|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 9 (May 1), 1999:
pp. 2867-2875
Consequences of GATA-1 Deficiency in Megakaryocytes and Platelets
By
Paresh Vyas,
Kenneth Ault,
Carl W. Jackson,
Stuart H. Orkin, and
Ramesh A. Shivdasani
From the Department of Hematology-Oncology and Howard Hughes Medical
Institute, Children's Hospital, Boston; the Departments of Adult
Oncology and Medicine, Dana-Farber Cancer Institute and Harvard Medical
School, Boston, MA; Maine Medical Center Research Institute, South
Portland, ME; and the Department of Experimental Hematology, St Jude
Children's Research Hospital, Memphis, TN.
 |
ABSTRACT |
In the absence of the hematopoietic transcription factor GATA-1,
mice develop thrombocytopenia and an increased number of megakaryocytes
characterized by marked ultrastructural abnormalities. These
observations establish a critical role for GATA-1 in megakaryopoiesis and raise the question as to how GATA-1 influences megakaryocyte maturation and platelet production. To begin to address this, we have
performed a more detailed examination of the megakaryocytes and
platelets produced in mice that lack GATA-1 in this lineage. Our
analysis demonstrates that compared with their normal counterparts, GATA-1-deficient primary megakaryocytes exhibit significant
hyperproliferation in liquid culture, suggesting that the
megakaryocytosis seen in animals is nonreactive. Morphologically, these
mutant megakaryocytes are small and show evidence of retarded nuclear
and cytoplasmic development. A significant proportion of these cells do
not undergo endomitosis and express markedly lower levels of mRNA of
all megakaryocyte-associated genes tested, including GPIb , GPIb ,
platelet factor 4 (PF4), c-mpl, and p45 NF-E2. These results
are consistent with regulation of a program of megakaryocytic
differentiation by GATA-1. Bleeding times are significantly prolonged
in mutant animals. GATA-1-deficient platelets show abnormal
ultrastructure, reminiscent of the megakaryocytes from which they are
derived, and exhibit modest but selective defects in platelet
activation in response to thrombin or to the combination of adenosine
diphosphate (ADP) and epinephrine. Our findings indicate that GATA-1
serves multiple functions in megakaryocyte development, influencing
both cellular growth and maturation.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
THE DIFFERENTIATION of hematopoietic
cells from pluripotent progenitors involves the progressive restriction
of differentiation potential and the acquisition of lineage-specific
patterns of gene expression.1,2 These patterns are
coordinated by a number of tissue-restricted and general transcription
factors that act in a combinatorial manner. In the megakaryocytic
lineage, one can operationally divide the roles of these transcription
factors into those required for the specification and maintenance of
progenitors, maturation of megakaryoctyes, and terminal differentiation
of megakaryocytes, including platelet production.
From analysis of expression patterns, of cis-elements important
in the regulation of megakaryocyte-specific genes and of mouse null
mutants of transcription factor genes, a number of tissue-restricted transcription factors are implicated in megakaryopoiesis. These include
SCL/Tal-1, c-Myb, Ets family members, GATA-1, GATA-2, FOG, and
NF-E2.3-11 Among these, GATA-1, FOG, and NF-E2 stand out
for the nonredundant and essential roles they play in megakaryopoiesis.
Two lines of evidence have suggested that GATA-1 can participate in
megakaryopoiesis. First, when overexpressed, either directly or
indirectly, GATA-1 can induce megakaryocytic differentiation in a
multipotential murine myeloid cell line, 416B.12,13
Similarly, forced GATA-1 expression in Myb-Ets-transformed chicken
myeloblasts induces differentiation into thromboblasts.14
Second, in fetal liver of chimeric mice generated with GATA-1-null ES
cells there is a fourfold increase in megakaryocyte number, suggesting
that GATA-1 influences megakaryocyte homeostasis.15
However, these studies do not clearly define a requirement for GATA-1
in megakaryocytes. Recently, we generated two mutant lines of mice with
megakaryocyte-specific loss of GATA-1 expression, allowing a more
direct evaluation of the importance of GATA-1 in this
lineage.8 Preliminary analysis of these mice pointed to a
critical role for GATA-1 in the proper proliferation and terminal
maturation of megarkaryocytes and in platelet production.
Mice with megakaryocyte-specific GATA-1 deficiency have a platelet
count of approximately 15% of normal with a markedly increased mean
platelet volume, suggesting that the platelets may be structurally abnormal.8 There is also a remarkable megakaryocytosis in
these animals, with a significant increase in megakaryocyte numbers in
the spleen and bone marrow. Colony assays from yolk sac and fetal liver
indicate that megakaryocyte progenitor numbers are normal but that some
megakaryocyte progenitors exhibit marked hyperproliferation, producing
abnormally large colonies principally composed of immature
megakaryocytes similar to those seen in vivo. Ultrastructural
examination of these megakaryocytes showed gross abnormalities with a
small cytoplasm, excess rough endoplasmic reticulum, a reduction in the
number of platelet granules, and underdeveloped and disorganized
platelet demarcation membranes. Takahashi et al have also recently
reported that when GATA-1 levels are reduced in vivo, heterozygous
female mice display megakaryocytosis in the spleen.16
These studies lead to the question as to how GATA-1 orchestrates
megakaryocyte development. To begin to address this issue, we have
performed a detailed characterization of GATA-1-deficient megakaryocytes and platelets. These studies more accurately define where GATA-1 is likely to act in this lineage.
| |
MATERIALS AND METHODS |
Generation of neo HS and neoHS mice.
NeoHS and neoHS mice used in this study have been previously
described.8 They were generated by a targeted deletion of
an upstream region of the GATA-1 locus. The mutation removes at least
one DNase I hypersensitive site (HS), which probably earmarks sequences
important for GATA-1 expression. Two different lines of mutant mice
were generated: neoHS, in which the PGK-neo selection cassette
remains in the targeted locus, and neoHS, in which the selection
marker has been excised from the targeted locus. In neoHS, there is
no detectable expression of GATA-1 in megakaryocytes, whereas in
neoHS mice, GATA-1 is expressed at a level of approximately 1% to
5% of normal.8 The megakaryocyte and platelet phenotypes
of the two mutant mice are indistinguishable, but as neoHS mice
are viable, they were used for studies involving adult mice.
Determination of primary megakaryocyte growth curves.
Fetal liver cells were isolated from 15 neoHS fetuses and 15 normal
littermate controls at embryonic day 12.5 (E12.5). Single-cell suspensions from individual fetal livers were cultured in Dulbecco's minimum essential medium (DMEM) with 10% fetal calf serum (FCS) supplemented with 1% recombinant human thrombopoietin (Tpo) tissue culture supernatant.17 A 50-µL quantity of the culture
was taken every 2 days for cytocentrifugation and the slides assayed
for acetylcholinesterase activity.18 The total number of
acetylcholinesterase-positive cells was counted in 50 µL.
DNA content analysis of primary megakaryocytes.
Individual single-cell suspensions were made from bone marrow harvested
from the femurs of eight neoHS mice and six wild-type littermates
aged 6 to 10 weeks, and resuspended and washed once in
CATCH medium (0.38% Na citrate + 10 3 mol/L
adenosine + 2 × 103 mol/L theophylline, in
Ca2+/Mg2+-free Hanks' balanced
solution).19 To assay DNA content from cultured cells,
individual single-cell suspensions were made from E12.5
fetal livers from three GATA-1-deficient embryos and three littermate
control embryos. These suspensions were cultured in 10% FCS in DMEM
supplemented with 1% recombinant human Tpo tissue culture
supernatant.17 The cells were harvested on day 4 of culture. To label megakaryocytes, cells were incubated with a rabbit
antimouse platelet antiserum (RAMPS), used at a dilution of
1:250.20 Cells were then incubated with a
fluorescein-conjugated goat antirabbit IgGF(ab')2
antibody (Tago International, Biosource International, Camarillo,
CA). Last, cells were stained with propidium iodide in
hypotonic citrate.21 Using a FACScan flow cytometer (Becton
Dickinson, Franklin Lakes, NJ) and two-color flow cytometry, DNA
content of all RAMP-positive cells was measured.22 The
proportion of cells in each ploidy class was determined by integrating
the area under each peak. Comparison of the percentage of 2N cells was
performed by the Student's paired t-test.
Semiquantitative reverse-transcriptase polymerase chain reaction
analysis of megakaryocyte-associated genes.
