Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vyas, P.
Right arrow Articles by Shivdasani, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vyas, P.
Right arrow Articles by Shivdasani, R. A.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 93 No. 9 (May 1), 1999: pp. 2867-2875

Consequences of GATA-1 Deficiency in Megakaryocytes and Platelets

By Paresh Vyas, Kenneth Ault, Carl W. Jackson, Stuart H. Orkin, and Ramesh A. Shivdasani

From the Department of Hematology-Oncology and Howard Hughes Medical Institute, Children's Hospital, Boston; the Departments of Adult Oncology and Medicine, Dana-Farber Cancer Institute and Harvard Medical School, Boston, MA; Maine Medical Center Research Institute, South Portland, ME; and the Department of Experimental Hematology, St Jude Children's Research Hospital, Memphis, TN.


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In the absence of the hematopoietic transcription factor GATA-1, mice develop thrombocytopenia and an increased number of megakaryocytes characterized by marked ultrastructural abnormalities. These observations establish a critical role for GATA-1 in megakaryopoiesis and raise the question as to how GATA-1 influences megakaryocyte maturation and platelet production. To begin to address this, we have performed a more detailed examination of the megakaryocytes and platelets produced in mice that lack GATA-1 in this lineage. Our analysis demonstrates that compared with their normal counterparts, GATA-1-deficient primary megakaryocytes exhibit significant hyperproliferation in liquid culture, suggesting that the megakaryocytosis seen in animals is nonreactive. Morphologically, these mutant megakaryocytes are small and show evidence of retarded nuclear and cytoplasmic development. A significant proportion of these cells do not undergo endomitosis and express markedly lower levels of mRNA of all megakaryocyte-associated genes tested, including GPIbalpha , GPIbbeta , platelet factor 4 (PF4), c-mpl, and p45 NF-E2. These results are consistent with regulation of a program of megakaryocytic differentiation by GATA-1. Bleeding times are significantly prolonged in mutant animals. GATA-1-deficient platelets show abnormal ultrastructure, reminiscent of the megakaryocytes from which they are derived, and exhibit modest but selective defects in platelet activation in response to thrombin or to the combination of adenosine diphosphate (ADP) and epinephrine. Our findings indicate that GATA-1 serves multiple functions in megakaryocyte development, influencing both cellular growth and maturation.
© 1999 by The American Society of Hematology.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

THE DIFFERENTIATION of hematopoietic cells from pluripotent progenitors involves the progressive restriction of differentiation potential and the acquisition of lineage-specific patterns of gene expression.1,2 These patterns are coordinated by a number of tissue-restricted and general transcription factors that act in a combinatorial manner. In the megakaryocytic lineage, one can operationally divide the roles of these transcription factors into those required for the specification and maintenance of progenitors, maturation of megakaryoctyes, and terminal differentiation of megakaryocytes, including platelet production.

From analysis of expression patterns, of cis-elements important in the regulation of megakaryocyte-specific genes and of mouse null mutants of transcription factor genes, a number of tissue-restricted transcription factors are implicated in megakaryopoiesis. These include SCL/Tal-1, c-Myb, Ets family members, GATA-1, GATA-2, FOG, and NF-E2.3-11 Among these, GATA-1, FOG, and NF-E2 stand out for the nonredundant and essential roles they play in megakaryopoiesis.

Two lines of evidence have suggested that GATA-1 can participate in megakaryopoiesis. First, when overexpressed, either directly or indirectly, GATA-1 can induce megakaryocytic differentiation in a multipotential murine myeloid cell line, 416B.12,13 Similarly, forced GATA-1 expression in Myb-Ets-transformed chicken myeloblasts induces differentiation into thromboblasts.14 Second, in fetal liver of chimeric mice generated with GATA-1-null ES cells there is a fourfold increase in megakaryocyte number, suggesting that GATA-1 influences megakaryocyte homeostasis.15 However, these studies do not clearly define a requirement for GATA-1 in megakaryocytes. Recently, we generated two mutant lines of mice with megakaryocyte-specific loss of GATA-1 expression, allowing a more direct evaluation of the importance of GATA-1 in this lineage.8 Preliminary analysis of these mice pointed to a critical role for GATA-1 in the proper proliferation and terminal maturation of megarkaryocytes and in platelet production.

Mice with megakaryocyte-specific GATA-1 deficiency have a platelet count of approximately 15% of normal with a markedly increased mean platelet volume, suggesting that the platelets may be structurally abnormal.8 There is also a remarkable megakaryocytosis in these animals, with a significant increase in megakaryocyte numbers in the spleen and bone marrow. Colony assays from yolk sac and fetal liver indicate that megakaryocyte progenitor numbers are normal but that some megakaryocyte progenitors exhibit marked hyperproliferation, producing abnormally large colonies principally composed of immature megakaryocytes similar to those seen in vivo. Ultrastructural examination of these megakaryocytes showed gross abnormalities with a small cytoplasm, excess rough endoplasmic reticulum, a reduction in the number of platelet granules, and underdeveloped and disorganized platelet demarcation membranes. Takahashi et al have also recently reported that when GATA-1 levels are reduced in vivo, heterozygous female mice display megakaryocytosis in the spleen.16

These studies lead to the question as to how GATA-1 orchestrates megakaryocyte development. To begin to address this issue, we have performed a detailed characterization of GATA-1-deficient megakaryocytes and platelets. These studies more accurately define where GATA-1 is likely to act in this lineage.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Generation of neoDelta HS and Delta neoDelta HS mice.   NeoDelta HS and Delta neoDelta HS mice used in this study have been previously described.8 They were generated by a targeted deletion of an upstream region of the GATA-1 locus. The mutation removes at least one DNase I hypersensitive site (HS), which probably earmarks sequences important for GATA-1 expression. Two different lines of mutant mice were generated: neoDelta HS, in which the PGK-neo selection cassette remains in the targeted locus, and Delta neoDelta HS, in which the selection marker has been excised from the targeted locus. In neoDelta HS, there is no detectable expression of GATA-1 in megakaryocytes, whereas in neoDelta HS mice, GATA-1 is expressed at a level of approximately 1% to 5% of normal.8 The megakaryocyte and platelet phenotypes of the two mutant mice are indistinguishable, but as Delta neoDelta HS mice are viable, they were used for studies involving adult mice.

Determination of primary megakaryocyte growth curves.   Fetal liver cells were isolated from 15 neoDelta HS fetuses and 15 normal littermate controls at embryonic day 12.5 (E12.5). Single-cell suspensions from individual fetal livers were cultured in Dulbecco's minimum essential medium (DMEM) with 10% fetal calf serum (FCS) supplemented with 1% recombinant human thrombopoietin (Tpo) tissue culture supernatant.17 A 50-µL quantity of the culture was taken every 2 days for cytocentrifugation and the slides assayed for acetylcholinesterase activity.18 The total number of acetylcholinesterase-positive cells was counted in 50 µL.

DNA content analysis of primary megakaryocytes.   Individual single-cell suspensions were made from bone marrow harvested from the femurs of eight Delta neoDelta HS mice and six wild-type littermates aged 6 to 10 weeks, and resuspended and washed once in CATCH medium (0.38% Na citrate + 10-3 mol/L adenosine + 2 × 10-3 mol/L theophylline, in Ca2+/Mg2+-free Hanks' balanced solution).19 To assay DNA content from cultured cells, individual single-cell suspensions were made from E12.5 fetal livers from three GATA-1-deficient embryos and three littermate control embryos. These suspensions were cultured in 10% FCS in DMEM supplemented with 1% recombinant human Tpo tissue culture supernatant.17 The cells were harvested on day 4 of culture. To label megakaryocytes, cells were incubated with a rabbit antimouse platelet antiserum (RAMPS), used at a dilution of 1:250.20 Cells were then incubated with a fluorescein-conjugated goat antirabbit IgGF(ab')2 antibody (Tago International, Biosource International, Camarillo, CA). Last, cells were stained with propidium iodide in hypotonic citrate.21 Using a FACScan flow cytometer (Becton Dickinson, Franklin Lakes, NJ) and two-color flow cytometry, DNA content of all RAMP-positive cells was measured.22 The proportion of cells in each ploidy class was determined by integrating the area under each peak. Comparison of the percentage of 2N cells was performed by the Student's paired t-test.

Semiquantitative reverse-transcriptase polymerase chain reaction analysis of megakaryocyte-associated genes.   Approximately 1 to 5 × 105 fetal liver cells from neoDelta HS and normal littermate fetuses were plated in a methylcellulose mix, which included 1% recombinant human Tpo tissue culture supernatant.9 At day 5 to 6 colony-forming unit-megakaryocytes (CFU-Mk) were picked and placed in DMEM with 10% FCS. The cells were then washed once in phosphate-buffered saline (PBS). RNA was extracted using RNAZOL B (Tel-Test, Friendwood, TX) according to the manufacturer's protocol and cDNA was made using an oligo(dT) primer. Semiquantitative reverse-transcriptase polymerase chain reaction (RT-PCR) was then performed.9 The amount of cDNA in the samples was normalized using primers for hypoxanthine phosphoribosyl transferase (HPRT). Reaction products were separated on 4% nondenaturing polyacrylamide gels. No reaction products were detected using RNA samples from which RT had been omitted (data not shown). Quantitation of fold-differences in mRNA levels was performed by densitometric analysis (Molecular Dynamics, Sunnyvale, CA) of autoradiographs. The sum of the average pixel intensity above background was determined for each of the bands representing different PCR cycle numbers; normalization was performed relative to the bands from the PCR reactions for HPRT. The primer pairs used for HPRT, platelet factor 4 (PF4), and c-mpl have been reported previously.9,23 The following primer pairs were used to amplify: GPIbalpha ---5' CCTGGAAGAAGCTCTGTTCCTCC 3' and 5' CATTGGTCTGCAGGCTCGTC 3'; GPIbbeta ---5'AGGACAGGACGCGGCATTCA 3' and 5' AGGCTTCTGGGAGGAAGGCG 3'; and p45 NF-E2---5' AACTTGCCGGTAGATGACTTTAAT 3' and 5' CAGAGTGCGGTCAGCCTCCCCTCG 3'.

Electron microscopy.   Electron microscopy of platelets was performed according to a modification of the procedure of Stenberg et al.24 Briefly, whole blood, collected by cardiac puncture directly into syringes containing an excess of 1.5% glutaraldehyde in 0.01 mol/L cocadylate buffer, pH 7.4, was fixed overnight at 4°C. The blood was centrifuged at 800g for 15 minutes to isolate platelets, which were dehydrated through an ascending series of alcohols, infiltrated with propylene oxide, and embedded in epoxy resin. Ultrathin sections were stained with uranyl acetate and lead citrate, and examined with a JEOL 100CX-II transmission electron microscope (JEOL, Peabody, MA) at an accelerating voltage of 60 kV.

Western blot of platelets.   Platelets isolated from Delta neoDelta HS and wild-type mice as previously described25 were directly resuspended in 2X protein lysis sample buffer (125 mmol/L Tris pH 6.8, 2% sodium dodecyl sulfate [SDS], 50% glycerol, 5% beta -mercaptoethanol, 0.001% bromophenol blue). The samples were electrophoresed through 10% SDS-polyacrylamide gel electrophoresis (PAGE) and immunoblotted onto nitrocellulose membranes. The membranes were blocked overnight at 4°C or for 2 hours at room temperature in Tris-buffered saline with Tween (TBST; 50 mmol/L Tris, pH 8.0, 150 mmol/L NaCl, 1 mmol/L EDTA, 0.1% Tween-20) supplemented with 5% nonfat milk. Binding of the primary and secondary antibody was performed in TBST. Washes of the membranes after antibody binding were performed for 1 hour with TBST. One filter was sequentially used to detect expression of c-MPL, GPIIb, and c-src, and another to detect GPIb and c-src; we evaluated c-src expression to ensure equivalent sample loading. Commercially available antibodies to GPIIb, GPIb (Pharmingen, San Diego, CA), and c-src (Santa Cruz Biotechnology, Santa Cruz, CA) were used at dilutions of 1:500, 1:500, and 1:1,000. Monoclonal antibodies against c-mpl were a kind gift from Dr Federic de Sauvage and used at a dilution of 1:1,000. The secondary antibody was conjugated with HPRT and the signal detected with a commercial chemiluminescence kit (Amersham, Arlington Heights, IL).

Bleeding time studies.   Four Delta neoDelta HS mice and six wild-type littermate controls at age 6 to 8 weeks were used to measure bleeding times as previously described.26

Platelet lifespan studies and platelet function tests.   Platelets were isolated from four Delta neoDelta HS and four normal animals; detailed methods for the platelet lifespan and platelet activation studies have been published previously.27,28


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Growth dysregulation of GATA-1-deficient megakaryocytes.   To quantitate the growth disturbance of primary GATA-1-deficient megakaryocytes, we compared the growth rates of GATA-1-deficient and normal megakaryocytes in vitro. Fetal liver cells isolated from neoDelta HS mice and wild-type littermates at E12.5 were expanded in liquid culture in the presence of recombinant Tpo and the number of acetylcholinesterase-positive cells was determined every 2 days. The growth curves (Fig 1) show a dramatic proliferative advantage for GATA-1-deficient cells; not only are the maximal numbers of megakaryocytes 15-fold greater, but the GATA-1-deficient megakaryocytes continue in culture for up to 4 weeks, whereas normal megakaryocytes die after 12 to 14 days. These results extend the previous colony data8 by showing the greatly enhanced proliferative response of GATA-1-deficient megakaryocytes in response to Tpo and are in agreement with megakaryocytosis seen in mutant animals.


View larger version (13K):
[in this window]
[in a new window]
 
Fig 1. Proliferation profiles of normal (WT) and neotriangle HS (MUT) primary megakaryocytes expanded from fetal liver cells in liquid culture in recombinant Tpo. The number of cells with acetylcholinesterase (AchE) activity in 50-µL aliquots of the culture is shown as a function of the duration of culture. The values shown are the mean ± 1 SD from separate cultures of 15 normal and 15 mutant fetal livers.

Nuclear and cytoplasmic arrest of GATA-1-deficient megakaryocytes.   Associated with this hyperproliferation, GATA-1-deficient megakaryoctyes, as a population, show evidence of arrested nuclear and cytoplasmic development. DNA content analysis of eight Delta neoDelta HS and six normal animals shows that the percentage of bone marrow megakaryocytes with 2N DNA content in the mutants is 32% compared with 15% in normal animals (P < .001; Fig 2A). In addition, there is a reduction in the proportion of mutant megakaryocytes with 8N and 16N DNA content compared with controls. Nonetheless, a subpopulation of mutant megakaryocytes achieves a higher ploidy and the modal ploidy of these megakaryocytes is 32N, compared with 16N in wild-type megakaryocytes. Mirroring these findings, the proportion of cells with low DNA content is increased in cultured GATA-1-deficient megakaryocytes compared with controls (Fig 2B); controls also show a higher fraction of megakaryocytes with DNA content >= 8N.



View larger version (41K):
[in this window]
[in a new window]
 
Fig 2. Histograms of the DNA content of (A) bone marrow megakaryocytes from 6 normal (Wild Type, top) and 8 triangle neotriangle HS (Mutant, bottom) weanling mice (age 4 weeks), and (B) megakaryocytes cultured ex vivo from E12.5 fetal livers of 3 normal (Wild Type, top) and 3 triangle neotriangle HS (Mutant, bottom) embryos. The mean percentage (± 1 SD) of RAMPS-positive cells in each ploidy class

Retardation of cytoplasmic maturation is indicated by semiquantitative RT-PCR analysis of megakaryocyte-specific transcripts. In these experiments, we used mutant and wild-type megakaryocytes of comparable morphology and size (colonies derived from CFU-Mk) as the source of mRNA. This was done to minimize differential patterns of gene expression being recorded solely because of differences in maturation state, rather than as a specific consequence of lack of GATA-1. GATA-1-deficient megakaryocytes showed significantly decreased mRNA expression of GPIbalpha (7.4-fold) and GPIbbeta (3.6-fold), PF4 (3.4-fold) c-mpl (3.8-fold), and p45 NF-E2 (35-fold). Indeed, all of the markers studied showed decreased expression, albeit at different levels (Fig 3).


View larger version (52K):
[in this window]
[in a new window]
 
Fig 3. Semiquantitative RT-PCR analysis of GPIbalpha , GPIbbeta , PF4, c-mpl, and p45 NF-E2 mRNA transcripts from primary megakaryocytes derived from normal (WT) and neotriangle HS (MUT) CFU-Mk. PCR reactions were performed with tracer alpha [32P]dCTP for the indicated number of cycles before analysis by PAGE. HPRT signal was used to normalize the input cDNA.

Platelet phenotype of GATA-1-deficient mice.   Despite the marked megakaryocyte abnormalities outlined above, some platelets (~15% of normal) are produced in neoDelta HS and Delta neoDelta HS mice. In the following studies, we examined the ultrastructure of these platelets and sought to determine their competence in hemostasis.

Morphology of GATA-1-deficient platelets.   Electron microscopy of platelets isolated from the peripheral blood of Delta neoDelta HS mice shows a number of gross morphologic abnormalities (Fig 4). In addition to their larger volume, mutant platelets are uniformly spherical in shape, in contrast to the discoid shape of normal platelets. Rough endoplasmic reticulum and ribosomes are excessive. Most of the GATA-1-deficient platelets contain few platelet-specific granules or lack them entirely. There is marked heterogeneity in distribution of organelles, with some platelets harboring few organelles, while others are replete. Finally, many platelets have an increased internal canalicular membrane system. These findings are reminiscent of the ultrastructural abnormalities seen in the defective megakaryocytes from which these platelets are derived8 and indicate abnormal compartmentalization of organelles within GATA-1-deficient megakaryocytes before platelet release.


View larger version (93K):
[in this window]
[in a new window]
 
Fig 4. Representative electron micrographs of platelets produced by megakaryocytes deficient in GATA-1. Normal mouse platelets (A) have a uniform appearance and show the typical discoid shape with a normal complement of organelles, including platelet-specific granules. In contrast, GATA-1-deficient platelets (B and C) are large, invariably round, heterogeneous, and show a paucity of organelles, especially platelet-specific granules. In particular, these platelets have an excess of rough endoplasmic reticulum (C), similar to the megakaryocytes from which they are derived. Bars in (A) and (B) are 5 µm; in (C), 1 µm.

In surprising contrast to the mRNA expression data from GATA-1-deficient megakaryocytes, mutant platelets exhibit greater evidence of cytoplasmic maturity. This is evidenced by normal protein expression levels of GPIb, GpIIb, and c-mpl in GATA-1-deficient platelets compared with normal controls (Fig 5). This apparent discrepancy between the maturation state of GATA-1-deficient megakaryocytes and platelets leads us to speculate that the platelets may be produced by a small subset of megakaryocytes that achieves the greatest degree of maturity in the bulk population of GATA-1-deficient megakaryocytes, presumably from among those cells with a higher DNA content.


View larger version (33K):
[in this window]
[in a new window]
 
Fig 5. Western blot analysis of c-mpl, GPIIb,and GPIb expression in platelets isolated from normal (WT) and triangle neotriangle HS (MUT) adult mice. In the left panel, the same filter was sequentially used to assay expression for c-mpl, GPIIb,and c-src, whereas in the right panel a separate filter was sequentially used to detect expression of GPIb and c-src. The c-src signal was used to verify equivalent sample loading.

The high ribosome and RNA content of GATA-1-deficient platelets is suggestive of young platelet age.29 Taken together with the thrombocytopenia, this raises the possibility that the abnormal GATA-1-deficient platelets have an increased susceptibility to destruction. To address this, we studied platelet lifespan in four Delta neoDelta HS and four normal animals. No difference in platelet survival was observed between wild-type and mutant platelets (Table 1), indicating that thrombocytopenia is due to a failure of platelet production.

                              
View this table:
[in this window]
[in a new window]
 
Table 1. Lifespan and Activation of GATA-1-Deficient and Wild-Type Platelets

Function of GATA-1-deficient platelets.   NeoDelta HS and Delta neoDelta HS mice do not exhibit a bleeding diathesis in the environment of a controlled animal care facility. However, when subject to trauma (tail biopsy), mutant mice frequently bleed excessively compared with wild-type littermates. To evaluate the function of GATA-1-deficient platelets, we measured bleeding times in four Delta neoDelta HS and six normal animals. As shown in Fig 6, bleeding times are substantially prolonged in the mutant mice. It is helpful to compare these data with published results from Tpo-null mice, which have an equivalent degree of thrombocytopenia with functionally normal platelets and are reported to have an average bleeding time of 3 minutes.30 Thus, the excessively prolonged bleeding time of Delta neoDelta HS mice points to a functional platelet defect superimposed on thrombocytopenia.


View larger version (19K):
[in this window]
[in a new window]
 
Fig 6. Bleeding times obtained from 6 normal (WT) and 4 triangle neotriangle HS (MUT) adult mice. *Bleeding times >1,200 seconds.

We performed platelet activation studies on four Delta neoDelta HS mice and four normal control mice by measuring the appearance of P-selectin on the platelet cell surface in response to a variety of platelet agonists. This analysis showed a modest selective defect in activation of mutant platelets by either thrombin or a combination of adenosine diphosphate (ADP) and epinephrine, whereas activation by ADP alone was comparable to normal (Table 1).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The findings presented here indicate that megakaryocytes deficient in GATA-1 hyperproliferate, have a modal ploidy of 2N, express significantly lower levels of several megakaryocyte-specific genes, and produce large, structurally abnormal platelets. Connected with these abnormalities, platelet function is compromised in vivo and in vitro.

The combination of the colony and liquid culture data provide useful insights into the biology of the megakaryocytosis seen in neoDelta HS and Delta neoDelta HS mice. In liquid culture there is a 15-fold increase in the maximal number of mutant megakaryocytes and these cells persist or are produced for more than twice as long. However, megakaryocytosis is not driven by an increased number of CFU-Mk progenitors, the frequency of which is similar in wild-type and mutant mice.8 We interpret the striking differences between wild-type and mutant cultures to reflect hyperproliferation of the progeny of a subset of mutant progenitors (Fig 7), which presumably give rise to the large abnormal colonies consisting of thousands of cells. There are two mutually nonexclusive possibilities for the different proliferative response in mutant and wild-type megakaryocyte progenitors. First, in the absence of GATA-1, there may be selective, abnormal expansion of an otherwise rare pool of normal progenitors with high proliferative capacity that is distinct from the pool of normal CFU-Mk. Alternatively, the large colonies could arise from abnormal CFU-Mk progenitors that are present only in mutant animals; however, mutant animals must also have normal CFU-Mk progenitors, as normal-sized megakaryocyte colonies can be cultured from their hematopoietic cells. Interestingly, May-Grünwald-Giemsa staining of the abnormally large colonies shows cells not only with megakaryocytic morphology, but also some that are blast-like8 and others that resemble proerythroblasts (data not shown). Moreover, the progeny of these abnormally large colonies have a low but definite secondary replating potential, producing mainly erythroid colonies arrested at the proerythroblast stage (data not shown). Taken together, these results suggest that the hyperproliferating cell is not a normal CFU-Mk, but rather represents an earlier progenitor, perhaps one with bilineage erythromegakaryocytic potential. Similar colonies are almost never seen in cultures of normal fetal livers in Tpo.


View larger version (17K):
[in this window]
[in a new window]
 
Fig 7. A hierarchy of transcription factors important in megakaryopoiesis. The normal progression of a multipotential progenitor to a platelet-producing megakaryocyte (MK) is shown. The upper set of arrows denotes the normal pattern of progression from one cell type to another, and the lower set of arrows illustrates the findings in a GATA-1-deficient environment. The thickness of the arrows represents the degree to which the progression from 1 cell type to another occurs. In GATA-1 deficiency, there is a marked increase of immature megakaryocytes relative to the wild type. Most normal immature megakaryocytes complete differentiation, whereas in GATA-1 deficiency, many immature megakaryocytes fail to complete the differentiation program, and the few that do are abnormal structurally. This results in a lower number of circulating platelets that are functionally and structurally abnormal. In the absence of FOG, either the megakaryocyte progenitor is not specified or fails to differentiate. Conversely, the requirement for NF-E2 is apparently limited to terminal megakaryocyte differentiation before platelet release.

It is interesting that GATA-1 impinges upon growth control in both the megakaryocytic and erythroid lineages. In erythroid cells, absence of GATA-1 leads to maturation arrest and premature apoptosis at the proerythroblast stage in vitro.23,31 The clear hyperproliferative response seen in megakaryocytes deficient in GATA-1 both in vitro and in vivo suggests that further analysis of the mechanisms by which GATA-1 influences cell growth and apoptosis in blood cells is likely to be rewarding.

GATA-1-deficient megakaryocytes exhibit evidence of retarded nuclear development, reflected by the modal ploidy of 2N, compared with 16N in wild-type controls. However, a population of mutant megakaryocytes does undergo endoreduplication and achieves higher DNA content. It is unclear whether this suggests that GATA-1 is not required for the initiation of endomitosis or that most megakaryocytes do require GATA-1 for endoreduplication, but that a subset of megakaryocytes can become polyploid through GATA-1-independent mechanisms. Regardless of the putative mechanism, we speculate that the minority of the megakaryocytes with higher DNA content produce platelets.

The promoters of many megakaryocyte-expressed genes have been demonstrated to harbor functional GATA-1-binding sites, eg, in GPIbalpha and GPIbbeta , GPIIb, c-mpl, PF4, and GPIX promoters.5,32-36 This consistent finding may be interpreted to suggest that GATA-1 regulates an entire program of megakaryocyte gene expression and differentiation, much as has been suggested in the related erythroid lineage.37,38 Indeed, GATA-1-deficient megakaryocytes show decreased expression of mRNAs encoding all cell surface, cytoplasmic, and nuclear megakaryocyte-specific genes tested, including GPIbalpha and GPIbbeta , c-mpl, p45 NF-E2, and PF4 (Fig 3) and GPIIb and GPIX (data not shown). There are two caveats to the interpretation of these results. First, differential expression of these mRNAs does not necessarily mean that they are all direct transcriptional targets of GATA-1. Rather, differential expression may simply reflect immaturity of GATA-1-deficient megakaryocytes if levels of these mRNAs normally increase late in megakaryocyte maturation by GATA-1-independent means. We specifically attempted to avoid this bias by conducting expression studies on normal-size megakaryocyte colonies derived from cultured wild-type and mutant CFU-Mk. Second, it remains formally possible that the differences in mRNA profile observed in cultured megakaryocytes may not be reflected in vivo. However, GPIbbeta is a good candidate for a true GATA-1 target gene. A patient with Bernard-Soulier syndrome (absence of GPIbbeta expression) has been described with a deletion of the structural GPIbbeta gene on one chromosome and a point mutation in a functional GATA-binding site in the GPIbbeta promoter as the sole defect on the other, implying a critical role for GATA-1 in GPIbbeta expression in vivo.39

Even though some platelets are produced in neoDelta HS and Delta neoDelta HS mice, they are abnormal in several respects. Morphologically, they are bigger, spherical, show an excess of rough endoplasmic reticulum and ribosomes, have few electron dense and alpha  granules, and often have an excess of internal canalicular membranes. Ultrastructurally, the platelets are similar to the megakaryocytes from which they are released. These observations suggest that GATA-1 deficiency leads not only to defective organelle and granule formation, but also to abnormal compartmentalization of these structures in megakaryocytes, which is reflected in the platelets that are released. We further speculate that platelet release from GATA-1-deficient megakaryocytes is abnormal, as proplatelet formation in liquid culture is infrequent,40 and the rare proplatelets produced by GATA-1-deficient megakaryocytes tend to be short buds, rather than the typical long filamentous structures that emanate from normal megakaryocytes.

Functionally, GATA-1-deficient platelets are also abnormal. Bleeding times in mutant animals are greatly prolonged, beyond that expected for the degree of thrombocytopenia. Platelet activation in vitro is modestly affected in response to either thrombin or a combination of ADP and epinephrine, but not to ADP alone. The latter findings suggest specific defects in the adrenergic and thrombin-induced pathways of platelet activation.

From the observations presented in this report, we present a model for the function of GATA-1 in megakaryocytes and platelets (Fig 7). In the absence of GATA-1, the majority of megakaryocytes are small and immature. These arise from hyperproliferation of megakaryocytes, probably from a small subset of progenitors, and many cells have 2N DNA content. Moreover, mature mutant megakaryocytes derived from CFU-Mk express lower levels of a number of megakaryocyte-associated mRNA transcripts. Nevertheless, a minority of megakaryocytes does undergo endoreduplication to have a ploidy profile that is comparable to normal and some of the mutant megakaryocytes are able to release platelets. Although these platelets display functional and structural abnormalities, they do express some platelet-associated proteins at apparently normal levels. We conclude that GATA-1 is required for the normal homeostasis of megakaryocyte numbers and nuclear and cytoplasmic maturation and platelet release.

It is unclear why some megakaryocytes are able to mature partially, albeit abnormally. This could occur if the mutations we have generated in mice (neoDelta HS and Delta neoDelta HS) are leaky with respect to GATA-1 expression in megakaryocytes, ie, a small proportion of cells is able to express GATA-1 to allow fuller differentiation. This is unlikely because we were unable to detect GATA-1 expression in megakaryocytes from neoDelta HS mice by either immunofluorescence or RT-PCR.8 Moreover, although megakaryocytes from Delta neoDelta HS mice show a low level of GATA-1 mRNA expression (1% to 5% by RT-PCR analysis8), the megakaryocyte and platelet phenotype is identical in the two mutant strains.8 We hence favor the possibility that the partial maturation of megakaryocytes seen in neoDelta HS and Delta neoDelta HS mice occurs by GATA-1-independent means.

The GATA-1-deficient megakaryocyte phenotype contrasts markedly with the two other transcription factor knockouts that affect the megakaryocytic lineage. FOG was isolated as a protein that interacts physically with GATA-1 and enhances its capacity to drive megakaryocytic differentiation in the 416B myeloid cell line.10 Thus, it was surprising that FOG-null fetuses do not produce any megakaryocytic colonies, a defect in megakaryopoiesis that is distinct from neoDelta HS and Delta neoDelta HS mice.11 We have speculated that FOG has a GATA-1-independent function early in megakaryopoiesis, as well as a GATA-1-dependent role later in megakaryocyte maturation. NF-E2 is vital for terminal megakaryocyte maturation and platelet release.9 However, the megakaryocyte and platelet phenotypes between NF-E2-null and neoDelta HS and Delta neoDelta HS mice are also clearly distinguishable. As expression of p45 NF-E2 is significantly reduced in colonies derived from GATA-1-deficient CFU-Mk, it could be that part of the failure of these megakaryocytes to undergo proper terminal differentiation is related to this observation. It is likely that these three transcription factors regulate mutually exclusive sets of target genes, although some genes may be controlled in a complex manner requiring two or all three of these proteins.


    ACKNOWLEDGMENT

We are grateful to Jerry Ware for providing unpublished sequence data to design GPIbalpha oligonucleotide primers for RT-PCR analysis, and to Yuhui Xu and Paula Stenberg for assistance with electron microscopy.


    FOOTNOTES

Submitted October 3, 1998; accepted December 16, 1998.

Supported in part by fellowships and grants from the Wellcome Trust, National Institutes of Health, and the Howard Hughes Medical Institute.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

Address reprint requests to Paresh Vyas, MD, PhD, Children's Hospital Medical Center, 300 Longwood Ave, Boston, MA 02115; e-mail: vyas{at}rascal.med.harvard.edu.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Orkin SH: Transcription factors and hematopoietic development. J Biol Chem 270:4955, 1995[Free Full Text]

2. Shivdasani RA, Orkin SH: The transcriptional control of hematopoiesis. Blood 87:4025, 1996[Free Full Text]

3. Mouthon M-A, Bernard O, Mitjavila M-T, Romeo P-H, Vainchenker W, Mathieu-Mahul D: Expression of tal-1 and GATA-binding proteins during human hematopoiesis. Blood 81:647, 1993[Abstract/Free Full Text]

4. Elwood MJ, Zogos H, Pereira DS, Dick JE, Begley CG: Enhanced megakaryocyte and erythroid development from normal human CD34+ cells: Consequences of enforced expression of SCL. Blood 91:3756, 1998[Abstract/Free Full Text]

5. Lemarchandel V, Ghysdael J, Mignotte V, Rahuel C, Romeo P-H: GATA and Ets cis-acting sequences mediate megakaryocyte-specific expression. Mol Cell Biol 13:668, 1993[Abstract/Free Full Text]

6. Uzan G, Prenant M, Prandini M-H, Martin F, Marguerie G: Tissue-specific expression of the platelet GPIIb gene. J Biol Chem 266:8932, 1991[Abstract/Free Full Text]

7. Block KL, Ravid K, Phung QH, Poncz M: Characterization of regulatory elements in the 5'-flanking region of the rat GPIIb gene by studies in a primary rat marrow culture system. Blood 84:3385, 1994[Abstract/Free Full Text]

8. Shivdasani RA, Fujiwara Y, McDevitt MA, Orkin SH: A lineage-selective knockout establishes the critical role of transcription factor GATA-1 in megakaryocyte growth and platelet development. EMBO J 16:3965, 1997[Medline] [Order article via Infotrieve]

9. Shivdasani RA, Rosenblatt MF, Zucker-Franklin D, Jackson CW, Hunt P, Saris C, Orkin SH: Transcription factor NF-E2 is required for platelet formation independent of the actions of thrombopoietin/MGDF in megakaryocyte development. Cell 81:695, 1995[Medline] [Order article via Infotrieve]

10. Tsang AP, Visvader JE, Turner CA, Fujiwara Y, Yu C, Weiss MJ, Crossley M, Orkin SH: FOG, a multitype zinc finger protein, acts as a cofactor for transcription factor GATA-1 in erythroid and megakaryocytic differentiation. Cell 90:109, 1997[Medline] [Order article via Infotrieve]

11. Tsang AP, Fujiwara Y, Hom DB, Orkin SH: Failure of megakaryopoiesis and arrested erythropoiesis in mice lacking the GATA-1 transcriptional cofactor FOG. Genes Dev 12:1176, 1998[Abstract/Free Full Text]

12. Visvader JE, Elefanty AG, Strasser A, Adams JM: GATA-1 but not SCL induces megakaryocytic differentiation in an early myeloid line. EMBO J 11:4557, 1992[Medline] [Order article via Infotrieve]

13. Visvader J, Adams JM: Megakaryocytic differentiation induced in 416B myeloid cells by GATA-2 and GATA-3 transgenes or 5-azacytidine is tightly coupled to GATA-1 expression. Blood 82:1493, 1993[Abstract/Free Full Text]

14. Kulessa H, Frampton J, Graf T: GATA-1 reprograms avian myelomonocytic cell lines into eosinophils, thromboblasts, and erythroblasts. Genes Dev 9:1250, 1995[Abstract/Free Full Text]

15. Pevny L, Lin C-S, D'Agati V, Simon MC, Orkin SH, Costantini F: Development of hematopoietic cells lacking transcription factor GATA-1. Development 121:163, 1995[Abstract]

16. Takahashi S, Komeno T, Suwabe N, Yoh K, Nakajima O, Nishimura S, Kuroha T, Yamamoto M: Role of GATA-1 in proliferation and differentiation of definitive erythroid and megakaryocytic cells in vivo. Blood 92:434, 1998[Abstract/Free Full Text]

17. Villeval J-L, Cohen-Solal K, Tulliez M, Giraudier S, Guichard J, Burstein SA, Cramer EM, Vainchenker W, Wendling F: High thrombopoietin production by hemopoietic cells induces a fatal myeloproliferative syndrome in mice. Blood 90:4369, 1997[Abstract/Free Full Text]

18. Jackson CW: Cholinesterase as a possible marker for early cells of the megakaryocytic series. Blood 42:413, 1973[Abstract/Free Full Text]

19. Levine RF, Fedorko ME: Isolation of intact megakaryocytes from guinea pig femoral marrow. Successful harvest made possible with inhibitors of platelet aggregation; enrichment achieved with a two-step separation technique. J Cell Biol 69:159, 1976[Abstract/Free Full Text]

20. McDonald T, Jackson CW: Thrombopoietin derived from human embryonic kidney cells stimulates an increase in DNA content of murine megakaryocytes in vivo. Exp Hematol 18:758, 1990[Medline] [Order article via Infotrieve]

21. Krishan A: Rapid flow cytofluorometric analysis of mammalian cell cycle by propidium iodide staining. J Cell Biol 66:188, 1975[Abstract/Free Full Text]

22. Jackson CW, Brown KL, Somerville BC, Lyles SA, Look AT: Two-color flow cytometric measurement of DNA distributions of rat megakaryocytes in unfixed unfractionated marrow cell suspensions. Blood 63:768, 1984[Abstract/Free Full Text]

23. Weiss MJ, Keller G, Orkin SH: Novel insights into erythroid development revealed through in vitro differentiation of GATA-1-embryonic stem cells. Genes Dev 8:1184, 1994[Abstract/Free Full Text]

24. Stenberg PE, Barrie RJ, Pestina TI, Steward SA, Arnold JT, Murti AK, Hutson NK, Jackson CW: Prolonged bleeding time with defective platelet filopodia formation in the Wistar Furth rat. Blood 91:1599, 1998[Abstract/Free Full Text]

25. Shivdasani RA, Fielder P, Keller G-A, Orkin SH, de Sauvage FJ: Regulation of the serum concentration of thrombopoietin in thrombocytopenic NF-E2 knockout mice. Blood 90:1821, 1997[Abstract/Free Full Text]

26. Dejana E, Villa S, de Gaetano G: Bleeding time in rats: A comparison of different experimental conditions. Thromb Haemost 48:108, 1982[Medline] [Order article via Infotrieve]

27. Ault KA, Knowles C: In vivo biotinylation demonstrates that reticulated platelets are the youngest platelets in the circulation. Exp Hematol 23:996, 1995[Medline] [Order article via Infotrieve]

28. Ault KA, Knowles C, Mitchell J, Brown CL, Schulz KL, Beamer WG: Genetic control of platelet activation in inbred mouse strains. Platelets 8:235, 1997

29. Bessman JD, Gilmer PR, Gardner FH: Use of mean platelet volume improves detection of platelet disorders. Blood Cells 11:127, 1985[Medline] [Order article via Infotrieve]

30. Bunting S, Widmer R, Lipari T, Rangell L, Steinmetz H, Carver-Moore K, Moore MW, Keller G-A, de Sauvage FJ: Normal platelets and megakaryocytes are produced in vivo in the absence of thrombopoietin. Blood 90:3423, 1997[Abstract/Free Full Text]

31. Weiss MJ, Orkin SH: Transcription factor GATA-1 permits survival and maturation of erythroid precursors by preventing apoptosis. Proc Natl Acad Sci USA 92:9623, 1995[Abstract/Free Full Text]

32. Hashimoto Y, Ware J: Identification of essential GATA and Ets binding motifs within the promoter of the platelet glycoprotein Iba gene. J Biol Chem 270:24532, 1995[Abstract/Free Full Text]

33. Yagi M, Edelhoff S, Disteche CM, Roth GJ: Structural characterization and chromosomal location of the gene encoding human platelet glycoprotein Ib beta. J Biol Chem 269:17424, 1994[Abstract/Free Full Text]

34. Deveaux S, Filipe A, Lemarchandel V, Ghysdael J, Romeo P-H, Mignotte V: Analysis of the thrombopoietin receptor (MPL) promoter implicates GATA and Ets proteins in the coregulation of megakaryocyte-specific genes. Blood 87:4678, 1996[Abstract/Free Full Text]

35. Ravid K, Doi T, Beeler DL, Kuter DJ, Rosenberg RD: Transcriptional regulation of the rat platelet factor 4 gene: Interaction between an enhancer/silencer domain and the GATA site. Mol Cell Biol 11:6116, 1991[Abstract/Free Full Text]

36. Hickey MJ, Roth GJ: Characterization of the gene encoding human platelet glycoprotein IX. J Biol Chem 268:3438, 1993[Abstract/Free Full Text]

37. Seshasayee D, Gaines P, Wojchowski DM: GATA-1 dominantly activates a program of erythroid gene expression in factor-dependent myeloid FDCW2 cells. Mol Cell Biol 18:3278, 1998[Abstract/Free Full Text]

38. Orkin SH: GATA-binding transcription factors in hematopoietic cells. Blood 80:575, 1992[Free Full Text]

39. Ludlow LB, Schick BP, Budarf ML, Driscoll DA, Zackai EH, Cohen A, Konkle BA: Identification of a mutation in a GATA binding site of the platelet glycoprotein Ibb promoter resulting in the Bernard-Soulier syndrome. J Biol Chem 271:22076, 1996[Abstract/Free Full Text]

40. Lecine P, Villeval J-L, Vyas P, Swencki B, Xu Y, Shivdasani RA: Mice lacking transcription factor NF-E2 provide in vivo validation of the proplatelet model of thrombocytopenia and show a platelet production defect that is intrinsic to megakaryocytes. Blood 92:1608, 1998[Abstract/Free Full Text]


© 1999 by The American Society of Hematology.
 
0006-4971/99/9309-0025$3.00/0

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
H. Huang, M. Yu, T. E. Akie, T. B. Moran, A. J. Woo, N. Tu, Z. Waldon, Y. Y. Lin, H. Steen, and A. B. Cantor
Differentiation-Dependent Interactions between RUNX-1 and FLI-1 during Megakaryocyte Development
Mol. Cell. Biol., August 1, 2009; 29(15): 4103 - 4115.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. J. Stankiewicz and J. D. Crispino
ETS2 and ERG promote megakaryopoiesis and synergize with alterations in GATA-1 to immortalize hematopoietic progenitor cells
Blood, April 2, 2009; 113(14): 3337 - 3347.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Bedi, J. Du, A. K. Sharma, I. Gomes, and S. J. Ackerman
Human C/EBP-{epsilon} activator and repressor isoforms differentially reprogram myeloid lineage commitment and differentiation
Blood, January 8, 2009; 113(2): 317 - 327.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. E. Elagib, I. S. Mihaylov, L. L. Delehanty, G. C. Bullock, K. D. Ouma, J. F. Caronia, S. L. Gonias, and A. N. Goldfarb
Cross-talk of GATA-1 and P-TEFb in megakaryocyte differentiation
Blood, December 15, 2008; 112(13): 4884 - 4894.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. P. Rodrigues, A. S. Boyd, C. Fugazza, G. E. May, Y. Guo, A. J. Tipping, D. T. Scadden, P. Vyas, and T. Enver
GATA-2 regulates granulocyte-macrophage progenitor cell function
Blood, December 15, 2008; 112(13): 4862 - 4873.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
I. Hamlett, J. Draper, J. Strouboulis, F. Iborra, C. Porcher, and P. Vyas
Characterization of megakaryocyte GATA1-interacting proteins: the corepressor ETO2 and GATA1 interact to regulate terminal megakaryocyte maturation
Blood, October 1, 2008; 112(7): 2738 - 2749.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
S. G. Olthof, S. Fatrai, A. L. Drayer, M. R. Tyl, E. Vellenga, and J. J. Schuringa
Downregulation of Signal Transducer and Activator of Transcription 5 (STAT5) in CD34+ Cells Promotes Megakaryocytic Development, Whereas Activation of STAT5 Drives Erythropoiesis
Stem Cells, July 1, 2008; 26(7): 1732 - 1742.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
J. Lorenzo, M. Horowitz, and Y. Choi
Osteoimmunology: Interactions of the Bone and Immune System
Endocr. Rev., June 1, 2008; 29(4): 403 - 440.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. J. Woo, T. B. Moran, Y. L. Schindler, S.-K. Choe, N. B. Langer, M. R. Sullivan, Y. Fujiwara, B. H. Paw, and A. B. Cantor
Identification of ZBP-89 as a Novel GATA-1-Associated Transcription Factor Involved in Megakaryocytic and Erythroid Development
Mol. Cell. Biol., April 15, 2008; 28(8): 2675 - 2689.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Gutierrez, S. Tsukamoto, M. Suzuki, H. Yamamoto-Mukai, M. Yamamoto, S. Philipsen, and K. Ohneda
Ablation of Gata1 in adult mice results in aplastic crisis, revealing its essential role in steady-state and stress erythropoiesis
Blood, April 15, 2008; 111(8): 4375 - 4385.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
P. G. Fuhrken, C. Chen, P. A. Apostolidis, M. Wang, W. M. Miller, and E. T. Papoutsakis
Gene Ontology-driven transcriptional analysis of CD34+ cell-initiated megakaryocytic cultures identifies new transcriptional regulators of megakaryopoiesis
Physiol Genomics, April 1, 2008; 33(2): 159 - 169.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. B. Cantor, H. Iwasaki, Y. Arinobu, T. B. Moran, H. Shigematsu, M. R. Sullivan, K. Akashi, and S. H. Orkin
Antagonism of FOG-1 and GATA factors in fate choice for the mast cell lineage
J. Exp. Med., March 17, 2008; 205(3): 611 - 624.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Freson, K. Peeters, R. De Vos, C. Wittevrongel, C. Thys, M. F. Hoylaerts, J. Vermylen, and C. Van Geet
PACAP and its receptor VPAC1 regulate megakaryocyte maturation: therapeutic implications
Blood, February 15, 2008; 111(4): 1885 - 1893.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
L. J. Suva, E. Hartman, J. D. Dilley, S. Russell, N. S. Akel, R. A. Skinner, W. R. Hogue, U. Budde, K. I. Varughese, T. Kanaji, et al.
Platelet Dysfunction and a High Bone Mass Phenotype in a Murine Model of Platelet-Type von Willebrand Disease
Am. J. Pathol., February 1, 2008; 172(2): 430 - 439.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
O. Tanabe, Y. Shen, Q. Liu, A. D. Campbell, T. Kuroha, M. Yamamoto, and J. D. Engel
The TR2 and TR4 orphan nuclear receptors repress Gata1 transcription
Genes & Dev., November 1, 2007; 21(21): 2832 - 2844.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
R. Garimella, M. A. Kacena, S. E. Tague, J. Wang, M. C. Horowitz, and H. C. Anderson
Expression of Bone Morphogenetic Proteins and Their Receptors in the Bone Marrow Megakaryocytes of GATA-1low Mice: A Possible Role in Osteosclerosis
J. Histochem. Cytochem., July 1, 2007; 55(7): 745 - 752.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. G. Muntean, L. Pang, M. Poncz, S. F. Dowdy, G. A. Blobel, and J. D. Crispino
Cyclin D-Cdk4 is regulated by GATA-1 and required for megakaryocyte growth and polyploidization
Blood, June 15, 2007; 109(12): 5199 - 5207.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Raslova, A. Kauffmann, D. Sekkai, H. Ripoche, F. Larbret, T. Robert, D. T. Le Roux, G. Kroemer, N. Debili, P. Dessen, et al.
Interrelation between polyploidization and megakaryocyte differentiation: a gene profiling approach
Blood, April 15, 2007; 109(8): 3225 - 3234.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Z. Chen, M. Hu, and R. A. Shivdasani
Expression analysis of primary mouse megakaryocyte differentiation and its application in identifying stage-specific molecular markers and a novel transcriptional target of NF-E2
Blood, February 15, 2007; 109(4): 1451 - 1459.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Pang, H.-H. Xue, G. Szalai, X. Wang, Y. Wang, D. K. Watson, W. J. Leonard, G. A. Blobel, and M. Poncz
Maturation stage-specific regulation of megakaryopoiesis by pointed-domain Ets proteins
Blood, October 1, 2006; 108(7): 2198 - 2206.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. P. McCormack, M. A. Hall, S. M. Schoenwaelder, Q. Zhao, S. Ellis, J. A. Prentice, A. J. Clarke, N. J. Slater, J. M. Salmon, S. P. Jackson, et al.
A critical role for the transcription factor Scl in platelet production during stress thrombopoiesis
Blood, October 1, 2006; 108(7): 2248 - 2256.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
I. J. Majewski, D. Metcalf, L. A. Mielke, D. L. Krebs, S. Ellis, M. R. Carpinelli, S. Mifsud, L. Di Rago, J. Corbin, N. A. Nicola, et al.
A mutation in the translation initiation codon of Gata-1 disrupts megakaryocyte maturation and causes thrombocytopenia
PNAS, September 19, 2006; 103(38): 14146 - 14151.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
O. Wagner-Ballon, H. Chagraoui, E. Prina, M. Tulliez, G. Milon, H. Raslova, J.-L. Villeval, W. Vainchenker, and S. Giraudier
Monocyte/Macrophage Dysfunctions Do Not Impair the Promotion of Myelofibrosis by High Levels of Thrombopoietin.
J. Immunol., June 1, 2006; 176(11): 6425 - 6433.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Guyot, K. Murai, Y. Fujiwara, V. Valverde-Garduno, M. Hammett, S. Wells, N. Dear, S. H. Orkin, C. Porcher, and P. Vyas
Characterization of a Megakaryocyte-specific Enhancer of the Key Hemopoietic Transcription Factor GATA1
J. Biol. Chem., May 12, 2006; 281(19): 13733 - 13742.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
P. Garcia and J. Frampton
The transcription factor B-Myb is essential for S-phase progression and genomic stability in diploid and polyploid megakaryocytes
J. Cell Sci., April 15, 2006; 119(8): 1483 - 1493.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. L. Stachura, S. T. Chou, and M. J. Weiss
Early block to erythromegakaryocytic development conferred by loss of transcription factor GATA-1
Blood, January 1, 2006; 107(1): 87 - 97.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Martelli, B. Ghinassi, B. Panetta, E. Alfani, V. Gatta, A. Pancrazzi, C. Bogani, A. M. Vannucchi, F. Paoletti, G. Migliaccio, et al.
Variegation of the phenotype induced by the Gata1low mutation in mice of different genetic backgrounds
Blood, December 15, 2005; 106(13): 4102 - 4113.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
A. Tefferi
Pathogenesis of Myelofibrosis With Myeloid Metaplasia
J. Clin. Oncol., November 20, 2005; 23(33): 8520 - 8530.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. Kuhl, A. Atzberger, F. Iborra, B. Nieswandt, C. Porcher, and P. Vyas
GATA1-Mediated Megakaryocyte Differentiation and Growth Control Can Be Uncoupled and Mapped to Different Domains in GATA1
Mol. Cell. Biol., October 1, 2005; 25(19): 8592 - 8606.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. G. Muntean and J. D. Crispino
Differential requirements for the activation domain and FOG-interaction surface of GATA-1 in megakaryocyte gene expression and development
Blood, August 15, 2005; 106(4): 1223 - 1231.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. P. Rodrigues, V. Janzen, R. Forkert, D. M. Dombkowski, A. S. Boyd, S. H. Orkin, T. Enver, P. Vyas, and D. T. Scadden
Haploinsufficiency of GATA-2 perturbs adult hematopoietic stem-cell homeostasis
Blood, July 15, 2005; 106(2): 477 - 484.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
C. Nishiyama, T. Ito, M. Nishiyama, S. Masaki, K. Maeda, N. Nakano, W. Ng, K. Fukuyama, M. Yamamoto, K. Okumura, et al.
GATA-1 is required for expression of Fc{varepsilon}RI on mast cells: analysis of mast cells derived from GATA-1 knockdown mouse bone marrow
Int. Immunol., July 1, 2005; 17(7): 847 - 856.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. C. Hughan, Y. Senis, D. Best, A. Thomas, J. Frampton, P. Vyas, and S. P. Watson
Selective impairment of platelet activation to collagen in the absence of GATA1
Blood, June 1, 2005; 105(11): 4369 - 4376.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. M. Vannucchi, L. Bianchi, F. Paoletti, A. Pancrazzi, E. Torre, M. Nishikawa, M. Zingariello, A. Di Baldassarre, R. A. Rana, R. Lorenzini, et al.
A pathobiologic pathway linking thrombopoietin, GATA-1, and TGF-{beta}1 in the development of myelofibrosis
Blood, May 1, 2005; 105(9): 3493 - 3501.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Toki, F. Katsuoka, R. Kanezaki, G. Xu, H. Kurotaki, J. Sun, T. Kamio, S. Watanabe, S. Tandai, K. Terui, et al.
Transgenic expression of BACH1 transcription factor results in megakaryocytic impairment
Blood, April 15, 2005; 105(8): 3100 - 3108.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Ezoe, I. Matsumura, K. Gale, Y. Satoh, J. Ishikawa, M. Mizuki, S. Takahashi, N. Minegishi, K. Nakajima, M. Yamamoto, et al.
GATA Transcription Factors Inhibit Cytokine-dependent Growth and Survival of a Hematopoietic Cell Line through the Inhibition of STAT3 Activity
J. Biol. Chem., April 1, 2005; 280(13): 13163 - 13170.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
R. Ferreira, K. Ohneda, M. Yamamoto, and S. Philipsen
GATA1 Function, a Paradigm for Transcription Factors in Hematopoiesis
Mol. Cell. Biol., February 15, 2005; 25(4): 1215 - 1227.
[Full Text] [PDF]


Home page
Nucleic Acids ResHome page
N. Vilaboa, R. Bermejo, P. Martinez, R. Bornstein, and C. Cales
A novel E2 box-GATA element modulates Cdc6 transcription during human cells polyploidization
Nucleic Acids Res., December 8, 2004; 32(21): 6454 - 6467.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Centurione, A. Di Baldassarre, M. Zingariello, D. Bosco, V. Gatta, R. A. Rana, V. Langella, A. Di Virgilio, A. M. Vannucchi, and A. R. Migliaccio
Increased and pathologic emperipolesis of neutrophils within megakaryocytes associated with marrow fibrosis in GATA-1low mice
Blood, December 1, 2004; 104(12): 3573 - 3580.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Ahmed, A. Sternberg, G. Hall, A. Thomas, O. Smith, A. O'Marcaigh, R. Wynn, R. Stevens, M. Addison, D. King, et al.
Natural history of GATA1 mutations in Down syndrome
Blood, April 1, 2004; 103(7): 2480 - 2489.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Shimizu, K. Ohneda, J. D. Engel, C. D. Trainor, and M. Yamamoto
Transgenic rescue of GATA-1-deficient mice with GATA-1 lacking a FOG-1 association site phenocopies patients with X-linked thrombocytopenia
Blood, April 1, 2004; 103(7): 2560 - 2567.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Sun, G. Mao, and A. K. Rao
Association of CBFA2 mutation with decreased platelet PKC-{theta} and impaired receptor-mediated activation of GPIIb-IIIa and pleckstrin phosphorylation: proteins regulated by CBFA2 play a role in GPIIb-IIIa activation
Blood, February 1, 2004; 103(3): 948 - 954.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Gurbuxani, P. Vyas, and J. D. Crispino
Recent insights into the mechanisms of myeloid leukemogenesis in Down syndrome
Blood, January 15, 2004; 103(2): 399 - 406.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. Fossett, K. Hyman, K. Gajewski, S. H. Orkin, and R. A. Schulz
Combinatorial interactions of Serpent, Lozenge, and U-shaped regulate crystal cell lineage commitment during Drosophila hematopoiesis
PNAS, September 30, 2003; 100(20): 11451 - 11456.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Rylski, J. J. Welch, Y.-Y. Chen, D. L. Letting, J. A. Diehl, L. A. Chodosh, G. A. Blobel, and M. J. Weiss
GATA-1-Mediated Proliferation Arrest during Erythroid Maturation
Mol. Cell. Biol., July 15, 2003; 23(14): 5031 - 5042.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. E. Italiano Jr, W. Bergmeier, S. Tiwari, H. Falet, J. H. Hartwig, K. M. Hoffmeister, P. Andre, D. D. Wagner, and R. A. Shivdasani
Mechanisms and implications of platelet discoid shape
Blood, June 15, 2003; 101(12): 4789 - 4796.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. K. Hitzler, J. Cheung, Y. Li, S. W. Scherer, and A. Zipursky
GATA1 mutations in transient leukemia and acute megakaryoblastic leukemia of Down syndrome
Blood, June 1, 2003; 101(11): 4301 - 4304.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. E. Elagib, F. K. Racke, M. Mogass, R. Khetawat, L. L. Delehanty, and A. N. Goldfarb
RUNX1 and GATA-1 coexpression and cooperation in megakaryocytic differentiation
Blood, June 1, 2003; 101(11): 4333 - 4341.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. R. Kyriakides, P. Rojnuckarin, M. A. Reidy, K. D. Hankenson, T. Papayannopoulou, K. Kaushansky, and P. Bornstein
Megakaryocytes require thrombospondin-2 for normal platelet formation and function
Blood, May 15, 2003; 101(10): 3915 - 3923.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. A. Hall, D. J. Curtis, D. Metcalf, A. G. Elefanty, K. Sourris, L. Robb, J. R. Gothert, S. M. Jane, and C. G. Begley
The critical regulator of embryonic hematopoiesis, SCL, is vital in the adult for megakaryopoiesis, erythropoiesis, and lineage choice in CFU-S12
PNAS, February 4, 2003; 100(3): 992 - 997.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. R. Migliaccio, R. A. Rana, M. Sanchez, R. Lorenzini, L. Centurione, L. Bianchi, A. M. Vannucchi, G. Migliaccio, and S. H. Orkin
GATA-1 as a Regulator of Mast Cell Differentiation Revealed by the Phenotype of the GATA-1low Mouse Mutant
J. Exp. Med., February 3, 2003; 197(3): 281 - 296.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Du, M. J. Stankiewicz, Y. Liu, Q. Xi, J. E. Schmitz, J. A. Lekstrom-Himes, and S. J. Ackerman
Novel Combinatorial Interactions of GATA-1, PU.1, and C/EBPepsilon Isoforms Regulate Transcription of the Gene Encoding Eosinophil Granule Major Basic Protein
J. Biol. Chem., November 1, 2002; 277(45): 43481 - 43494.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Yu, K. K. Niakan, M. Matsushita, G. Stamatoyannopoulos, S. H. Orkin, and W. H. Raskind
X-linked thrombocytopenia with thalassemia from a mutation in the amino finger of GATA-1 affecting DNA binding rather than FOG-1 interaction
Blood, August 28, 2002; 100(6): 2040 - 2045.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. M. Vannucchi, L. Bianchi, C. Cellai, F. Paoletti, R. A. Rana, R. Lorenzini, G. Migliaccio, and A. R. Migliaccio
Development of myelofibrosis in mice genetically impaired for GATA-1 expression (GATA-1low mice)
Blood, July 30, 2002; 100(4): 1123 - 1132.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. N. Chang, A. B. Cantor, Y. Fujiwara, M. B. Lodish, S. Droho, J. D. Crispino, and S. H. Orkin
GATA-factor dependence of the multitype zinc-finger protein FOG-1 for its essential role in megakaryopoiesis
PNAS, July 9, 2002; 99(14): 9237 - 9242.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. B. Cantor, S. G. Katz, and S. H. Orkin
Distinct Domains of the GATA-1 Cofactor FOG-1 Differentially Influence Erythroid versus Megakaryocytic Maturation
Mol. Cell. Biol., June 15, 2002; 22(12): 4268 - 4279.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
C. Yu, A. B. Cantor, H. Yang, C. Browne, R. A. Wells, Y. Fujiwara, and S. H. Orkin
Targeted Deletion of a High-Affinity GATA-binding Site in the GATA-1 Promoter Leads to Selective Loss of the Eosinophil Lineage In Vivo
J. Exp. Med., June 3, 2002; 195(11): 1387 - 1395.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. G. Mehaffey, A. L. Newton, M. J. Gandhi, M. Crossley, and J. G. Drachman
X-linked thrombocytopenia caused by a novel mutation of GATA-1
Blood, November 1, 2001; 98(9): 2681 - 2688.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
R. A. Shivdasani
Molecular and Transcriptional Regulation of Megakaryocyte Differentiation
Stem Cells, September 1, 2001; 19(5): 397 - 407.
[Abstract] [Full Text] [PDF]


Home page
Cell Growth Differ.Home page
M. Eisbacher, L. M. Khachigian, T. H. Khin, M. L. Holmes, and B. H. Chong
Inducible Expression of the Megakarocyte-specific Gene Glycoprotein IX Is Mediated through an Ets Binding Site and Involves Upstream Activation of Extracellular Signal-regulated Kinase
Cell Growth Differ., August 1, 2001; 12(8): 435 - 445.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Freson, K. Devriendt, G. Matthijs, A. Van Hoof, R. De Vos, C. Thys, K. Minner, M. F. Hoylaerts, J. Vermylen, and C. Van Geet
Platelet characteristics in patients with X-linked macrothrombocytopenia because of a novel GATA1 mutation
Blood, July 1, 2001; 98(1): 85 - 92.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. M. Vannucchi, L. Bianchi, C. Cellai, F. Paoletti, V. Carrai, A. Calzolari, L. Centurione, R. Lorenzini, C. Carta, E. Alfani, et al.
Accentuated response to phenylhydrazine and erythropoietin in mice genetically impaired for their GATA-1 expression (GATA-1low mice)
Blood, May 15, 2001; 97(10): 3040 - 3050.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M.-j. Xu, S. Matsuoka, F.-C. Yang, Y. Ebihara, A. Manabe, R. Tanaka, M. Eguchi, S. Asano, T. Nakahata, and K. Tsuji
Evidence for the presence of murine primitive megakarycytopoiesis in the early yolk sac
Blood, April 1, 2001; 97(7): 2016 - 2022.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. Vyas, F. A. Norris, R. Joseph, P. W. Majerus, and S. H. Orkin
Inositol polyphosphate 4-phosphatase type I regulates cell growth downstream of transcription factor GATA-1
PNAS, November 16, 2000; (2000) 250476397.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
S. Tsuzuki, M. Towatari, H. Saito, and T. Enver
Potentiation of GATA-2 Activity through Interactions with the Promyelocytic Leukemia Protein (PML) and the t(15;17)-Generated PML-Retinoic Acid Receptor alpha Oncoprotein
Mol. Cell. Biol., September 1, 2000; 20(17): 6276 - 6286.
[Abstract] [Full Text]


Home page
BloodHome page
P. Albanese, M. Leboeuf, J.-P. Rosa, and G. Uzan
Identification of a GATA-overlapping sequence within the enhancer of the murine GPIIb promoter that induces transcriptional deregulation in human K562 cells
Blood, August 15, 2000; 96(4): 1348 - 1357.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. G. Drachman, G. P. Jarvik, and M. G. Mehaffey
Autosomal dominant thrombocytopenia: incomplete megakaryocyte differentiation and linkage to human chromosome 10
Blood, July 1, 2000; 96(1): 118 - 125.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Moroni, T. Mastrangelo, R. Razzini, L. Cairns, P. Moi, S. Ottolenghi, and B. Giglioni
Regulation of Mouse p45 NF-E2 Transcription by an Erythroid-specific GATA-dependent Intronic Alternative Promoter
J. Biol. Chem., March 31, 2000; 275(14): 10567 - 10576.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Gainsford, H. Nandurkar, D. Metcalf, L. Robb, C. G. Begley, and W. S. Alexander
The residual megakaryocyte and platelet production in c-Mpl-deficient mice is not dependent on the actions of interleukin-6, interleukin-11, or leukemia inhibitory factor
Blood, January 15, 2000; 95(2): 528 - 534.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
M. Shiraga, A. Ritchie, S. Aidoudi, V. Baron, D. Wilcox, G. White, B. Ybarrondo, G. Murphy, A. Leavitt, and S. Shattil
Primary Megakaryocytes Reveal a Role for Transcription Factor NF-E2 in Integrin {alpha}IIb{beta}3 Signaling
J. Cell Biol., December 27, 1999; 147(7): 1419 - 1430.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A.-H. Lagrue-Lak-Hal, N. Debili, G. Kingbury, C. Lecut, J.-P. Le Couedic, J.-L. Villeval, M. Jandrot-Perrus, and W. Vainchenker
Expression and Function of the Collagen Receptor GPVI during Megakaryocyte Maturation
J. Biol. Chem., April 27, 2001; 276(18): 15316 - 15325.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Ware, S. Russell, and Z. M. Ruggeri
Generation and rescue of a murine model of platelet dysfunction: The Bernard-Soulier syndrome
PNAS, March 14, 2000; 97(6): 2803 - 2808.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. Vyas, F. A. Norris, R. Joseph, P. W. Majerus, and S. H. Orkin
Inositol polyphosphate 4-phosphatase type I regulates cell growth downstream of transcription factor GATA-1
PNAS, December 5, 2000; 97(25): 13696 - 13701.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
Y. Kimura, A. Hart, M. Hirashima, C. Wang, D. Holmyard, J. Pittman, X.-L. Pang, C. W. Jackson, and A. Bernstein
Zinc Finger Protein, Hzf, Is Required for Megakaryocyte Development and Hemostasis
J. Exp. Med., April 1, 2002; 195(7): 941 - 952.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vyas, P.
Right arrow Articles by Shivdasani, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vyas, P.
Right arrow Articles by Shivdasani, R. A.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1999 by American Society of Hematology         Online ISSN: 1528-0020