: Effects of recombinant human granulocyte colony-stimulating factor on hematopoietic progenitor cells in cancer patients. Blood 72:2074, 1988[Abstract/Free Full Text]

30. Einerhand MPW, Bakx TA, Valerio D: IL-6 production by retrovirus packaging cells and cultured bone marrow cells. Hum Gene Ther 2:301, 1991[Medline] [Order article via Infotrieve]

31. Moore KA, Beisseroth AB, Reading CL, Williams DE, Belmont JW: Stromal support enhances cell-free retroviral transduction of human bone marrow long-term culture-initiating cells. Blood 79:1393, 1992[Abstract/Free Full Text]

32. Moritz T, Patel VP, Williams DA: Bone marrow extracellular matrix molecules improve gene transfer into human hematopoietic cells via retroviral vectors. J Clin Invest 93:1451, 1994

33. Hanania EG, Giles RE, Kavanagh J, Ellerson D, Zu Z, Wang T, Su Y, Kudelka A, Rahman Z, Holmes F, Hortobagyi G, Claxton D, Bachier C, Thall P, Cheng S, Hester J, Ostrove JM, Bird RE, Chang A, Korbling M, Seong D, Cote R, Holzmayer T, Mechetner E, Heimfeld S, Berenson R, Burtness B, Edwards C, Bast R, Andreeff M, Champlin R, Deisseroth AB: Results of MDR-1 vector modification trial indicate that granulocyte/macrophage colony-forming unit cells do not contribute to posttransplant hematopoietic recovery following intensive systemic therapy. Proc Natl Acad Sci USA 93:15346, 1996[Abstract/Free Full Text]

34. Xu L-C, Kluepfel-Stahl S, Blanco M, Schiffmann R, Dunbar C, Karlsson S: Growth factors and stromal support generate very efficient retroviral transduction of peripheral blood CD34+ cells from Gaucher patients. Blood 86:141, 1995[Abstract/Free Full Text]

35. Sorrentino BP, Brandt SI, Bodine D, Gottesman M, Pastan I, Cline A, Nienhuis AW: Selection of drug-resistant bone marrow cells in vivo after retroviral transfer of human MDR1. Science 257:99, 1992[Abstract/Free Full Text]

36. Sokolic RA, Sekhsaria S, Sugimoto Y, Whiting-Theobald N, Linton GF, Li F, Gottesman MM, Malech HL: A bicistronic retrovirus vector containing a picornavirus internal ribosome entry site allows for correction of X-linked CGD by selection for MDR1 expression. Blood 87:42, 1996[Abstract/Free Full Text]

37. Podda S, Ward M, Himelstein A, Richardson C, de la Flor-Weiss E, Smith L, Gottesman M, Pastan I, Bank A: Transfer and expression of the human multiple drug resistance gene into live mice. Proc Natl Acad Sci USA 89:9676, 1992[Abstract/Free Full Text]

38. Sugimoto Y, Aksentijevich I, Murray GJ, Brady RO, Pastan I, Gottesman MM: Retroviral coexpression of a multidrug resistance gene (MDR1) and human alpha -galactosidase A for gene therapy of fabry disease. Hum Gene Ther 6:905, 1995[Medline] [Order article via Infotrieve]

39. Hanania EG, Deisseroth AB: Serial transplantation shows that early hematopoietic precursor cells are transduced by MDR-1 retroviral vector in a mouse gene therapy model. Cancer Gene Ther 1:21, 1994[Medline] [Order article via Infotrieve]

40. Hanania EG, Fu S, Roninson I, Zu Z, Gottesman MM, Deisseroth AB: Resistance to taxol chemotherapy produced in mouse marrow cells by safety-modified retroviruses containing a human MDR-1 transcription unit. Gene Ther 2:279, 1995[Medline] [Order article via Infotrieve]

41. Hesdorffer C, Ayello J, Ward M, Kaubisch A, Vahdat L, Balmaceda C, Garrett T, Fetell M, Reiss R, Bank A, Antman K: Phase I trial of retroviral-mediated transfer of the human MDR1 gene as bone marrow chemoprotection in patients undergoing high-dose chemotherapy and autologous stem-cell transplantation. J Clin Oncol 16:165, 1998[Abstract/Free Full Text]


© 1999 by The American Society of Hematology.
 
0006-4971/99/9309-0008$3.00/0

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
T. Neff, B. C. Beard, and H.-P. Kiem
Survival of the fittest: in vivo selection and stem cell gene therapy
Blood, March 1, 2006; 107(5): 1751 - 1760.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Neff, B. C. Beard, L. J. Peterson, P. Anandakumar, J. Thompson, and H.-P. Kiem
Polyclonal chemoprotection against temozolomide in a large-animal model of drug resistance gene therapy
Blood, February 1, 2005; 105(3): 997 - 1002.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Neff, P. A. Horn, V. E. Valli, A. M. Gown, S. Wardwell, B. L. Wood, C. von Kalle, M. Schmidt, L. J. Peterson, J. C. Morris, et al.
Pharmacologically regulated in vivo selection in a large animal
Blood, August 28, 2002; 100(6): 2026 - 2031.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J. A. LaBonte, G. J. Babcock, T. Patel, and J. Sodroski
Blockade of HIV-1 Infection of New World Monkey Cells Occurs Primarily at the Stage of Virus Entry
J. Exp. Med., August 20, 2002; 196(4): 431 - 445.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hibino, H.
Right arrow Articles by Asano, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hibino, H.
Right arrow Articles by Asano, S.
Related Collections
Right arrow Gene Therapy
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1999 by American Society of Hematology         Online ISSN: 1528-0020