Approximately 1 to 5 × 105 fetal liver cells from
neoHS and normal littermate fetuses were plated in a methylcellulose
mix, which included 1% recombinant human Tpo tissue culture
supernatant.9 At day 5 to 6 colony-forming
unit-megakaryocytes (CFU-Mk) were picked and placed in DMEM with 10%
FCS. The cells were then washed once in phosphate-buffered saline
(PBS). RNA was extracted using RNAZOL B (Tel-Test, Friendwood, TX)
according to the manufacturer's protocol and cDNA was made using an
oligo(dT) primer. Semiquantitative reverse-transcriptase polymerase
chain reaction (RT-PCR) was then performed.9 The amount of
cDNA in the samples was normalized using primers for hypoxanthine
phosphoribosyl transferase (HPRT). Reaction products were separated on
4% nondenaturing polyacrylamide gels. No reaction products were
detected using RNA samples from which RT had been omitted (data not
shown). Quantitation of fold-differences in mRNA levels was performed
by densitometric analysis (Molecular Dynamics, Sunnyvale, CA) of
autoradiographs. The sum of the average pixel intensity above
background was determined for each of the bands representing different
PCR cycle numbers; normalization was performed relative to the bands
from the PCR reactions for HPRT. The primer pairs used for HPRT,
platelet factor 4 (PF4), and c-mpl have been reported
previously.9,23 The following primer pairs were used to
amplify: GPIb  5' CCTGGAAGAAGCTCTGTTCCTCC 3' and
5' CATTGGTCTGCAGGCTCGTC 3';
GPIb5'AGGACAGGACGCGGCATTCA 3' and 5'
AGGCTTCTGGGAGGAAGGCG 3'; and p45 NF-E25'
AACTTGCCGGTAGATGACTTTAAT 3' and 5'
CAGAGTGCGGTCAGCCTCCCCTCG 3'.
Electron microscopy.
Electron microscopy of platelets was performed according to a
modification of the procedure of Stenberg et al.24 Briefly, whole blood, collected by cardiac puncture directly into syringes containing an excess of 1.5% glutaraldehyde in 0.01 mol/L cocadylate buffer, pH 7.4, was fixed overnight at 4°C. The blood was
centrifuged at 800g for 15 minutes to isolate platelets, which
were dehydrated through an ascending series of alcohols, infiltrated
with propylene oxide, and embedded in epoxy resin. Ultrathin sections
were stained with uranyl acetate and lead citrate, and examined with a
JEOL 100CX-II transmission electron microscope (JEOL, Peabody, MA) at
an accelerating voltage of 60 kV.
Western blot of platelets.
Platelets isolated from neoHS and wild-type mice as previously
described25 were directly resuspended in 2X protein lysis sample buffer (125 mmol/L Tris pH 6.8, 2% sodium dodecyl sulfate [SDS], 50% glycerol, 5% -mercaptoethanol, 0.001% bromophenol blue). The samples were electrophoresed through 10% SDS-polyacrylamide gel electrophoresis (PAGE) and immunoblotted onto nitrocellulose membranes. The membranes were blocked overnight at 4°C or for 2 hours at room temperature in Tris-buffered saline with Tween (TBST; 50 mmol/L Tris, pH 8.0, 150 mmol/L NaCl, 1 mmol/L EDTA, 0.1% Tween-20)
supplemented with 5% nonfat milk. Binding of the primary and secondary
antibody was performed in TBST. Washes of the membranes after antibody
binding were performed for 1 hour with TBST. One filter was
sequentially used to detect expression of c-MPL, GPIIb, and
c-src, and another to detect GPIb and c-src; we
evaluated c-src expression to ensure equivalent sample loading. Commercially available antibodies to GPIIb, GPIb (Pharmingen, San
Diego, CA), and c-src (Santa Cruz Biotechnology, Santa Cruz, CA) were used at dilutions of 1:500, 1:500, and 1:1,000. Monoclonal antibodies against c-mpl were a kind gift from Dr Federic de
Sauvage and used at a dilution of 1:1,000. The secondary antibody was conjugated with HPRT and the signal detected with a commercial chemiluminescence kit (Amersham, Arlington Heights, IL).
Bleeding time studies.
Four neoHS mice and six wild-type littermate controls at age 6 to
8 weeks were used to measure bleeding times as previously described.26
Platelet lifespan studies and platelet function tests.
Platelets were isolated from four neoHS and four normal animals;
detailed methods for the platelet lifespan and platelet activation
studies have been published previously.27,28
| |
RESULTS |
Growth dysregulation of GATA-1-deficient megakaryocytes.
To quantitate the growth disturbance of primary GATA-1-deficient
megakaryocytes, we compared the growth rates of GATA-1-deficient and
normal megakaryocytes in vitro. Fetal liver cells isolated from
neoHS mice and wild-type littermates at E12.5 were
expanded in liquid culture in the presence of recombinant Tpo and the
number of acetylcholinesterase-positive cells was determined every 2 days. The growth curves (Fig 1) show a
dramatic proliferative advantage for GATA-1-deficient cells; not only
are the maximal numbers of megakaryocytes 15-fold greater, but the
GATA-1-deficient megakaryocytes continue in culture for up to 4 weeks,
whereas normal megakaryocytes die after 12 to 14 days. These results
extend the previous colony data8 by showing the greatly
enhanced proliferative response of GATA-1-deficient megakaryocytes in
response to Tpo and are in agreement with megakaryocytosis seen in
mutant animals.
View larger version (13K):
[in this window]
[in a new window]
| Fig 1.
Proliferation profiles of normal (WT) and neo HS (MUT)
primary megakaryocytes expanded from fetal liver cells in liquid
culture in recombinant Tpo. The number of cells with
acetylcholinesterase (AchE) activity in 50-µL aliquots of the culture
is shown as a function of the duration of culture. The values shown are
the mean ± 1 SD from separate cultures of 15 normal and 15 mutant
fetal livers.
|
|
Nuclear and cytoplasmic arrest of GATA-1-deficient megakaryocytes.
Associated with this hyperproliferation, GATA-1-deficient
megakaryoctyes, as a population, show evidence of arrested nuclear and
cytoplasmic development. DNA content analysis of eight neoHS and
six normal animals shows that the percentage of bone marrow megakaryocytes with 2N DNA content in the mutants is 32% compared with
15% in normal animals (P < .001; Fig
2A). In addition, there is a reduction in
the proportion of mutant megakaryocytes with 8N and 16N DNA content
compared with controls. Nonetheless, a subpopulation of mutant
megakaryocytes achieves a higher ploidy and the modal ploidy of these
megakaryocytes is 32N, compared with 16N in wild-type megakaryocytes.
Mirroring these findings, the proportion of cells with low DNA content
is increased in cultured GATA-1-deficient megakaryocytes compared with
controls (Fig 2B); controls also show a higher fraction of
megakaryocytes with DNA content  8N.
View larger version (41K):
[in this window]
[in a new window]
| Fig 2.
Histograms of the DNA content of (A) bone marrow
megakaryocytes from 6 normal (Wild Type, top) and 8 neoHS
(Mutant, bottom) weanling mice (age 4 weeks), and (B) megakaryocytes
cultured ex vivo from E12.5 fetal livers of 3 normal (Wild Type, top)
and 3 neoHS (Mutant, bottom) embryos. The mean percentage (± 1 SD) of RAMPS-positive cells in each ploidy class
|
|
Retardation of cytoplasmic maturation is indicated by semiquantitative
RT-PCR analysis of megakaryocyte-specific transcripts. In these
experiments, we used mutant and wild-type megakaryocytes of comparable
morphology and size (colonies derived from CFU-Mk) as the source of
mRNA. This was done to minimize differential patterns of gene
expression being recorded solely because of differences in maturation
state, rather than as a specific consequence of lack of GATA-1.
GATA-1-deficient megakaryocytes showed significantly decreased mRNA
expression of GPIb (7.4-fold) and GPIb (3.6-fold), PF4 (3.4-fold)
c-mpl (3.8-fold), and p45 NF-E2 (35-fold). Indeed, all of the
markers studied showed decreased expression, albeit at different levels
(Fig 3).
View larger version (52K):
[in this window]
[in a new window]
| Fig 3.
Semiquantitative RT-PCR analysis of GPIb, GPIb,
PF4, c-mpl, and p45 NF-E2 mRNA transcripts from primary
megakaryocytes derived from normal (WT) and neoHS (MUT) CFU-Mk. PCR
reactions were performed with tracer [32P]dCTP for the
indicated number of cycles before analysis by PAGE. HPRT signal was
used to normalize the input cDNA.
|
|
Platelet phenotype of GATA-1-deficient mice.
Despite the marked megakaryocyte abnormalities outlined above, some
platelets (~15% of normal) are produced in neoHS and neoHS
mice. In the following studies, we examined the ultrastructure of these
platelets and sought to determine their competence in hemostasis.
Morphology of GATA-1-deficient platelets.
Electron microscopy of platelets isolated from the peripheral blood of
neoHS mice shows a number of gross morphologic abnormalities (Fig
4). In addition to their larger volume,
mutant platelets are uniformly spherical in shape, in contrast to the
discoid shape of normal platelets. Rough endoplasmic reticulum and
ribosomes are excessive. Most of the GATA-1-deficient platelets
contain few platelet-specific granules or lack them entirely. There is marked heterogeneity in distribution of organelles, with some platelets
harboring few organelles, while others are replete. Finally, many
platelets have an increased internal canalicular membrane system. These
findings are reminiscent of the ultrastructural abnormalities seen in
the defective megakaryocytes from which these platelets are
derived8 and indicate abnormal compartmentalization of
organelles within GATA-1-deficient megakaryocytes before platelet release.
View larger version (93K):
[in this window]
[in a new window]
| Fig 4.
Representative electron micrographs of platelets produced
by megakaryocytes deficient in GATA-1. Normal mouse platelets (A) have
a uniform appearance and show the typical discoid shape with a normal
complement of organelles, including platelet-specific granules. In
contrast, GATA-1-deficient platelets (B and C) are large, invariably
round, heterogeneous, and show a paucity of organelles, especially
platelet-specific granules. In particular, these platelets have an
excess of rough endoplasmic reticulum (C), similar to the
megakaryocytes from which they are derived. Bars in (A) and (B) are 5 µm; in (C), 1 µm.
|
|
In surprising contrast to the mRNA expression data from
GATA-1-deficient megakaryocytes, mutant platelets exhibit greater evidence of cytoplasmic maturity. This is evidenced by normal protein
expression levels of GPIb, GpIIb, and c-mpl in
GATA-1-deficient platelets compared with normal controls (Fig
5). This apparent discrepancy between the
maturation state of GATA-1-deficient megakaryocytes and platelets
leads us to speculate that the platelets may be produced by a small
subset of megakaryocytes that achieves the greatest degree of maturity
in the bulk population of GATA-1-deficient megakaryocytes, presumably
from among those cells with a higher DNA content.
View larger version (33K):
[in this window]
[in a new window]
| Fig 5.
Western blot analysis of c-mpl, GPIIb,and GPIb
expression in platelets isolated from normal (WT) and neoHS (MUT)
adult mice. In the left panel, the same filter was sequentially used to
assay expression for c-mpl, GPIIb,and c-src, whereas in
the right panel a separate filter was sequentially used to detect
expression of GPIb and c-src. The c-src signal was used
to verify equivalent sample loading.
|
|
The high ribosome and RNA content of GATA-1-deficient platelets is
suggestive of young platelet age.29 Taken together with the
thrombocytopenia, this raises the possibility that the abnormal GATA-1-deficient platelets have an increased susceptibility to destruction. To address this, we studied platelet lifespan in four
neoHS and four normal animals. No difference in platelet survival
was observed between wild-type and mutant platelets (Table 1), indicating that thrombocytopenia is due
to a failure of platelet production.
Function of GATA-1-deficient platelets.
NeoHS and neoHS mice do not exhibit a bleeding diathesis in
the environment of a controlled animal care facility. However, when
subject to trauma (tail biopsy), mutant mice frequently bleed excessively compared with wild-type littermates. To evaluate the function of GATA-1-deficient platelets, we measured bleeding times in
four neoHS and six normal animals. As shown in
Fig 6, bleeding times are substantially
prolonged in the mutant mice. It is helpful to compare these data with
published results from Tpo-null mice, which have an equivalent degree
of thrombocytopenia with functionally normal platelets and are reported
to have an average bleeding time of 3 minutes.30 Thus, the
excessively prolonged bleeding time of neoHS mice points to a
functional platelet defect superimposed on thrombocytopenia.
View larger version (19K):
[in this window]
[in a new window]
| Fig 6.
Bleeding times obtained from 6 normal (WT) and 4 neoHS (MUT) adult mice. *Bleeding times >1,200 seconds.
|
|
We performed platelet activation studies on four neoHS mice and
four normal control mice by measuring the appearance of P-selectin on
the platelet cell surface in response to a variety of platelet
agonists. This analysis showed a modest selective defect in activation
of mutant platelets by either thrombin or a combination of adenosine
diphosphate (ADP) and epinephrine, whereas activation by ADP alone was
comparable to normal (Table 1).
| |
DISCUSSION |
The findings presented here indicate that megakaryocytes deficient in
GATA-1 hyperproliferate, have a modal ploidy of 2N, express
significantly lower levels of several megakaryocyte-specific genes, and
produce large, structurally abnormal platelets. Connected with these
abnormalities, platelet function is compromised in vivo and in vitro.
The combination of the colony and liquid culture data
provide useful insights into the biology of the megakaryocytosis seen in neoHS and neoHS mice. In liquid culture there is a 15-fold increase in the maximal number of mutant megakaryocytes and these cells
persist or are produced for more than twice as long. However, megakaryocytosis is not driven by an increased number of CFU-Mk progenitors, the frequency of which is similar in wild-type and mutant
mice.8 We interpret the striking differences between wild-type and mutant cultures to reflect hyperproliferation of the
progeny of a subset of mutant progenitors (Fig
7), which presumably give rise to the large
abnormal colonies consisting of thousands of cells. There are two
mutually nonexclusive possibilities for the different proliferative
response in mutant and wild-type megakaryocyte progenitors. First, in
the absence of GATA-1, there may be selective, abnormal expansion of an
otherwise rare pool of normal progenitors with high proliferative
capacity that is distinct from the pool of normal CFU-Mk.
Alternatively, the large colonies could arise from abnormal CFU-Mk
progenitors that are present only in mutant animals; however, mutant
animals must also have normal CFU-Mk progenitors, as normal-sized
megakaryocyte colonies can be cultured from their hematopoietic cells.
Interestingly, May-Grünwald-Giemsa staining of the abnormally
large colonies shows cells not only with megakaryocytic morphology, but
also some that are blast-like8 and others that resemble
proerythroblasts (data not shown). Moreover, the progeny of these
abnormally large colonies have a low but definite secondary replating
potential, producing mainly erythroid colonies arrested at the
proerythroblast stage (data not shown). Taken together, these results
suggest that the hyperproliferating cell is not a normal CFU-Mk, but
rather represents an earlier progenitor, perhaps one with bilineage
erythromegakaryocytic potential. Similar colonies are almost never seen
in cultures of normal fetal livers in Tpo.
View larger version (17K):
[in this window]
[in a new window]
| Fig 7.
A hierarchy of transcription factors important in
megakaryopoiesis. The normal progression of a multipotential progenitor
to a platelet-producing megakaryocyte (MK) is shown. The upper set of
arrows denotes the normal pattern of progression from one cell type to
another, and the lower set of arrows illustrates the findings in a
GATA-1-deficient environment. The thickness of the arrows represents
the degree to which the progression from 1 cell type to another occurs.
In GATA-1 deficiency, there is a marked increase of immature
megakaryocytes relative to the wild type. Most normal immature
megakaryocytes complete differentiation, whereas in GATA-1 deficiency,
many immature megakaryocytes fail to complete the differentiation
program, and the few that do are abnormal structurally. This results in
a lower number of circulating platelets that are functionally and
structurally abnormal. In the absence of FOG, either the megakaryocyte
progenitor is not specified or fails to differentiate. Conversely, the
requirement for NF-E2 is apparently limited to terminal megakaryocyte
differentiation before platelet release.
|
|
It is interesting that GATA-1 impinges upon growth control in both the
megakaryocytic and erythroid lineages. In erythroid cells, absence of
GATA-1 leads to maturation arrest and premature apoptosis at the
proerythroblast stage in vitro.23,31 The clear hyperproliferative response seen in megakaryocytes deficient in GATA-1
both in vitro and in vivo suggests that further analysis of the
mechanisms by which GATA-1 influences cell growth and apoptosis in
blood cells is likely to be rewarding.
GATA-1-deficient megakaryocytes exhibit evidence of retarded nuclear
development, reflected by the modal ploidy of 2N, compared with 16N in
wild-type controls. However, a population of mutant megakaryocytes does
undergo endoreduplication and achieves higher DNA content. It is
unclear whether this suggests that GATA-1 is not required for the
initiation of endomitosis or that most megakaryocytes do require GATA-1
for endoreduplication, but that a subset of megakaryocytes can become
polyploid through GATA-1-independent mechanisms. Regardless of the
putative mechanism, we speculate that the minority of the
megakaryocytes with higher DNA content produce platelets.
The promoters of many megakaryocyte-expressed genes have been
demonstrated to harbor functional GATA-1-binding sites, eg, in GPIb
and GPIb, GPIIb, c-mpl, PF4, and GPIX
promoters.5,32-36 This consistent finding may be
interpreted to suggest that GATA-1 regulates an entire program of
megakaryocyte gene expression and differentiation, much as has been
suggested in the related erythroid lineage.37,38 Indeed,
GATA-1-deficient megakaryocytes show decreased expression of mRNAs
encoding all cell surface, cytoplasmic, and nuclear
megakaryocyte-specific genes tested, including GPIb and GPIb,
c-mpl, p45 NF-E2, and PF4 (Fig 3) and GPIIb and GPIX (data not
shown). There are two caveats to the interpretation of these results.
First, differential expression of these mRNAs does not necessarily mean
that they are all direct transcriptional targets of GATA-1. Rather,
differential expression may simply reflect immaturity of
GATA-1-deficient megakaryocytes if levels of these mRNAs normally
increase late in megakaryocyte maturation by GATA-1-independent means.
We specifically attempted to avoid this bias by conducting expression
studies on normal-size megakaryocyte colonies derived from cultured
wild-type and mutant CFU-Mk. Second, it remains formally possible that
the differences in mRNA profile observed in cultured megakaryocytes may
not be reflected in vivo. However, GPIb is a good candidate for a
true GATA-1 target gene. A patient with Bernard-Soulier
syndrome (absence of GPIb expression) has been described with a
deletion of the structural GPIb gene on one chromosome and a point
mutation in a functional GATA-binding site in the GPIb promoter as
the sole defect on the other, implying a critical role for GATA-1 in
GPIb expression in vivo.39
Even though some platelets are produced in neoHS and neoHS
mice, they are abnormal in several respects. Morphologically, they are
bigger, spherical, show an excess of rough endoplasmic reticulum and
ribosomes, have few electron dense and granules, and often have an
excess of internal canalicular membranes. Ultrastructurally, the
platelets are similar to the megakaryocytes from which they are
released. These observations suggest that GATA-1 deficiency leads not
only to defective organelle and granule formation, but also to abnormal
compartmentalization of these structures in megakaryocytes, which is
reflected in the platelets that are released. We further speculate that
platelet release from GATA-1-deficient megakaryocytes is abnormal, as
proplatelet formation in liquid culture is infrequent,40 and the rare proplatelets produced by GATA-1-deficient megakaryocytes tend to be short buds, rather than the typical long filamentous structures that emanate from normal megakaryocytes.
Functionally, GATA-1-deficient platelets are also abnormal. Bleeding
times in mutant animals are greatly prolonged, beyond that expected for
the degree of thrombocytopenia. Platelet activation in vitro is
modestly affected in response to either thrombin or a combination of
ADP and epinephrine, but not to ADP alone. The latter findings suggest
specific defects in the adrenergic and thrombin-induced pathways of
platelet activation.
From the observations presented in this report, we present a model for
the function of GATA-1 in megakaryocytes and platelets (Fig 7). In the
absence of GATA-1, the majority of megakaryocytes are small and
immature. These arise from hyperproliferation of megakaryocytes,
probably from a small subset of progenitors, and many cells have 2N DNA
content. Moreover, mature mutant megakaryocytes derived from CFU-Mk
express lower levels of a number of megakaryocyte-associated mRNA
transcripts. Nevertheless, a minority of megakaryocytes does undergo
endoreduplication to have a ploidy profile that is comparable to normal
and some of the mutant megakaryocytes are able to release platelets.
Although these platelets display functional and structural abnormalities, they do express some platelet-associated proteins at
apparently normal levels. We conclude that GATA-1 is required for the
normal homeostasis of megakaryocyte numbers and nuclear and cytoplasmic
maturation and platelet release.
It is unclear why some megakaryocytes are able to mature partially,
albeit abnormally. This could occur if the mutations we have generated
in mice (neoHS and neoHS) are leaky with respect to GATA-1
expression in megakaryocytes, ie, a small proportion of cells is able
to express GATA-1 to allow fuller differentiation. This is unlikely
because we were unable to detect GATA-1 expression in megakaryocytes
from neoHS mice by either immunofluorescence or RT-PCR.8
Moreover, although megakaryocytes from neoHS mice show a low
level of GATA-1 mRNA expression (1% to 5% by RT-PCR analysis8), the megakaryocyte and platelet phenotype is
identical in the two mutant strains.8 We hence favor the
possibility that the partial maturation of megakaryocytes seen in
neoHS and neoHS mice occurs by GATA-1-independent means.
The GATA-1-deficient megakaryocyte phenotype contrasts markedly with
the two other transcription factor knockouts that affect the
megakaryocytic lineage. FOG was isolated as a protein that interacts
physically with GATA-1 and enhances its capacity to drive
megakaryocytic differentiation in the 416B myeloid cell line.10 Thus, it was surprising that FOG-null fetuses do
not produce any megakaryocytic colonies, a defect in megakaryopoiesis that is distinct from neoHS and neoHS mice.11 We
have speculated that FOG has a GATA-1-independent function early in
megakaryopoiesis, as well as a GATA-1-dependent role later in
megakaryocyte maturation. NF-E2 is vital for terminal megakaryocyte
maturation and platelet release.9 However, the
megakaryocyte and platelet phenotypes between NF-E2-null and neoHS
and neoHS mice are also clearly distinguishable. As expression of
p45 NF-E2 is significantly reduced in colonies derived from
GATA-1-deficient CFU-Mk, it could be that part of the failure of these
megakaryocytes to undergo proper terminal differentiation is related to
this observation. It is likely that these three transcription factors
regulate mutually exclusive sets of target genes, although some genes
may be controlled in a complex manner requiring two or all three of
these proteins.
| |
ACKNOWLEDGMENT |
We are grateful to Jerry Ware for providing unpublished sequence data
to design GPIb oligonucleotide primers for RT-PCR analysis, and to
Yuhui Xu and Paula Stenberg for assistance with electron microscopy.
| |
FOOTNOTES |
Submitted October 3, 1998; accepted December 16, 1998.
Supported in part by fellowships and grants from the Wellcome Trust,
National Institutes of Health, and the Howard Hughes Medical Institute.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Paresh Vyas, MD, PhD, Children's Hospital
Medical Center, 300 Longwood Ave, Boston, MA 02115; e-mail:
vyas{at}rascal.med.harvard.edu.
| |
REFERENCES |
1.
Orkin SH:
Transcription factors and hematopoietic development.
J Biol Chem
270:4955, 1995[Free Full Text]
2.
Shivdasani RA, Orkin SH:
The transcriptional control of hematopoiesis.
Blood
87:4025, 1996[Free Full Text]
3.
Mouthon M-A, Bernard O, Mitjavila M-T, Romeo P-H, Vainchenker W, Mathieu-Mahul D:
Expression of tal-1 and GATA-binding proteins during human hematopoiesis.
Blood
81:647, 1993[Abstract/Free Full Text]
4.
Elwood MJ, Zogos H, Pereira DS, Dick JE, Begley CG:
Enhanced megakaryocyte and erythroid development from normal human CD34+ cells: Consequences of enforced expression of SCL.
Blood
91:3756, 1998[Abstract/Free Full Text]
5.
Lemarchandel V, Ghysdael J, Mignotte V, Rahuel C, Romeo P-H:
GATA and Ets cis-acting sequences mediate megakaryocyte-specific expression.
Mol Cell Biol
13:668, 1993[Abstract/Free Full Text]
6.
Uzan G, Prenant M, Prandini M-H, Martin F, Marguerie G:
Tissue-specific expression of the platelet GPIIb gene.
J Biol Chem
266:8932, 1991[Abstract/Free Full Text]
7.
Block KL, Ravid K, Phung QH, Poncz M:
Characterization of regulatory elements in the 5'-flanking region of the rat GPIIb gene by studies in a primary rat marrow culture system.
Blood
84:3385, 1994[Abstract/Free Full Text]
8.
Shivdasani RA, Fujiwara Y, McDevitt MA, Orkin SH:
A lineage-selective knockout establishes the critical role of transcription factor GATA-1 in megakaryocyte growth and platelet development.
EMBO J
16:3965, 1997[Medline]
[Order article via Infotrieve]
9.
Shivdasani RA, Rosenblatt MF, Zucker-Franklin D, Jackson CW, Hunt P, Saris C, Orkin SH:
Transcription factor NF-E2 is required for platelet formation independent of the actions of thrombopoietin/MGDF in megakaryocyte development.
Cell
81:695, 1995[Medline]
[Order article via Infotrieve]
10.
Tsang AP, Visvader JE, Turner CA, Fujiwara Y, Yu C, Weiss MJ, Crossley M, Orkin SH:
FOG, a multitype zinc finger protein, acts as a cofactor for transcription factor GATA-1 in erythroid and megakaryocytic differentiation.
Cell
90:109, 1997[Medline]
[Order article via Infotrieve]
11.
Tsang AP, Fujiwara Y, Hom DB, Orkin SH:
Failure of megakaryopoiesis and arrested erythropoiesis in mice lacking the GATA-1 transcriptional cofactor FOG.
Genes Dev
12:1176, 1998[Abstract/Free Full Text]
12.
Visvader JE, Elefanty AG, Strasser A, Adams JM:
GATA-1 but not SCL induces megakaryocytic differentiation in an early myeloid line.
EMBO J
11:4557, 1992[Medline]
[Order article via Infotrieve]
13.
Visvader J, Adams JM:
Megakaryocytic differentiation induced in 416B myeloid cells by GATA-2 and GATA-3 transgenes or 5-azacytidine is tightly coupled to GATA-1 expression.
Blood
82:1493, 1993[Abstract/Free Full Text]
14.
Kulessa H, Frampton J, Graf T:
GATA-1 reprograms avian myelomonocytic cell lines into eosinophils, thromboblasts, and erythroblasts.
Genes Dev
9:1250, 1995[Abstract/Free Full Text]
15.
Pevny L, Lin C-S, D'Agati V, Simon MC, Orkin SH, Costantini F:
Development of hematopoietic cells lacking transcription factor GATA-1.
Development
121:163, 1995[Abstract]
16.
Takahashi S, Komeno T, Suwabe N, Yoh K, Nakajima O, Nishimura S, Kuroha T, Yamamoto M:
Role of GATA-1 in proliferation and differentiation of definitive erythroid and megakaryocytic cells in vivo.
Blood
92:434, 1998[Abstract/Free Full Text]
17.
Villeval J-L, Cohen-Solal K, Tulliez M, Giraudier S, Guichard J, Burstein SA, Cramer EM, Vainchenker W, Wendling F:
High thrombopoietin production by hemopoietic cells induces a fatal myeloproliferative syndrome in mice.
Blood
90:4369, 1997[Abstract/Free Full Text]
18.
Jackson CW:
Cholinesterase as a possible marker for early cells of the megakaryocytic series.
Blood
42:413, 1973[Abstract/Free Full Text]
19.
Levine RF, Fedorko ME:
Isolation of intact megakaryocytes from guinea pig femoral marrow. Successful harvest made possible with inhibitors of platelet aggregation; enrichment achieved with a two-step separation technique.
J Cell Biol
69:159, 1976[Abstract/Free Full Text]
20.
McDonald T, Jackson CW:
Thrombopoietin derived from human embryonic kidney cells stimulates an increase in DNA content of murine megakaryocytes in vivo.
Exp Hematol
18:758, 1990[Medline]
[Order article via Infotrieve]
21.
Krishan A:
Rapid flow cytofluorometric analysis of mammalian cell cycle by propidium iodide staining.
J Cell Biol
66:188, 1975[Abstract/Free Full Text]
22.
Jackson CW, Brown KL, Somerville BC, Lyles SA, Look AT:
Two-color flow cytometric measurement of DNA distributions of rat megakaryocytes in unfixed unfractionated marrow cell suspensions.
Blood
63:768, 1984[Abstract/Free Full Text]
23.
Weiss MJ, Keller G, Orkin SH:
Novel insights into erythroid development revealed through in vitro differentiation of GATA-1-embryonic stem cells.
Genes Dev
8:1184, 1994[Abstract/Free Full Text]
24.
Stenberg PE, Barrie RJ, Pestina TI, Steward SA, Arnold JT, Murti AK, Hutson NK, Jackson CW:
Prolonged bleeding time with defective platelet filopodia formation in the Wistar Furth rat.
Blood
91:1599, 1998[Abstract/Free Full Text]
25.
Shivdasani RA, Fielder P, Keller G-A, Orkin SH, de Sauvage FJ:
Regulation of the serum concentration of thrombopoietin in thrombocytopenic NF-E2 knockout mice.
Blood
90:1821, 1997[Abstract/Free Full Text]
26.
Dejana E, Villa S, de Gaetano G:
Bleeding time in rats: A comparison of different experimental conditions.
Thromb Haemost
48:108, 1982[Medline]
[Order article via Infotrieve]
27.
Ault KA, Knowles C:
In vivo biotinylation demonstrates that reticulated platelets are the youngest platelets in the circulation.
Exp Hematol
23:996, 1995[Medline]
[Order article via Infotrieve]
28.
Ault KA, Knowles C, Mitchell J, Brown CL, Schulz KL, Beamer WG:
Genetic control of platelet activation in inbred mouse strains.
Platelets
8:235, 1997
29.
Bessman JD, Gilmer PR, Gardner FH:
Use of mean platelet volume improves detection of platelet disorders.
Blood Cells
11:127, 1985[Medline]
[Order article via Infotrieve]
30.
Bunting S, Widmer R, Lipari T, Rangell L, Steinmetz H, Carver-Moore K, Moore MW, Keller G-A, de Sauvage FJ:
Normal platelets and megakaryocytes are produced in vivo in the absence of thrombopoietin.
Blood
90:3423, 1997[Abstract/Free Full Text]
31.
Weiss MJ, Orkin SH:
Transcription factor GATA-1 permits survival and maturation of erythroid precursors by preventing apoptosis.
Proc Natl Acad Sci USA
92:9623, 1995[Abstract/Free Full Text]
32.
Hashimoto Y, Ware J:
Identification of essential GATA and Ets binding motifs within the promoter of the platelet glycoprotein Iba gene.
J Biol Chem
270:24532, 1995[Abstract/Free Full Text]
33.
Yagi M, Edelhoff S, Disteche CM, Roth GJ:
Structural characterization and chromosomal location of the gene encoding human platelet glycoprotein Ib beta.
J Biol Chem
269:17424, 1994[Abstract/Free Full Text]
34.
Deveaux S, Filipe A, Lemarchandel V, Ghysdael J, Romeo P-H, Mignotte V:
Analysis of the thrombopoietin receptor (MPL) promoter implicates GATA and Ets proteins in the coregulation of megakaryocyte-specific genes.
Blood
87:4678, 1996[Abstract/Free Full Text]
35.
Ravid K, Doi T, Beeler DL, Kuter DJ, Rosenberg RD:
Transcriptional regulation of the rat platelet factor 4 gene: Interaction between an enhancer/silencer domain and the GATA site.
Mol Cell Biol
11:6116, 1991[Abstract/Free Full Text]
36.
Hickey MJ, Roth GJ:
Characterization of the gene encoding human platelet glycoprotein IX.
J Biol Chem
268:3438, 1993[Abstract/Free Full Text]
37.
Seshasayee D, Gaines P, Wojchowski DM:
GATA-1 dominantly activates a program of erythroid gene expression in factor-dependent myeloid FDCW2 cells.
Mol Cell Biol
18:3278, 1998[Abstract/Free Full Text]
38.
Orkin SH:
GATA-binding transcription factors in hematopoietic cells.
Blood
80:575, 1992[Free Full Text]
39.
Ludlow LB, Schick BP, Budarf ML, Driscoll DA, Zackai EH, Cohen A, Konkle BA:
Identification of a mutation in a GATA binding site of the platelet glycoprotein Ibb promoter resulting in the Bernard-Soulier syndrome.
J Biol Chem
271:22076, 1996[Abstract/Free Full Text]
40.
Lecine P, Villeval J-L, Vyas P, Swencki B, Xu Y, Shivdasani RA:
Mice lacking transcription factor NF-E2 provide in vivo validation of the proplatelet model of thrombocytopenia and show a platelet production defect that is intrinsic to megakaryocytes.
Blood
92:1608, 1998[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
J. W. Snow and S. H. Orkin
Translational Isoforms of FOG1 Regulate GATA1-interacting Complexes
J. Biol. Chem.,
October 23, 2009;
284(43):
29310 - 29319.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Z. Huang, L. C. Dore, Z. Li, S. H. Orkin, G. Feng, S. Lin, and J. D. Crispino
GATA-2 Reinforces Megakaryocyte Development in the Absence of GATA-1
Mol. Cell. Biol.,
September 15, 2009;
29(18):
5168 - 5180.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. R. Migliaccio, F. Martelli, M. Verrucci, M. Sanchez, M. Valeri, G. Migliaccio, A. M. Vannucchi, M. Zingariello, A. Di Baldassarre, B. Ghinassi, et al.
Gata1 expression driven by the alternative HS2 enhancer in the spleen rescues the hematopoietic failure induced by the hypomorphic Gata1low mutation
Blood,
September 3, 2009;
114(10):
2107 - 2120.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Huang, M. Yu, T. E. Akie, T. B. Moran, A. J. Woo, N. Tu, Z. Waldon, Y. Y. Lin, H. Steen, and A. B. Cantor
Differentiation-Dependent Interactions between RUNX-1 and FLI-1 during Megakaryocyte Development
Mol. Cell. Biol.,
August 1, 2009;
29(15):
4103 - 4115.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. J. Stankiewicz and J. D. Crispino
ETS2 and ERG promote megakaryopoiesis and synergize with alterations in GATA-1 to immortalize hematopoietic progenitor cells
Blood,
April 2, 2009;
113(14):
3337 - 3347.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Bedi, J. Du, A. K. Sharma, I. Gomes, and S. J. Ackerman
Human C/EBP-{epsilon} activator and repressor isoforms differentially reprogram myeloid lineage commitment and differentiation
Blood,
January 8, 2009;
113(2):
317 - 327.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. E. Elagib, I. S. Mihaylov, L. L. Delehanty, G. C. Bullock, K. D. Ouma, J. F. Caronia, S. L. Gonias, and A. N. Goldfarb
Cross-talk of GATA-1 and P-TEFb in megakaryocyte differentiation
Blood,
December 15, 2008;
112(13):
4884 - 4894.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. P. Rodrigues, A. S. Boyd, C. Fugazza, G. E. May, Y. Guo, A. J. Tipping, D. T. Scadden, P. Vyas, and T. Enver
GATA-2 regulates granulocyte-macrophage progenitor cell function
Blood,
December 15, 2008;
112(13):
4862 - 4873.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. Hamlett, J. Draper, J. Strouboulis, F. Iborra, C. Porcher, and P. Vyas
Characterization of megakaryocyte GATA1-interacting proteins: the corepressor ETO2 and GATA1 interact to regulate terminal megakaryocyte maturation
Blood,
October 1, 2008;
112(7):
2738 - 2749.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Lorenzo, M. Horowitz, and Y. Choi
Osteoimmunology: Interactions of the Bone and Immune System
Endocr. Rev.,
June 1, 2008;
29(4):
403 - 440.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. J. Woo, T. B. Moran, Y. L. Schindler, S.-K. Choe, N. B. Langer, M. R. Sullivan, Y. Fujiwara, B. H. Paw, and A. B. Cantor
Identification of ZBP-89 as a Novel GATA-1-Associated Transcription Factor Involved in Megakaryocytic and Erythroid Development
Mol. Cell. Biol.,
April 15, 2008;
28(8):
2675 - 2689.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Gutierrez, S. Tsukamoto, M. Suzuki, H. Yamamoto-Mukai, M. Yamamoto, S. Philipsen, and K. Ohneda
Ablation of Gata1 in adult mice results in aplastic crisis, revealing its essential role in steady-state and stress erythropoiesis
Blood,
April 15, 2008;
111(8):
4375 - 4385.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. G. Fuhrken, C. Chen, P. A. Apostolidis, M. Wang, W. M. Miller, and E. T. Papoutsakis
Gene Ontology-driven transcriptional analysis of CD34+ cell-initiated megakaryocytic cultures identifies new transcriptional regulators of megakaryopoiesis
Physiol Genomics,
April 1, 2008;
33(2):
159 - 169.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. B. Cantor, H. Iwasaki, Y. Arinobu, T. B. Moran, H. Shigematsu, M. R. Sullivan, K. Akashi, and S. H. Orkin
Antagonism of FOG-1 and GATA factors in fate choice for the mast cell lineage
J. Exp. Med.,
March 17, 2008;
205(3):
611 - 624.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Freson, K. Peeters, R. De Vos, C. Wittevrongel, C. Thys, M. F. Hoylaerts, J. Vermylen, and C. Van Geet
PACAP and its receptor VPAC1 regulate megakaryocyte maturation: therapeutic implications
Blood,
February 15, 2008;
111(4):
1885 - 1893.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. J. Suva, E. Hartman, J. D. Dilley, S. Russell, N. S. Akel, R. A. Skinner, W. R. Hogue, U. Budde, K. I. Varughese, T. Kanaji, et al.
Platelet Dysfunction and a High Bone Mass Phenotype in a Murine Model of Platelet-Type von Willebrand Disease
Am. J. Pathol.,
February 1, 2008;
172(2):
430 - 439.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
O. Tanabe, Y. Shen, Q. Liu, A. D. Campbell, T. Kuroha, M. Yamamoto, and J. D. Engel
The TR2 and TR4 orphan nuclear receptors repress Gata1 transcription
Genes & Dev.,
November 1, 2007;
21(21):
2832 - 2844.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Garimella, M. A. Kacena, S. E. Tague, J. Wang, M. C. Horowitz, and H. C. Anderson
Expression of Bone Morphogenetic Proteins and Their Receptors in the Bone Marrow Megakaryocytes of GATA-1low Mice: A Possible Role in Osteosclerosis
J. Histochem. Cytochem.,
July 1, 2007;
55(7):
745 - 752.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. G. Muntean, L. Pang, M. Poncz, S. F. Dowdy, G. A. Blobel, and J. D. Crispino
Cyclin D-Cdk4 is regulated by GATA-1 and required for megakaryocyte growth and polyploidization
Blood,
June 15, 2007;
109(12):
5199 - 5207.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Raslova, A. Kauffmann, D. Sekkai, H. Ripoche, F. Larbret, T. Robert, D. T. Le Roux, G. Kroemer, N. Debili, P. Dessen, et al.
Interrelation between polyploidization and megakaryocyte differentiation: a gene profiling approach
Blood,
April 15, 2007;
109(8):
3225 - 3234.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Z. Chen, M. Hu, and R. A. Shivdasani
Expression analysis of primary mouse megakaryocyte differentiation and its application in identifying stage-specific molecular markers and a novel transcriptional target of NF-E2
Blood,
February 15, 2007;
109(4):
1451 - 1459.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Pang, H.-H. Xue, G. Szalai, X. Wang, Y. Wang, D. K. Watson, W. J. Leonard, G. A. Blobel, and M. Poncz
Maturation stage-specific regulation of megakaryopoiesis by pointed-domain Ets proteins
Blood,
October 1, 2006;
108(7):
2198 - 2206.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. P. McCormack, M. A. Hall, S. M. Schoenwaelder, Q. Zhao, S. Ellis, J. A. Prentice, A. J. Clarke, N. J. Slater, J. M. Salmon, S. P. Jackson, et al.
A critical role for the transcription factor Scl in platelet production during stress thrombopoiesis
Blood,
October 1, 2006;
108(7):
2248 - 2256.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. J. Majewski, D. Metcalf, L. A. Mielke, D. L. Krebs, S. Ellis, M. R. Carpinelli, S. Mifsud, L. Di Rago, J. Corbin, N. A. Nicola, et al.
A mutation in the translation initiation codon of Gata-1 disrupts megakaryocyte maturation and causes thrombocytopenia
PNAS,
September 19, 2006;
103(38):
14146 - 14151.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
O. Wagner-Ballon, H. Chagraoui, E. Prina, M. Tulliez, G. Milon, H. Raslova, J.-L. Villeval, W. Vainchenker, and S. Giraudier
Monocyte/Macrophage Dysfunctions Do Not Impair the Promotion of Myelofibrosis by High Levels of Thrombopoietin.
J. Immunol.,
June 1, 2006;
176(11):
6425 - 6433.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Guyot, K. Murai, Y. Fujiwara, V. Valverde-Garduno, M. Hammett, S. Wells, N. Dear, S. H. Orkin, C. Porcher, and P. Vyas
Characterization of a Megakaryocyte-specific Enhancer of the Key Hemopoietic Transcription Factor GATA1
J. Biol. Chem.,
May 12, 2006;
281(19):
13733 - 13742.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Garcia and J. Frampton
The transcription factor B-Myb is essential for S-phase progression and genomic stability in diploid and polyploid megakaryocytes
J. Cell Sci.,
April 15, 2006;
119(8):
1483 - 1493.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. L. Stachura, S. T. Chou, and M. J. Weiss
Early block to erythromegakaryocytic development conferred by loss of transcription factor GATA-1
Blood,
January 1, 2006;
107(1):
87 - 97.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Martelli, B. Ghinassi, B. Panetta, E. Alfani, V. Gatta, A. Pancrazzi, C. Bogani, A. M. Vannucchi, F. Paoletti, G. Migliaccio, et al.
Variegation of the phenotype induced by the Gata1low mutation in mice of different genetic backgrounds
Blood,
December 15, 2005;
106(13):
4102 - 4113.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Tefferi
Pathogenesis of Myelofibrosis With Myeloid Metaplasia
J. Clin. Oncol.,
November 20, 2005;
23(33):
8520 - 8530.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Kuhl, A. Atzberger, F. Iborra, B. Nieswandt, C. Porcher, and P. Vyas
GATA1-Mediated Megakaryocyte Differentiation and Growth Control Can Be Uncoupled and Mapped to Different Domains in GATA1
Mol. Cell. Biol.,
October 1, 2005;
25(19):
8592 - 8606.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. G. Muntean and J. D. Crispino
Differential requirements for the activation domain and FOG-interaction surface of GATA-1 in megakaryocyte gene expression and development
Blood,
August 15, 2005;
106(4):
1223 - 1231.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. P. Rodrigues, V. Janzen, R. Forkert, D. M. Dombkowski, A. S. Boyd, S. H. Orkin, T. Enver, P. Vyas, and D. T. Scadden
Haploinsufficiency of GATA-2 perturbs adult hematopoietic stem-cell homeostasis
Blood,
July 15, 2005;
106(2):
477 - 484.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Nishiyama, T. Ito, M. Nishiyama, S. Masaki, K. Maeda, N. Nakano, W. Ng, K. Fukuyama, M. Yamamoto, K. Okumura, et al.
GATA-1 is required for expression of Fc{varepsilon}RI on mast cells: analysis of mast cells derived from GATA-1 knockdown mouse bone marrow
Int. Immunol.,
July 1, 2005;
17(7):
847 - 856.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. C. Hughan, Y. Senis, D. Best, A. Thomas, J. Frampton, P. Vyas, and S. P. Watson
Selective impairment of platelet activation to collagen in the absence of GATA1
Blood,
June 1, 2005;
105(11):
4369 - 4376.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. M. Vannucchi, L. Bianchi, F. Paoletti, A. Pancrazzi, E. Torre, M. Nishikawa, M. Zingariello, A. Di Baldassarre, R. A. Rana, R. Lorenzini, et al.
A pathobiologic pathway linking thrombopoietin, GATA-1, and TGF-{beta}1 in the development of myelofibrosis
Blood,
May 1, 2005;
105(9):
3493 - 3501.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Toki, F. Katsuoka, R. Kanezaki, G. Xu, H. Kurotaki, J. Sun, T. Kamio, S. Watanabe, S. Tandai, K. Terui, et al.
Transgenic expression of BACH1 transcription factor results in megakaryocytic impairment
Blood,
April 15, 2005;
105(8):
3100 - 3108.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Ezoe, I. Matsumura, K. Gale, Y. Satoh, J. Ishikawa, M. Mizuki, S. Takahashi, N. Minegishi, K. Nakajima, M. Yamamoto, et al.
GATA Transcription Factors Inhibit Cytokine-dependent Growth and Survival of a Hematopoietic Cell Line through the Inhibition of STAT3 Activity
J. Biol. Chem.,
April 1, 2005;
280(13):
13163 - 13170.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Ferreira, K. Ohneda, M. Yamamoto, and S. Philipsen
GATA1 Function, a Paradigm for Transcription Factors in Hematopoiesis
Mol. Cell. Biol.,
February 15, 2005;
25(4):
1215 - 1227.
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Vilaboa, R. Bermejo, P. Martinez, R. Bornstein, and C. Cales
A novel E2 box-GATA element modulates Cdc6 transcription during human cells polyploidization
Nucleic Acids Res.,
December 8, 2004;
32(21):
6454 - 6467.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Centurione, A. Di Baldassarre, M. Zingariello, D. Bosco, V. Gatta, R. A. Rana, V. Langella, A. Di Virgilio, A. M. Vannucchi, and A. R. Migliaccio
Increased and pathologic emperipolesis of neutrophils within megakaryocytes associated with marrow fibrosis in GATA-1low mice
Blood,
December 1, 2004;
104(12):
3573 - 3580.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Ahmed, A. Sternberg, G. Hall, A. Thomas, O. Smith, A. O'Marcaigh, R. Wynn, R. Stevens, M. Addison, D. King, et al.
Natural history of GATA1 mutations in Down syndrome
Blood,
April 1, 2004;
103(7):
2480 - 2489.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Shimizu, K. Ohneda, J. D. Engel, C. D. Trainor, and M. Yamamoto
Transgenic rescue of GATA-1-deficient mice with GATA-1 lacking a FOG-1 association site phenocopies patients with X-linked thrombocytopenia
Blood,
April 1, 2004;
103(7):
2560 - 2567.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Sun, G. Mao, and A. K. Rao
Association of CBFA2 mutation with decreased platelet PKC-{theta} and impaired receptor-mediated activation of GPIIb-IIIa and pleckstrin phosphorylation: proteins regulated by CBFA2 play a role in GPIIb-IIIa activation
Blood,
February 1, 2004;
103(3):
948 - 954.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Gurbuxani, P. Vyas, and J. D. Crispino
Recent insights into the mechanisms of myeloid leukemogenesis in Down syndrome
Blood,
January 15, 2004;
103(2):
399 - 406.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Fossett, K. Hyman, K. Gajewski, S. H. Orkin, and R. A. Schulz
Combinatorial interactions of Serpent, Lozenge, and U-shaped regulate crystal cell lineage commitment during Drosophila hematopoiesis
PNAS,
September 30, 2003;
100(20):
11451 - 11456.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Rylski, J. J. Welch, Y.-Y. Chen, D. L. Letting, J. A. Diehl, L. A. Chodosh, G. A. Blobel, and M. J. Weiss
GATA-1-Mediated Proliferation Arrest during Erythroid Maturation
Mol. Cell. Biol.,
July 15, 2003;
23(14):
5031 - 5042.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. E. Italiano Jr, W. Bergmeier, S. Tiwari, H. Falet, J. H. Hartwig, K. M. Hoffmeister, P. Andre, D. D. Wagner, and R. A. Shivdasani
Mechanisms and implications of platelet discoid shape
Blood,
June 15, 2003;
101(12):
4789 - 4796.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. K. Hitzler, J. Cheung, Y. Li, S. W. Scherer, and A. Zipursky
GATA1 mutations in transient leukemia and acute megakaryoblastic leukemia of Down syndrome
Blood,
June 1, 2003;
101(11):
4301 - 4304.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. E. Elagib, F. K. Racke, M. Mogass, R. Khetawat, L. L. Delehanty, and A. N. Goldfarb
RUNX1 and GATA-1 coexpression and cooperation in megakaryocytic differentiation
Blood,
June 1, 2003;
101(11):
4333 - 4341.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. R. Kyriakides, P. Rojnuckarin, M. A. Reidy, K. D. Hankenson, T. Papayannopoulou, K. Kaushansky, and P. Bornstein
Megakaryocytes require thrombospondin-2 for normal platelet formation and function
Blood,
May 15, 2003;
101(10):
3915 - 3923.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. A. Hall, D. J. Curtis, D. Metcalf, A. G. Elefanty, K. Sourris, L. Robb, J. R. Gothert, S. M. Jane, and C. G. Begley
The critical regulator of embryonic hematopoiesis, SCL, is vital in the adult for megakaryopoiesis, erythropoiesis, and lineage choice in CFU-S12
PNAS,
February 4, 2003;
100(3):
992 - 997.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. R. Migliaccio, R. A. Rana, M. Sanchez, R. Lorenzini, L. Centurione, L. Bianchi, A. M. Vannucchi, G. Migliaccio, and S. H. Orkin
GATA-1 as a Regulator of Mast Cell Differentiation Revealed by the Phenotype of the GATA-1low Mouse Mutant
J. Exp. Med.,
February 3, 2003;
197(3):
281 - 296.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Du, M. J. Stankiewicz, Y. Liu, Q. Xi, J. E. Schmitz, J. A. Lekstrom-Himes, and S. J. Ackerman
Novel Combinatorial Interactions of GATA-1, PU.1, and C/EBPepsilon Isoforms Regulate Transcription of the Gene Encoding Eosinophil Granule Major Basic Protein
J. Biol. Chem.,
November 1, 2002;
277(45):
43481 - 43494.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Yu, K. K. Niakan, M. Matsushita, G. Stamatoyannopoulos, S. H. Orkin, and W. H. Raskind
X-linked thrombocytopenia with thalassemia from a mutation in the amino finger of GATA-1 affecting DNA binding rather than FOG-1 interaction
Blood,
August 28, 2002;
100(6):
2040 - 2045.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. M. Vannucchi, L. Bianchi, C. Cellai, F. Paoletti, R. A. Rana, R. Lorenzini, G. Migliaccio, and A. R. Migliaccio
Development of myelofibrosis in mice genetically impaired for GATA-1 expression (GATA-1low mice)
Blood,
July 30, 2002;
100(4):
1123 - 1132.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. N. Chang, A. B. Cantor, Y. Fujiwara, M. B. Lodish, S. Droho, J. D. Crispino, and S. H. Orkin
GATA-factor dependence of the multitype zinc-finger protein FOG-1 for its essential role in megakaryopoiesis
PNAS,
July 9, 2002;
99(14):
9237 - 9242.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. B. Cantor, S. G. Katz, and S. H. Orkin
Distinct Domains of the GATA-1 Cofactor FOG-1 Differentially Influence Erythroid versus Megakaryocytic Maturation
Mol. Cell. Biol.,
June 15, 2002;
22(12):
4268 - 4279.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Yu, A. B. Cantor, H. Yang, C. Browne, R. A. Wells, Y. Fujiwara, and S. H. Orkin
Targeted Deletion of a High-Affinity GATA-binding Site in the GATA-1 Promoter Leads to Selective Loss of the Eosinophil Lineage In Vivo
J. Exp. Med.,
June 3, 2002;
195(11):
1387 - 1395.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. G. Mehaffey, A. L. Newton, M. J. Gandhi, M. Crossley, and J. G. Drachman
X-linked thrombocytopenia caused by a novel mutation of GATA-1
Blood,
November 1, 2001;
98(9):
2681 - 2688.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Eisbacher, L. M. Khachigian, T. H. Khin, M. L. Holmes, and B. H. Chong
Inducible Expression of the Megakarocyte-specific Gene Glycoprotein IX Is Mediated through an Ets Binding Site and Involves Upstream Activation of Extracellular Signal-regulated Kinase
Cell Growth Differ.,
August 1, 2001;
12(8):
435 - 445.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Freson, K. Devriendt, G. Matthijs, A. Van Hoof, R. De Vos, C. Thys, K. Minner, M. F. Hoylaerts, J. Vermylen, and C. Van Geet
Platelet characteristics in patients with X-linked macrothrombocytopenia because of a novel GATA1 mutation
Blood,
July 1, 2001;
98(1):
85 - 92.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. M. Vannucchi, L. Bianchi, C. Cellai, F. Paoletti, V. Carrai, A. Calzolari, L. Centurione, R. Lorenzini, C. Carta, E. Alfani, et al.
Accentuated response to phenylhydrazine and erythropoietin in mice genetically impaired for their GATA-1 expression (GATA-1low mice)
Blood,
May 15, 2001;
97(10):
3040 - 3050.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M.-j. Xu, S. Matsuoka, F.-C. Yang, Y. Ebihara, A. Manabe, R. Tanaka, M. Eguchi, S. Asano, T. Nakahata, and K. Tsuji
Evidence for the presence of murine primitive megakarycytopoiesis in the early yolk sac
Blood,
April 1, 2001;
97(7):
2016 - 2022.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Vyas, F. A. Norris, R. Joseph, P. W. Majerus, and S. H. Orkin
Inositol polyphosphate 4-phosphatase type I regulates cell growth downstream of transcription factor GATA-1
PNAS,
November 16, 2000;
(2000)
250476397.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
S. Tsuzuki, M. Towatari, H. Saito, and T. Enver
Potentiation of GATA-2 Activity through Interactions with the Promyelocytic Leukemia Protein (PML) and the t(15;17)-Generated PML-Retinoic Acid Receptor alpha Oncoprotein
Mol. Cell. Biol.,
September 1, 2000;
20(17):
6276 - 6286.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
P. Albanese, M. Leboeuf, J.-P. Rosa, and G. Uzan
Identification of a GATA-overlapping sequence within the enhancer of the murine GPIIb promoter that induces transcriptional deregulation in human K562 cells
Blood,
August 15, 2000;
96(4):
1348 - 1357.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. G. Drachman, G. P. Jarvik, and M. G. Mehaffey
Autosomal dominant thrombocytopenia: incomplete megakaryocyte differentiation and linkage to human chromosome 10
Blood,
July 1, 2000;
96(1):
118 - 125.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Moroni, T. Mastrangelo, R. Razzini, L. Cairns, P. Moi, S. Ottolenghi, and B. Giglioni
Regulation of Mouse p45 NF-E2 Transcription by an Erythroid-specific GATA-dependent Intronic Alternative Promoter
J. Biol. Chem.,
March 31, 2000;
275(14):
10567 - 10576.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Gainsford, H. Nandurkar, D. Metcalf, L. Robb, C. G. Begley, and W. S. Alexander
The residual megakaryocyte and platelet production in c-Mpl-deficient mice is not dependent on the actions of interleukin-6, interleukin-11, or leukemia inhibitory factor
Blood,
January 15, 2000;
95(2):
528 - 534.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Shiraga, A. Ritchie, S. Aidoudi, V. Baron, D. Wilcox, G. White, B. Ybarrondo, G. Murphy, A. Leavitt, and S. Shattil
Primary Megakaryocytes Reveal a Role for Transcription Factor Nf-E2 in Integrin {alpha}iib{beta}3 Signaling
J. Cell Biol.,
December 27, 1999;
147(7):
1419 - 1430.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A.-H. Lagrue-Lak-Hal, N. Debili, G. Kingbury, C. Lecut, J.-P. Le Couedic, J.-L. Villeval, M. Jandrot-Perrus, and W. Vainchenker
Expression and Function of the Collagen Receptor GPVI during Megakaryocyte Maturation
J. Biol. Chem.,
April 27, 2001;
276(18):
15316 - 15325.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Ware, S. Russell, and Z. M. Ruggeri
Generation and rescue of a murine model of platelet dysfunction: The Bernard-Soulier syndrome
PNAS,
March 14, 2000;
97(6):
2803 - 2808.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Vyas, F. A. Norris, R. Joseph, P. W. Majerus, and S. H. Orkin
Inositol polyphosphate 4-phosphatase type I regulates cell growth downstream of transcription factor GATA-1
PNAS,
December 5, 2000;
97(25):
13696 - 13701.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Kimura, A. Hart, M. Hirashima, C. Wang, D. Holmyard, J. Pittman, X.-L. Pang, C. W. Jackson, and A. Bernstein
Zinc Finger Protein, Hzf, Is Required for Megakaryocyte Development and Hemostasis
J. Exp. Med.,
April 1, 2002;
195(7):
941 - 952.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION