|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 1 (July 1), 1999:
pp. 186-191
Kozak Sequence Polymorphism of the Glycoprotein (GP) Ib Gene Is a
Major Determinant of the Plasma Membrane Levels of the Platelet GP
Ib-IX-V Complex
By
Vahid Afshar-Kharghan,
Chester Q. Li,
Mohammad Khoshnevis-Asl, and
José A. López
From the Departments of Medicine and Molecular and Human Genetics,
Baylor College of Medicine and Veterans Affairs Medical Center,
Houston, TX.
 |
ABSTRACT |
Despite the known importance of the sequences surrounding ATG start
codons (Kozak sequences) for efficient translation of proteins, few
reports have appeared that describe the natural variations in these
sequences. Here, we report a human polymorphism in the Kozak sequence
of the platelet adhesion receptor, glycoprotein (GP) Ib , a component
of the GP Ib-IX-V complex, which mediates the initial adhesion of
platelets to the blood vessel wall following injury. The polymorphism
is based on the presence of either thymine (T) or cytosine (C) at
position  5 from the initiator ATG in the GP Ib gene. The less
common allele, 5C, represented 8% to 17% of the alleles in four
ethnic populations surveyed. This allele more closely resembles the
sequence considered optimal for efficient initiation of protein
translation and is associated with increased expression of the receptor
on the cell membrane, both in transfected cells and in the platelets of
individuals carrying the allele. In vitro transcription/translation
studies indicate that the increased expression results from more
efficient translation of the 5C form of the GP Ib mRNA. Other
mutations made to approximate more closely the consensus sequence
described by Kozak did not increase expression of the receptor. This is
the first known description of Kozak sequence polymorphism as a
determinant of the surface levels of a cell adhesion receptor. This
polymorphism may influence an individual's susceptibility for the
development of cardiovascular disease.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
THE INITIAL INTERACTION of mammalian
blood platelets with the blood vessel wall following injury is mediated
by the platelet glycoprotein (GP) Ib-IX-V complex, which binds a large multimeric protein in the subendothelium called von Willebrand factor
(vWF).1 This association is essential for the normal function of platelets in preventing blood loss and also is required for
the initial adhesion of platelets to exposed thrombogenic materials in
regions of atherosclerotic plaque rupture, which sets the stage for the
formation of platelet thrombi and possible tissue infarction.
The GP Ib-IX-V complex contains four polypeptides, GP Ib , GP Ib ,
GP IX, and GP V, which arise from different genes and are present on
the platelet plasma membrane in a 2:2:2:1 stoichiometry.1 All of the polypeptides are required for a fully functional complex; efficient expression of GP Ib on the plasma membrane requires coexpression of GP Ib and GP IX.2 GP Ib is the
largest polypeptide in the GP Ib-IX-V complex and contains within its
N-terminus the region that binds vWF. This polypeptide also contains a
high-affinity binding site for thrombin that is necessary for platelet
activation at low thrombin concentrations,3 and a region in
its cytoplasmic domain through which it anchors the entire complex to
the platelet cytoskeleton and to signaling molecules.4-6
Aside from the requirement for coexpression of GP Ib and GP IX,
little is known about the determinants of the plasma membrane levels of
GP Ib. Its transcription in megakaryocytes is controlled by
transcription factors of the Ets and GATA families,7 but no
examples of transcriptional regulation of protein levels have been
described, except for the boost in transcription of the gene observed
in cultured human endothelial cells treated with tumor necrosis
factor-.8 In this report, we describe another mechanism by which the levels of this important adhesion receptor are determined. We found that polymorphic variation in the region surrounding the
translation start site, at position 5 from the initiator ATG
codon (where either T or C is present), predicts the levels of the
receptor expressed on the surfaces of transfected cells and platelets.
The polymorphism is prevalent in several human ethnic populations and
may be a determinant of platelet responsiveness.
| |
MATERIALS AND METHODS |
Site-directed mutagenesis and expression of the polymorphic variants in
heterologous cells.
Mutagenesis to produce the 5C variant of GP Ib was performed
on the cDNA cloned in the expression plasmid pDX as was previously described.9 The two GP Ib cDNA variants were then
transiently expressed in cells stably expressing GP Ib and GP IX,
using liposome-mediated transfection (LipofectAMINE; GIBCO-BRL, Grand
Island, NY). One microgram of plasmid was used in each transfection,
with the two plasmids transfected either alone or as an equal mixture.
Expression of the GP Ib-IX complex on the cell surface was evaluated 72 hours after the transfection. The cells were detached from the culture plates using 0.54 mmol/L EDTA and incubated for 45 minutes in 5 µg/mL
final concentration of the GP Ib monoclonal antibody, WM23 (kindly
provided by Dr Michael C. Berndt, Prahran, Victoria, Australia). The
cells were then washed twice in phosphate-buffered saline (PBS) and
incubated in 10 µg/mL of fluorescein isothiocyanate (FITC)-conjugated rabbit antimouse IgG (Zymed, South San Francisco, CA) for an additional 45 minutes. After two subsequent washes in PBS,
the cells were analyzed by flow cytometry. Ten thousand cells from each
transfection were analyzed for fluorescence by exciting the fluor with
laser light at 480 nm using an argon ion laser and analyzing the light
emitted at greater than 520 nm. The analyses were performed on a
FACStar flow cytometer (Becton Dickinson, San Jose, CA).
A separate set of experiments was also performed with the T or C
plasmid cotransfected with a plasmid containing a cDNA for green
fluorescent protein (GFP) as an internal control for transfection efficiency. The GP Ib plasmid (0.5 µg) was mixed with 0.5 µg of
pEGFP-C1 (Clontech, Palo Alto, CA) and transfected as described earlier. The GP Ib was detected using WM23 and a
phycoerythrin-conjugated secondary antibody. GP Ib fluorescence was
detected in FL-2 and GFP fluorescence in FL-1 after appropriate
compensation for spectral overlap.
Subjects.
The DNA samples from the African American, Australian Aborigine, and
Southeast Asian populations have been described
previously.10 The French Caucasian population represented
the Centre d'Etude du Polymorphisme Humain (CEPH) reference families.
The samples were generously provided by Dr Erwin Ludwig (Department of
Genetics, University of Utah, Salt Lake City).
DNA amplification and restriction analysis.
Genomic DNA was amplified by the polymerase chain reaction (PCR) using
primers based on the GP Ib gene sequence (accession no. M22403),
nucleotides 2761 to 3218. The sequence of the upstream primer was
5'GAGAGAAGGACGGAGTCGAG3' and that of the downstream primer
was 5'GGTTGTGTCTTTCGGCAGG3'. Each reaction contained 100 to
300 ng of genomic DNA, 250 ng of each primer, each dNTP at a final
concentration of 200 µmol/L, 2.5 U Pyrococcus furiosus (Pfu) DNA polymerase, and 5 µL Pfu buffer provided by
the manufacturer (Stratagene, La Jolla, CA). The final volume of the
reactions was brought to 50 µL with water. The following conditions
were used in the amplification: the samples were heated to 95°C for 5 minutes, then subjected to 30 cycles of 95°C for 1 minute,
60°C for 1 minute, and 72°C for 2 minutes. At the end of the 30 cycles, the samples were incubated for 10 minutes at 72°C. An
aliquot of the amplification product was digested with the restriction enzyme PpuMI. The allele containing T at position 5
contains a site for this enzyme not present in the C allele. Thus,
digestion of the amplified product from T/T homozygotes produces three
bands (125 bp, 157 bp, and 175 bp), from C/C homozygotes, two bands (125 bp and 332 bp), and from heterozygotes, four bands (125 bp, 157 bp, 175 bp, and 332 bp).
Cell-free transcription/translation.
The transcription/translation experiments were performed using the TNT
quick-coupled transcription/translation system (Promega Corp, Madison,
WI). The two forms of the GP Ib cDNA were cloned into the vector
pBluescript II SK (+/) (Stratagene), in which transcription is
driven from the T7 promoter. One microgram of each DNA was added to 40 µL of the "master-mix," which contains rNTPs, rabbit
reticulocyte lysate, T7 polymerase, all of the necessary amino acids
except methionine, RNAse inhibitor, buffer, and 20 µCi of
[35S]methionine (Amersham Life Science, Arlington
Heights, IL). The volume was brought to 50 µL with nuclease-free
water. The mixture was incubated at 30°C for 60 minutes. The
translation products were separated by sodium dodecyl sulfate
(SDS)-polyacrylamide gel electrophoresis, the gel was exposed to a
phosphorimager plate, and the latent image developed in a
phosphorimager (Fuji, Tokyo, Japan; Model BAS1000). The band density
was quantitated using MacBAS version 2.0 software (Fuji).
Flow cytometry of platelets.
Blood was drawn from subjects with different GP Ib genotypes (T/T,
T/C, C/C) into 1:6 vol of acid-citrate-dextrose anticoagulant. Prostaglandin E1 (5 nmol/L) was included in the buffers at
each step of the platelet preparation to prevent platelet activation. The blood was centrifuged at 250g for 15 minutes to obtain
platelet-rich plasma (PRP). Creatine phosphokinase and creatine
phosphate were added to the PRP as a further measure against platelet
activation, and the PRP was centrifuged at 1,600g to obtain a
platelet pellet. The platelets were then washed twice in Tris-buffered
saline (25 mmol/L Tris, 154 mmol/L NaCl) containing 2 mmol/L EDTA. The
platelets were then fixed with 1% paraformaldehyde and analyzed by
flow cytometry using the GP Ib monoclonal antibody WM23. Analysis was performed as described for the transfected CHO cells, except that
100,000 platelets were included in each analysis.
Western blot analysis of platelet GP Ib.
Platelets were prepared as described earlier and the platelet pellet
was resuspended in RIPA lysis buffer (100 mmol/L Tris, 50 mmol/L NaCl,
0.5% SDS, 1% Triton X-100), which contained a protease inhibitor
cocktail (1 mg/mL leupeptin, 1.6 mg/mL benzamidine, 0.1 mg/mL soybean
trypsin inhibitor, 1 mmol/L phenylmethylsulfonyl fluoride), 5 mmol/L
EDTA, and 100 µg/mL DNase I. The platelet lysate was mixed with an
equal volume of 2 × SDS sample buffer (containing 4% SDS and 4%
-mercaptoethanol), boiled for 10 minutes, then electrophoresed on a
7.5% SDS-polyacrylamide gel. Proteins were electrophoretically
transferred to a nitrocellulose membrane. To block nonspecific binding,
the membrane was incubated for 1 hour at room temperature in a solution
containing 5% nonfat milk and 0.1% Tween 20 in Tris-buffered saline.
The membrane was then incubated for 1 hour with 4 µg/mL WM23 to
detect GP Ib. The membrane was washed twice with the same buffer
(without milk) and then incubated for 45 minutes with horseradish
peroxidase-conjugated antimouse antibody (1:10,000 dilution; Amersham)
and washed as before. The bound antibody was then detected using a
chemiluminescence detection kit (Amersham kit no. 2106). To control for
sample loading, the membrane was also probed with the monoclonal
antibody G 1.9, directed against GP IIb (a kind gift from Dr Perumal
Thiagarajan, University of Texas, Houston). The membrane was first
submerged in stripping buffer (100 mmol/L 2-mercaptoethanol, 2% SDS,
62.5 mmol/L Tris-HCl, pH 6.7) at 50°C for 30 minutes, then washed
twice for 15 minutes and blocked with 5% milk and 0.1% Tween 20 in
Tris-buffered saline. The membrane was then probed with G 1.9 as
described earlier for WM23.
Statistical analysis.
The data were analyzed by pair-wise comparison using Student's
two-tailed t-test for paired values. Differences were
considered statistically significant for P values less than
.05.
| |
RESULTS |
Cytosine at position 5 of the GP Ib mRNA increases surface
expression of GP Ib in transfected cells.
In the course of our studies on genetic variation involving the GP
Ib gene in humans,9 we found an allele with replacement of thymine (T) by cytosine (C) at position 5 from the ATG start codon (Fig 1A). This base change was
recently reported as a polymorphism in a Finnish population, but no
comment was made as to its effect on the platelet
phenotype.11 Because the sequence surrounding the AUG
initiator codon in an mRNA has been shown by Kozak to determine the
efficiency with which the ribosomes and their accompanying translation
machinery initiate translation,12-14 we investigated if the
T C change might influence the expression of GP Ib.
View larger version (14K):
[in this window]
[in a new window]
| Fig 1.
Kozak sequence polymorphism in the GP Ib gene and in
vitro expression of the polymorphic variants. (A) The GP Ib sequence
surrounding the start codon and the location of the polymorphism
aligned with the consensus sequence determined for these regions by
Kozak.15 (B) Expression of GP Ib in CHO cells
transfected with GP Ib cDNAs containing either C or T at position
5. The cells were transfected with either plasmid alone or with the
same quantity of an equal mixture of the 2 plasmids. Expression of GP
Ib on the cell surface was evaluated by flow cytometry after
staining the cells with monoclonal antibody WM23 and a FITC-conjugated
secondary antibody. Expression levels were determined by measuring the
mean fluorescence of the whole cell population and are expressed as
percentages of the expression obtained for the more common 5T
variant. The increased surface levels of GP Ib in the cells
transfected with the 5C plasmid alone or with a combination of the
5C and 5T plasmids as compared with the cells transfected only
with the 5T plasmid were both statistically significant (P
= .05 and P < .003, respectively, Student's
two-tail t-test, n = 5). (C) Coexpression of GP Ib
variants with green fluorescent protein. Plasmids encoding the GP Ib
T and C variants were cotransfected with a plasmid containing the GFP
cDNA. GP Ib was detected with WM23 followed by a
phycoerythrin-conjugated secondary antibody. Values are expressed as
the ratio of mean fluorescence in FL-2 (PE) to the mean fluorescence in
FL-1 (GFP). The expression of the C variant was again significantly
higher than that of the T variant (P = .02, n = 4, Student's two-tail t-test).
|
|
Expression of GP Ib on the plasma membrane was compared using the
two forms of the GP Ib cDNA by transient expression in Chinese
hamster ovary (CHO) cells that stably express GP Ib and GP IX. The
presence of C at 5 increased surface levels of GP Ib in
proportion to its representation in the transfection mix (C/C 153% ± 22%, T/C 132% ± 31%, T/T 100%; Fig 1B). As a further test
that the observed differences were not due to differences in
transfection efficiency, we repeated the transient transfections of the
T and C plasmids, now cotransfecting them with a plasmid containing a
cDNA for GFP as an internal control for transfection efficiency. In
these experiments, expression of the C variant was 1.7 times the
expression of the T variant (see Fig 3C).
Allele frequencies in different ethnic populations.
Because Kaski et al had reported that the 5C variant of GP Ib
represented a significant proportion of GP Ib alleles in a Finnish
population,11 we examined whether the same is true in other
ethnic populations. Table 1 shows that the
polymorphism is present in several human populations of diverse origin,
with an allele frequency for the less common 5C variant ranging
between 8% and 17%, and a distribution of heterozygotes close to that predicted by Hardy-Weinberg equilibrium.
T/C polymorphism is a determinant of platelet surface levels of GP
Ib.
We next examined whether, as in transfected cells, the presence of C at
5 also increases GP Ib-IX-V complex surface levels in human
platelets. We compared the surface levels of GP Ib in homozygotes
for either allele and in heterozygotes. As in transfected CHO cells,
the amount of GP Ib-IX-V complex expressed on the platelet surface
correlated directly with gene dosage. T/T homozygote platelets displayed the least GP Ib on their surfaces, C/C homozygotes displayed the most, and heterozygotes displayed intermediate levels (T/T 100%, T/C 128% ± 16%, C/C 157% ± 26%; Fig
2A and B). Both the mean and modal levels
of GP Ib were increased in the platelets of persons carrying the C
allele.
View larger version (22K):
[in this window]
[in a new window]
| Fig 2.
Expression of GP Ib in the platelets of individuals
with different GP Ib genotypes. (A) Flow cytometry histograms of
platelets from three individuals with the genotypes indicated. GP Ib
was detected with WM23 and a FITC-conjugated secondary antibody. The
ordinate represents the relative cell number; the abscissa represents
the log fluorescence intensity. (B) Average GP Ib levels from flow
cytometry determinations on three individuals with each genotype. The
experiments were performed six times and the mean fluorescence
intensities from the individual experiments were averaged and are
represented as mean ± SEM. The differences in the levels of GP Ib
in the platelets of individuals with T/C and C/C genotypes as compared
with T/T individuals were both statistically significant (P = .01 and P < .005, respectively, Student's two-tail
t-test, n = 6). The increased expression in the C/C
individuals compared with those with the T/C genotype also showed a
trend toward statistical significance (P = .075). (C)
Immunoblot of whole platelet lysates from three individuals. The
membrane was probed with WM23. The same blot was stripped and reprobed
with antibody G 1.9 against GP IIb as a control for loading.
|
|
Immunoblot analysis for GP Ib reflected the flow cytometry results:
C/C homozygotes had significantly greater quantities of GP Ib in
their platelets than did heterozygotes or T/T homozygotes (Fig 2C).
T/C polymorphism influences GP Ib mRNA translation efficiency.
To investigate the mechanism of the increased expression, we evaluated
the two allelic forms for their ability to produce protein in a
cell-free transcription/translation system. Transcription in this
system is driven by the T7 bacteriophage promoter and begins from the
T7 transcription start site. The only difference between the two
inserts was the nucleotide at position 5. In this system,
significantly more protein was produced from the 5C cDNA than
from the 5T form (Fig 3), which
strongly suggests that the polymorphism affects the efficiency of
translation.
View larger version (32K):
[in this window]
[in a new window]
| Fig 3.
In vitro transcription/translation analysis. Protein
production from the two forms of the GP Ib cDNA was evaluated in a
cell-free transcription/translation system using
[35S]methionine as the radiolabel for the newly
synthesized protein. The band designated GP Ib is of the molecular
weight expected for the polypeptide that has not been
posttranslationally modified (~70 kD). The experiment was performed
six times; a representative autoradiogram is shown. The autoradiogram
was obtained by phosphorimaging; the band densities are expressed in
arbitrary units. Substantially more protein was synthesized from the
5C plasmid.
|
|
Other mutations of the GP Ib Kozak sequence.
The consensus derived by Kozak was deduced by study of a large number
of sequences and by experimental studies with a model mRNA, encoding
preproinsulin.12-15 We wondered whether the same rules hold
for the sequence surrounding the GP Ib translation start site.
Therefore, we studied whether mutations that further increase the
similarity of the GP Ib sequence to the consensus sequence described
by Kozak12-14 would also increase the surface expression of
the GP Ib-IX complex in transfected cells. The mutations progressively
increase the similarity between the GP Ib sequence and the consensus
sequence, as depicted in Fig 4, by
sequentially changing the nucleotides at positions +4, 3, and
2. None of the changes produced expression levels greater than
produced by the wild-type sequence; only when the sequence was fully
converted to the consensus Kozak sequence did expression approximate
expression from the wild-type variant. In contrast, the levels produced
by the 5C form were again significantly higher than those from
the wild-type variant. Thus, the wild-type sequence of GP Ib
functions as well as the consensus sequence in supporting efficient
translation of the polypeptide and the 5C polymorphic variant
functions even better.
View larger version (25K):
[in this window]
[in a new window]
| Fig 4.
Effect of additional mutations of the GP Ib Kozak
sequence on surface expression of the GP Ib-IX complex in transfected
cells. Additional mutations surrounding the GP Ib start codon were
made as indicated, with each successive mutation rendering the sequence
closer to the consensus sequence derived by Kozak, shown at the right.
Expression of the mutants is expressed as a percentage of the
expression in cells transfected with the wild-type GP Ib cDNA. *The
decrease in expression from these mutants as compared with wild-type GP
Ib was statistically significant.
|
|
| |
DISCUSSION |
We describe here a polymorphism of a gene encoding a human platelet
adhesion receptor that influences the levels of the receptor on the
platelet plasma membrane. To our knowledge, no other similar polymorphisms have been described that affect the context of a eukaryotic translation initiation site without either adding or removing an ATG start codon. Recently, Kanaji et al showed that the
level of coagulation factor XII in human plasma was profoundly influenced by a single base polymorphism within the Kozak sequence of
the mRNA encoding this protein.16 The less common allele, with T replacing C at position 4, was associated with a marked decrease in the plasma levels of factor XII. The difference between that polymorphism and the one described here is that in the factor XII
polymorphism T at position 4 introduces a new ATG codon upstream of the one present in the most common allele and thus may decrease expression by providing a competing out-of-frame initiation codon. In
the GP Ib polymorphism, on the other hand, only the context of the
initiation site is changed. The sequence containing C instead of T at
position 5 more closely approximates the consensus derived by
Kozak (Fig 1A), which suggests that the mRNA with C at 5 is translated more efficiently. Consistent with this possibility, more
protein was produced from the 5C form in a cell-free
transcription/translation system (Fig 3). Previous work on the
sequences surrounding translation initiation sites indicates that the
purines at positions 3 and +4 are the most important
determinants of efficient translation. The other nucleotides in the
sequence were deemed of lesser importance, based on a comparison of a
large number of eukaryotic mRNA sequences12 and on in vitro
studies with a model mRNA.13-15 Our studies indicate that
these values of relative importance may not apply generally, and
certainly do not apply in the case of the GP Ib mRNA, as the
5 position had a much more profound effect than did changes at
any other position (Fig 4).
The presence of one or two copies of the 5C allele increases
both the mean and modal levels of GP Ib on the platelet plasma membrane (Fig 2A). Because the stability and plasma membrane expression of GP Ib require that this polypeptide form a complex with GP Ib
and GP IX, this finding suggests that the latter polypeptides are
normally synthesized in excess. If this is true, then one might find
that the level of the GP Ib-IX-V complex found on the platelets of
heterozygous carriers of Bernard-Soulier syndrome (the deficiency
disorder of the complex) would depend on which of the three genes is
mutated. Those who carry an abnormal GP Ib allele might be expected
to express less of the complex on their platelets if this polypeptide
is normally present in limiting quantities. As yet this hypothesis has
not been thoroughly examined.
Most of the previously described differences within populations in the
levels of individual proteins have been ascribed to differences in gene
transcription or protein stability. It might be expected that other
polymorphisms of Kozak sequences would also lead to variations in
protein levels, although such polymorphisms may have escaped detection
because they involve neither protein coding sequences nor promoters and
consequently may have been overlooked in searches for determinants of
variation in protein expression levels. Nevertheless, the large
variations in translation efficiency, and thus in protein levels, that
have been described following experimental alteration of these
sequences in vitro,13-15 suggest that changes in
translation efficiency may be a common reason for differences in
protein expression between individuals.
The GP Ib-IX-V complex plays a crucial role in the adhesion of
platelets to the vessel wall, both during normal hemostasis and during
thrombotic events that lead to tissue infarction (notably of the
myocardium in coronary artery disease). It seems possible that
increasing the density of this adhesive protein on the surfaces of
platelets might predispose them to attach more readily, thus increasing
the likelihood of thrombosis and infarction. Increased expression of
the GP Ib-IX-V complex in platelets may also provide more efficient
hemostasis, and thus the 5C allele may have at some point in
human evolution provided a selective advantage to individuals carrying it.
| |
ACKNOWLEDGMENT |
We gratefully acknowledge Dr Erwin Ludwig for providing DNA samples and
helpful advice, Dr Jing-fei Dong for helpful discussions, and Drs
Arthur Beaudet and John Belmont for carefully reading the manuscript
and providing helpful suggestions.
| |
FOOTNOTES |
Submitted October 5, 1998; accepted March 3, 1999.
Supported by Grants No. 96002750 and 96012670 from the American Heart
Association and Grant No. HL54218 from the National Institutes of
Health. J.A.L. is an Established Investigator of the American Heart Association.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to José A. López, MD, Veterans
Affairs Medical Center, Hematology/Oncology (111H), 2002 Holcombe Blvd,
Houston, TX 77030; e-mail: josel{at}bcm.tmc.edu.
| |
REFERENCES |
1.
López JA:
The platelet glycoprotein Ib-IX complex.
Blood Coagul Fibrinolysis
5:97, 1994[Medline]
[Order article via Infotrieve]
2.
López JA, Leung B, Reynolds CC, Li CQ, Fox JE:
Efficient plasma membrane expression of a functional platelet glycoprotein Ib-IX complex requires the presence of its three subunits.
J Biol Chem
267:12851, 1992[Abstract/Free Full Text]
3.
Jamieson GA:
Pathophysiology of platelet thrombin receptors.
Thromb Haemost
78:242, 1997[Medline]
[Order article via Infotrieve]
4.
Fox JEB, Lipfer L, Clark EA, Reynolds CC, Austin CD, Brugge JS:
On the role of the platelet membrane skeleton in mediating signal transduction.
J Biol Chem
268:25973, 1993[Abstract/Free Full Text]
5.
Fox JE:
Platelet activation: New aspects.
Haemostasis
26:102, 1996 (suppl 4)
6.
Fox JE:
The platelet cytoskeleton.
Thromb Haemost
70:884, 1993[Medline]
[Order article via Infotrieve]
7.
Hashimoto Y, Ware J:
Identification of essential GATA and Ets binding motifs within the promoter of the platelet glycoprotein Ib gene.
J Biol Chem
270:24532, 1995[Abstract/Free Full Text]
8.
Rajagopalan V, Essex DW, Shapiro SS, Konkle BA:
Tumor necrosis factor- modulation of glycoprotein Ib expression in human endothelial and erythroleukemia cells.
Blood
80:153, 1992[Abstract/Free Full Text]
9.
Afshar-Kharghan V, López JA:
Bernard-Soulier syndrome caused by a dinucleotide deletion and reading frameshift in the region encoding the glycoprotein Ib transmembrane domain.
Blood
90:2634, 1997[Abstract/Free Full Text]
10.
López JA, Ludwig EH, McCarthy BJ:
Polymorphism of human glycoprotein Ib results from a variable number of tandem repeats of a 13-amino acid sequence in the mucin-like macroglycopeptide region. Structure/function implications.
J Biol Chem
267:10055, 1992[Abstract/Free Full Text]
11.
Kaski S, Kekomaki R, Partanen J:
Systematic screening for genetic polymorphism in human platelet glycoprotein Ib.
Immunogenetics
44:170, 1996[Medline]
[Order article via Infotrieve]
12.
Kozak M:
Possible role of flanking nucleotides in recognition of the AUG initiator codon by eukaryotic ribosomes.
Nucleic Acids Res
9:5233, 1981[Abstract/Free Full Text]
13.
Kozak M:
Point mutations close to the AUG initiator codon affect the efficiency of translation of rat preproinsulin in vivo.
Nature
308:241, 1984[Medline]
[Order article via Infotrieve]
14.
Kozak M:
Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes.
Cell
44:283, 1986[Medline]
[Order article via Infotrieve]
15.
Kozak M:
At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells.
J Mol Biol
196:947, 1987[Medline]
[Order article via Infotrieve]
16.
Kanaji T, Okamura T, Osaki K, Kuroiwa M, Shimoda K, Hamasaki N, Niho Y:
A common genetic polymorphism (46 C to T substitution) in the 5'-untranslated region of the coagulation factor XII gene is associated with low translation efficiency and decrease in plasma factor XII level.
Blood
91:2010, 1998[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
C. I. Jones, S. Bray, S. F. Garner, J. Stephens, B. de Bono, W. G. J. Angenent, D. Bentley, P. Burns, A. Coffey, P. Deloukas, et al.
A functional genomics approach reveals novel quantitative trait loci associated with platelet signaling pathways
Blood,
August 13, 2009;
114(7):
1405 - 1416.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. M. Maguire, A. Thakkinstian, J. Sturm, C. Levi, L. Lincz, M. Parsons, S. Whyte, and J. Attia
Polymorphisms in Platelet Glycoprotein 1b{alpha} and Factor VII and Risk of Ischemic Stroke: A Meta-Analysis
Stroke,
June 1, 2008;
39(6):
1710 - 1716.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. F. Bray, T. D. Howard, E. Vittinghoff, D. C. Sane, and D. M. Herrington
Effect of genetic variations in platelet glycoproteins Ib{alpha} and VI on the risk for coronary heart disease events in postmenopausal women taking hormone therapy
Blood,
March 1, 2007;
109(5):
1862 - 1869.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Ohmori, J. Mimuro, K. Takano, S. Madoiwa, Y. Kashiwakura, A. Ishiwata, M. Niimura, K. Mitomo, T. Tabata, M. Hasegawa, et al.
Efficient expression of a transgene in platelets using simian immunodeficiency virus-based vector harboring glycoprotein Ib{alpha} promoter: in vivo model for platelet-targeting gene therapy
FASEB J,
July 1, 2006;
20(9):
1522 - 1524.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. V. Vijayan and P. F. Bray
Molecular Mechanisms of Prothrombotic Risk Due to Genetic Variations in Platelet Genes: Enhanced Outside-In Signaling Through the Pro33 Variant of Integrin {beta}3.
Experimental Biology and Medicine,
May 1, 2006;
231(5):
505 - 513.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Mikkelsson, M. Perola, and P. J. Karhunen
Genetics of Platelet Glycoprotein Receptors: Risk of Thrombotic Events and Pharmacogenetic Implications
Clinical and Applied Thrombosis/Hemostasis,
April 1, 2005;
11(2):
113 - 125.
[Abstract]
[PDF]
|
|
|
|
|
|
|
B. Stratmann and D. Tschoepe
Pathobiology and cell interactions of platelets in diabetes
Diabetes and Vascular Disease Research,
February 1, 2005;
2(1):
16 - 23.
[Abstract]
[PDF]
|
|
|
|
|
|
|
T. J. Kunicki, A. B. Federici, D. R. Salomon, J. A. Koziol, S. R. Head, T. S. Mondala, J. D. Chismar, L. Baronciani, M. T. Canciani, and I. R. Peake
An association of candidate gene haplotypes and bleeding severity in von Willebrand disease (VWD) type 1 pedigrees
Blood,
October 15, 2004;
104(8):
2359 - 2367.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T.-T. Li, S. Larrucea, S. Souza, S. M. Leal, J. A. Lopez, E. M. Rubin, B. Nieswandt, and P. F. Bray
Genetic variation responsible for mouse strain differences in integrin {alpha}2 expression is associated with altered platelet responses to collagen
Blood,
May 1, 2004;
103(9):
3396 - 3402.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Best, Y. A. Senis, G. E. Jarvis, H. J. Eagleton, D. J. Roberts, T. Saito, S. M. Jung, M. Moroi, P. Harrison, F. R. Green, et al.
GPVI levels in platelets: relationship to platelet function at high shear
Blood,
October 15, 2003;
102(8):
2811 - 2818.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Macchi, L. Christiaens, S. Brabant, N. Sorel, S. Ragot, J. Allal, G. Mauco, and A. Brizard
Resistance in vitro to low-dose aspirin is associated with platelet PlA1 (GP IIIa) polymorphism but not with C807T(GP Ia/IIa) and C-5T kozak (GP Ib{alpha}) polymorphisms
J. Am. Coll. Cardiol.,
September 17, 2003;
42(6):
1115 - 1119.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Ulrichts, K. Vanhoorelbeke, S. Cauwenberghs, S. Vauterin, H. Kroll, S. Santoso, and H. Deckmyn
Von Willebrand Factor But Not {alpha}-Thrombin Binding to Platelet Glycoprotein Ib{alpha} Is Influenced by the HPA-2 Polymorphism
Arterioscler Thromb Vasc Biol,
July 1, 2003;
23(7):
1302 - 1307.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Y. Park, S. H. Park, J. E. Choi, S. Y. Lee, H.-S. Jeon, S. I. Cha, C. H. Kim, J.-H. Park, S. Kam, R. W. Park, et al.
Polymorphisms of the DNA Repair Gene Xeroderma Pigmentosum Group A and Risk of Primary Lung Cancer
Cancer Epidemiol. Biomarkers Prev.,
October 1, 2002;
11(10):
993 - 997.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. J. Kunicki
The Influence of Platelet Collagen Receptor Polymorphisms in Hemostasis and Thrombotic Disease
Arterioscler Thromb Vasc Biol,
January 1, 2002;
22(1):
14 - 20.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H Douglas, K Michaelides, D A Gorog, E Durante-Mangoni, N Ahmed, G J Davies, and E G D Tuddenham
Platelet membrane glycoprotein Ib{alpha} gene -5T/C Kozak sequence polymorphism as an independent risk factor for the occurrence of coronary thrombosis
Heart,
January 1, 2002;
87(1):
70 - 74.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Cadroy, K. S. Sakariassen, J.-P. Charlet, C. Thalamas, B. Boneu, and P. Sie
Role of 4 platelet membrane glycoprotein polymorphisms on experimental arterial thrombus formation in men
Blood,
November 15, 2001;
98(10):
3159 - 3161.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Meisel, V. Afshar-Kharghan, I. Cascorbi, M. Laule, V. Stangl, S. B. Felix, G. Baumann, J. A. Lopez, I. Roots, and K. Stangl
Role of Kozak sequence polymorphism of platelet glycoprotein Ib{alpha} as a risk factor for coronary artery disease and catheter interventions
J. Am. Coll. Cardiol.,
October 1, 2001;
38(4):
1023 - 1027.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. I. Baker, J. Eikelboom, E. Lofthouse, N. Staples, V. Afshar-Kharghan, J. A. Lopez, Y. Shen, M. C. Berndt, and G. Hankey
Platelet glycoprotein Ib{alpha} Kozak polymorphism is associated with an increased risk of ischemic stroke
Blood,
July 1, 2001;
98(1):
36 - 40.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. S. Williams and P. F. Bray
Genetics of Arterial Prothrombotic Risk States
Experimental Biology and Medicine,
May 1, 2001;
226(5):
409 - 419.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
M. B. Frank, A. P. Reiner, S. M. Schwartz, P. N. Kumar, R. M. Pearce, P. G. Arbogast, W. T. Longstreth Jr, F. R. Rosendaal, B. M. Psaty, and D. S. Siscovick
The Kozak sequence polymorphism of platelet glycoprotein Ib{alpha} and risk of nonfatal myocardial infarction and nonfatal stroke in young women
Blood,
February 15, 2001;
97(4):
875 - 879.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. J. Samani, J. A. Lopez, and V. Afshar-Kharghan
Kozak sequence polymorphism in the platelet GPIb{alpha} gene is not associated with risk of myocardial infarction
Blood,
March 15, 2000;
95(6):
2183 - 2184.
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Sonoda, M. Murata, D. Ito, N. Tanahashi, A. Ohta, Y. Tada, E. Takeshita, T. Yoshida, I. Saito, M. Yamamoto, et al.
Association Between Platelet Glycoprotein Ib{alpha} Genotype and Ischemic Cerebrovascular Disease
Stroke,
February 1, 2000;
31(2):
493 - 497.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION