|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 1 (July 1), 1999:
pp. 310-318
Identification of a Defect in the Intracellular Trafficking of a
Kell Blood Group Variant
By
Karina Yazdanbakhsh,
Soohee Lee,
Qian Yu, and
Marion E. Reid
From the New York Blood Center, New York, NY.
 |
ABSTRACT |
Blood group polymorphisms have been used as tools to study the
architecture of the red blood cell (RBC) membrane. Some blood group
variants have reduced antigen expression at the cell surface. Understanding the underlying mechanism for this reduced expression can
potentially provide structural information and help to elucidate protein trafficking pathways of membrane proteins. The Kp(a+) phenotype is a variant in the Kell blood group system that is associated with a single amino acid substitution (R281W) in the Kell
glycoprotein and serologically associated with a weakened expression of
other Kell system antigens by an unknown mechanism. We found by
immunoblotting of RBCs that the weakening of Kell antigens in this
variant is due to a reduced amount of total Kell glycoprotein at the
cell surface rather than to the inaccessibility of the antigens to Kell
antibodies. Using a heterologous expression system, we demonstrate that
the Kpa mutation causes retention of most of the Kell
glycoprotein in a pre-Golgi compartment due to differential processing,
thereby suggesting aberrant transport of the Kell protein to the cell surface. Furthermore, we demonstrated that single nucleotide
substitutions into the coding region of the common KEL allele,
as predicted by the molecular genotyping studies, was sufficient to
encode three clinically significant low incidence antigens. We found that two low incidence antigens can be expressed on a single Kell protein, thus showing that the historical failure to detect such a
variant is not due to structural constraints in the Kell protein. These
studies demonstrate the power of studying the molecular mechanisms of
blood group variants for elucidating the intracellular transport
pathways of membrane proteins and the requirements for cell surface expression.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
BLOOD GROUP ANTIGENS are inherited,
polymorphic amino acid or carbohydrate motifs on the surface of red
blood cells (RBCs) and because they are easy to detect, a multitude of
naturally occurring variants have been identified. Several examples of
blood group variants that have reduced cell surface expression have been described serologically, and in some cases, the molecular basis
has been elucidated and found to be associated with point mutations in
the proteins encoding these variants.1 Examples include the
mutations in multipass proteins, eg, the mutation in the Duffy
(FY*B) gene that leads to the Fyx
phenotype,2-4 and the mutations in the channel-forming
integral protein (CHIP) leading to the Colton null phenotype
[Co(a b)].5 Understanding the molecular
mechanisms underlying the reduced cell surface expression can
potentially help in elucidating the biosynthetic pathways of the
surface membrane proteins and in obtaining useful structural information.
The Kell blood group system is one of the most polymorphic antigenic
systems in human RBCs with at least 23 Kell antigens including sets of
antithetical antigens K (K1) and k (K2); Kpa (K3),
Kpb (K4), and Kpc (K21); Jsa (K6)
and Jsb (K7).6 Kell system antigens are highly
immunogenic and the resulting antibodies can cause severe reactions to
transfusion of incompatible blood as well as causing fetal anemia and
hemolytic disease in newborns (HDN).7 It was recently shown
that anemia in the fetus/newborn is exacerbated by suppression of
erythropoiesis.8 Molecular analysis of the phenotypes of
the Kell blood group system has shown that for 21 antigens, the
differences are due to single base mutations, each causing an amino
acid substitution.6 However, with the exception of the K
antigen,6 it has not been possible to determine whether
single point mutations are solely responsible for each of the Kell
antigens, probably due to lack of strongly reactive monoclonal
antibodies (MoAbs) as detection tools. In addition, despite a
deliberate search, a KEL allele that encodes two low incidence
antigens has not yet been described.9
Kell antigens reside on a 93-kD type II glycoprotein, with
a 665-amino acid carboxy terminal extracellular domain, a single transmembrane domain, and a 47-amino acid N-terminal cytoplasmic domain.10 The Kell protein has a striking sequence homology with neutral zinc endo peptidases,10 which activate or
inactivate bioactive peptides and was recently shown to have
proteolytic activity.11 There are five consensus
N-glycosylation sites in the Kell sequence. In addition, Kell has 16 cysteine residues, making it highly folded and its antigens sensitive
to reducing agents, thereby showing the importance of conformation for
antigen expression. A weakening of all inherited, high incidence Kell antigens has been reported with RBCs of the Kp(a+)
phenotype,7,12,13 but the mechanism by which this occurs is
not understood. An amino acid substitution of Arg281Trp is associated
with the Kpa antigen.14 Because Kell is a
highly folded protein, this amino acid change may cause a
conformational change throughout the protein, thereby affecting the
accessibility of the antigens to Kell antibodies. Alternatively, the
amino acid substitution may affect the stability of the protein or its
ability to reach the cell membrane. Interestingly, the Kpc
antigen, a second antithetical antigen to Kpb, is
associated with amino acid substitution Arg281Gln,14 but does not result in weakening of Kell antigens. Understanding the underlying mechanism for the difference in these RBC phenotypes can
potentially yield useful information on the structure of Kell and its
related family members and/or help in elucidating the intracellular
trafficking of Kell and its requirements for surface expression.
As a first step in studying the clinically significant Kell antigens
including Kpa, we developed a transient heterologous Kell
expression system and obtained sufficient surface expression levels to
allow detection of antigens with human alloimmune antibodies. Using
this system, we showed that a single amino acid substitution in the
Kell protein gives rise to the expression of antithetical blood group
antigens: k to K: T193M; Kpb to Kpa: R281W;
Jsb to Jsa: L597P and demonstrated that it is
possible to express two low incidence antigens (K and Jsa)
on the same Kell protein. Interestingly, the weakening of Kell antigens
in RBCs with the Kp(a+) phenotype can be mimicked in this heterologous
system, and we used this system to understand the molecular mechanism
for this reduced expression. We demonstrated that whereas other Kell
variants express two forms of Kell glycoprotein, one that reaches the
cell surface and one that is retained in a pre-Golgi compartment, the
Kpa mutation causes the retention of most glycoprotein in
the intracellular compartment. These results strongly suggest that the
reduced cell surface expression of the Kell protein in the Kp(a+)
phenotype is as a result of aberrant transport of the protein. These
novel findings not only help in our understanding of the intracellular trafficking of Kell and other members of the endopeptidase family, but
can potentially be used to study the surface expression requirements of
other type II glycoproteins.
| |
MATERIALS AND METHODS |
Materials.
RBCs with known antigen types were obtained either from local blood
donors, a commercial panel (Gamma Biologicals, Inc, Houston, TX) or
from frozen storage. MoAb anti-K14 (6-22)15 and anti-Fy6 (NYBC-BG6, clone K6)16 were kindly supplied by Pablo
Rubinstein (New York Blood Center [NYBC], New York, NY). Commercial
antibodies (anti-K, anti-k, anti-Kpa, and
anti-Kpb) were from Gamma Biologicals, Inc (Houston, TX)
and Ortho Diagnostic Systems, Inc (Raritan, NJ). Sera containing
alloantibodies with specificities identified by the Immunohematology
Laboratory at the New York Blood Center were obtained from blood donors
or patients. Sera used included the following Kell specificities:
anti-K (6735416, 6747196), anti-k (BK, GUE), anti-Kpa (JH,
FR), anti-Kpb (RAU, 303255), anti-Jsa (632443, AM) and anti-Jsb (NM, CHI).
Construction of Kell expression vectors.
The wild-type Kell cDNA (encoding the common Kell phenotype, ie,
Kk+ Kp(ab+) Js(ab+) K14+ in pRc/CMV (InVitrogen,
Inc, Carlsbad, CA)17 without the XK cDNA (hereafter
referred to as pRc/CMV-wt) was used for expression studies and for
site-directed mutagenesis. All Kell cDNAs with the single mutations
were prepared in three steps using a DNA amplification
method.18 DNA sequencing analysis using an automated system
(Model 373A, version 1-2.0; Applied Biosystems, Foster City, CA) was
performed on all expression constructs to confirm that only the correct
mutations were obtained.
K construct.
A forward primer, 322fa (5'-AACTTCCAGAACTGTGGCCCTC-3') and
a reverse primer, NK1R (5'-ACTGACTCATCAGAAGTCTCAGCA
TTCGG-3') harboring the K C698T mutation19 were used
to amplify a 400-bp 5' polymerase chain reaction (PCR) fragment
using the pRc/CMV-wt as the template. The 3' 152-bp PCR fragment
with the same C698T mutation was amplified with primers NK1F
(5'-GG AC TTCCTTAAACTTTAACCGAAT GCTG-3') and
RT801R (5'-CTT GA GG GG AA CA TC AA AC TC TG GC-3'). The
third PCR step was performed using the 5' and 3'
gel-purified PCR fragments with 322fa and RT801R primer pairs. This
504-bp PCR product was then digested with EcoRI (nucleotide
[nt] 528) and PpuMI (nt 753) to release a 225-bp DNA fragment
that was inserted at the EcoRI and PpuMI of the Kell
cDNA in pBC SK.17 The resulting plasmid was digested with
HindIII and PpuMI and the 652-bp fragment was placed in
the HindIII and PpuMI double-digested pRc/CMV-wt to
obtain pRc/CMV-K.
Kpa construct.
To obtain a 350-bp 5' PCR fragment with the
Kpa-associated C961T mutation (that replaces arginine with
tryptophan at residue 281),14 primer pairs PPUF
(5'-GG CC ATTTCCCTTTCTTCAGAGCCTACCT-3') and KPAR
(5'-GG GG CC TC AG AA AC TGG AA CA GC CA
TGAAGT-3') were used with the linearized pRc/CMV-wt as template.
A 162-bp 3' PCR fragment with the C961T mutation was made using
KPAF (5'-CT TC CT TG TC AA TC TC CA TC AC TT CAT
GGCTG-3') and BSTR (5'-GA GC TT TC TG CG TG CC TC CT GG AA
TTGAC-3') as primers. Both PCR products were then gel-purified
and used as templates with primer pairs PPUF and BSTR to generate a
561-bp final PCR product. This was then cut with PpuMI (nt 753)
and BstEII (nt 1230) and the resulting fragment inserted at
PpuMI and BstEII sites of pRc/CMV-wt Kell construct and
was referred to as pRc/CMV-Kpa.
Kpc construct.
The strategy used to generate the Kpa mutation was also
used to make the Kpc-associated G962A
mutation14 (that encodes glutamine instead of arginine at
residue 281). The exception was that the primers PPUF and KPCR
(5'-GG GG CC TC AG AA ACT GG AA CA GCT
GTGAAGT-3') were used to generate the 5' PCR fragment and
primers KPCF (5'-CT TC CT TGTCAATCTCCATCACTTCACA GCTG-3')
and BSTR were used to make the 3' PCR fragment. The final
expression construct was called pRc/CMV-Kpc.
Jsa construct.
Molecular genotyping studies have shown the Jsa allele has
two point mutations within the Kell gene, one at position 1910 that has
been associated with T to C substitution that encodes Leu597 Pro and
another occurring at position 2019, which is a silent mutation.20 Therefore, we introduced the point mutation
that corresponds to T1910C. A 5' 741 bp DNA fragment containing
the 5' terminal region with the T1910C mutation was made by PCR
with forward primer, BstF (5'-CT TT CT GC AG AG CC AC AT GA
TCTTAGGGC-3') and reverse primer, JsaR (5'-TC CT GG AG GG
CA TG GT TG TC AC AG GC GG GG-3') using the
PvuI linearized pRc/CMV-wt as template. A 3' 208-bp DNA
fragment also harboring the T1910C mutation was made with primers JsaF
(5'-AC CA GC TC TT AC TG CC T GG GG GC TGCCC
C-3') and NheR (5'-TA AC AG CC
TGTTGCTGTATGCCTGCAG-3') using pRc/CMV-wt Kell as template. This
was then followed by the third-step PCR reaction using gel purified
5' and 3' PCR fragments as templates and the BstF
and NheR primer pairs. The resulting 904-bp PCR product was
digested with BstEII (nt position 1230 of the Kell cDNA) and
NheI (nt 2043) to release an 814-bp DNA fragment, which was
cloned into pRc/CMV-wt at BstEII and NheI sites. This
expression construct is referred to as pRc/CMV-Jsa.
Double K/Jsa mutant construct.
The strategy used to construct a Kell cDNA that encodes two low
incidence antigens K and Jsa was to insert the K mutation
into pRc/CMV-Jsa. pRc/CMV-K and pRc/CMV-Jsa
were both digested with HindIII (5' to the Kozak site in
the polylinker of the vector) and AvrII (nt 750). Because there
is an extra AvrII in the pRc/CMV vector, the
pRc/CMV-Jsa was only partially digested. The
gel-purified fragments (750-bp fragment encoding the K mutation and the
7 kbp pRc/CMV-Jsa) were then ligated together to make the
pRc/CMV-K/Jsa double mutant.
Transfection procedure 293T cells.
The human embryonic kidney 293T cells were transfected by the calcium
phosphate precipitation method as previously described21 with the various (listed above) Kell cDNA expression constructs (10 µg). To control for transfection efficiency, an unrelated plasmid,
pREP-FYB (3 µg), was cotransfected with each expression construct.
After 24 hours, cells were washed and fed with growth medium (Minimal
Essential Medium Eagle alpha [ -MEM], 10% fetal bovine serum, 1%
penicillin/streptomycin) and grown for another 24 hours. Cells were
then analyzed for expression by flow cytometry and immunoblotting.
Flow cytometric analyses.
Analysis of antigen expression on transfected cells was performed by
flow cytometry in parallel with antigen-positive and antigen-negative
RBCs to control for antibody specificity. In addition to antithetical
antigen expression profile, the expression of other Kell antigens was
analyzed to ensure that the Kell proteins in the transfectants were
correctly folded. Thus, expression of K14 antigen was tested with each
of the transfectants using MoAab anti-K14. Anti-k (n = 2) were used to
detect the expression of k antigen in Kpa- and
Jsa-transfected cells; anti-Kpb (n = 2) to
detect the expression of Kpb antigen in K-,
Jsa-, and K/Jsa-transfected cells; and
anti-Jsb (n = 2) to detect the expression of
Jsb antigen in K-, Kpa-transfected cells (data
not shown).
Briefly, RBCs (3 µL of 0.5% suspension) or 106
transfected 293T cells were washed twice with phosphate-buffered
saline (PBS) containing 0.5% bovine serum albumin (BSA) and
incubated for 1 hour at 37°C with the appropriate primary antibody
diluted at a ratio of 1:2 in PBS/0.5% BSA. After three washes, the
cells were incubated with fluorescein-conjugated anti-mouse or
anti-human IgG (H+L) (Vector Laboratories Inc, Burlingame, CA) at
50-fold dilution for 30 minutes at 4°C. To analyze the transfected
cells, 10 µg of propidium iodide (PI) was added to 0.5 mL cell
suspension and PI-negative cells, representing the live cell
population, were selected for analysis on the FACSCalibur flow
cytometer (Becton Dickinson, San Jose, CA). For the RBC analysis, the
total population was used. RBCs with the common Kell phenotype were
used as the positive control for all of the high incidence antigens. In
Tables 1 and 2,
the median of fluorescence intensity values from several experiments
were averaged and used as a measure of antigen expression. To normalize
for efficiency of transfection of the different Kell constructs,
expression of cotransfected Duffy plasmid vector was measured by flow
cytometry using anti-Fy6. The fluorescence intensity values for Kell
antigen expression in Table 2 were calculated as relative values
obtained after normalization to the level of Duffy expression.
Immunoblotting.
RBC membrane ghosts were prepared by a standard method.22
Transfected 293T cells (1 × 107) were lysed in
PBS/1% Triton X100 in the presence of protease inhibitors (10 µg/mL
aprotonin and 1 mmol/L phenylmethylsulfonyl fluoride), centrifuged at
12,000 rpm to pellet nuclei and cell debris. Equal volumes of 2X sodium
dodecyl sulfate (SDS)-loading buffer (0.5 mol/L Tris-HCl, pH 6.8, 2%
SDS, 8 mol/L urea, 20 mmol/L dithiothreitol [DTT], and 0.01%
bromophenol blue) was added to RBC ghost preparations and cell lysates.
Samples were boiled, separated on 4-12% SDS-polyacrylamide gel
electrophoresis (PAGE) gradient gels (Novex, San Diego, CA) and then
transferred onto nitrocellulose paper (NCP). The NCP was stained with
Ponceau-S to demonstrate approximately equal amounts of protein in each lane before blocking for 1 hour or overnight in 5% BSA. This was followed by several washes in PBS, 0.1% Tween-20 and incubation overnight at 4°C with a 1:1,000 dilution of polyclonal anti-Kell (kindly provided by David Russo, NYBC), which had been prepared from
injection into rabbits of SDS-PAGE purified Kell glycoprotein immunoprecipitated from antigen positive RBCs. After several washings (4 × 15 minutes) in PBS, 0.1% Tween-20, the NCP was incubated at
room temperature for 1 hour with a 1:3,000 dilution of the rabbit
horseradish peroxidase (HPR)-conjugated secondary antibody in PBS,
0.5% BSA. They were then washed four times 15 minutes in PBS, 0.1%
BSA, and the peroxidase activity developed by HRP color development
reagent, 4-chloro-1-naphthol (Bio-Rad, Hercules, CA).
Endo H digestion.
Transfected 293T cells (1 × 105) were lysed in 300 µL of PBS/1% Triton X100 in the presence of protease inhibitors (10 µg/mL aprotonin and 1 mmol/L phenylmethylsulfonyl fluoride),
centrifuged at 12,000 rpm to pellet nuclei and cell debris. A total of
100 µL of the extracts was then denatured and digested with 500 U of
Endo H (New England Biolabs, Inc, Beverly, MA) at 37°C for 1 hour
following manufacturer's instructions. As control, 100 µL of
extracts were also treated following manufacturer's instructions, but
in the absence of endo H. An equal volume of 2X SDS-loading buffer was
then added to each sample. The proteins were separated on 4-12%
SDS-PAGE gradient gels (Novex) for analysis by immunoblotting using the
rabbit polyclonal anti-Kell antibody as in above.
Cell surface biotinylation.
Two days after transfection, 5 × 106 cells were
washed three times with PBS. The cells were then harvested and coated
for 30 minutes with 3 mL of 1 mg/mL Sulfo-NHS-LC-Biotin (Pierce
Chemical Co, Rockford, IL) at 4°C. After three washes with PBS
containing 20 mmol/L glycine and one wash with PBS alone, the cells
were lysed by suspension in lysis buffer (PBS containing 1% Triton X-100 10 µg/mL of aprotonin and 1 mmol/L phenylmethylsulfonyl fluoride) for 10 minutes on ice. The nuclei and cell debris were pelleted by centrifugation at 12,000 rpm for 15 minutes. ImmunoPure Immobilized Streptavidin (Pierce Chemical Co) was then added at one
tenth of the volume and the sample was incubated with gentle mixing at
4°C for 2 hours. The bound complexes were then washed five times
with lysis buffer and then eluted with SDS-loading buffer. The proteins
were separated by 4-12% SDS-PAGE gradient gels (Novex) for analysis by
immunoblotting using the rabbit polyclonal anti-Kell antibody as in
above. To control and ensure for comparable levels of biotinylation in
the different samples, immunoblotting was performed using ImmunoPure
Streptavidin horseradish peroxidase-conjugated antibody (Pierce
Chemical Co) (data not shown). To control for equal amounts of protein
in each lane, immunoblotting with anti- tubulin (Sigma, St Louis,
MO) was performed.
| |
RESULTS |
Expression of wild-type and variant Kell constructs.
Using a panel of alloantibodies that included patient and donor sera
with specificities of anti-K, anti-Kpb, and
anti-Jsb, the 293T transfected with wild-type Kell cDNA was
found to express the corresponding antigens (see below), indicating
that the correct conformation of the Kell protein was maintained.
By site-directed mutagenesis, point mutations associated with K,
Kpa, Jsa antigens were introduced into the
wild-type Kell expression construct. Each construct was transfected
separately into 293T cells and the antithetical antigen expression
profile was compared in the mutant and wild-type Kell transfected cells
(see below). Moreover, the expression of other Kell antigens was also
analyzed to ensure that the correct conformation of the variant Kell
proteins was maintained (see Materials and Methods).
K/k polymorphism.
We first tested the reactivity of sera from donors containing
alloanti-k (n = 2) or alloanti-K (n = 3) on cells transfected with the
cDNA encoding the K allele (for representative histograms, see
Fig 1). We found that, as had been
demonstrated using MoAbs, the sera containing anti-K specifically
detected the variant Kell protein that contained the amino acid
substitution encoded by the point mutation C698T associated with the K
antigen.6
View larger version (25K):
[in this window]
[in a new window]
| Fig 1.
Expression analysis of K/k polymorphism. Flow cytometric
analysis of 293T cells transiently transfected either with the
wild-type Kell cDNA construct (pRc/CMV-wt) encoding the high incidence
antigen k or with the Kell cDNA encoding the C698T mutation associated
with K antigen (pRc/CMV-K). Antigen-positive RBCs were tested in
parallel to control for antibody specificity. Alloimmune sera used were
anti-k (GUE) and anti-K (6735416). The results are depicted as overlays
of open histograms to represent negative control mock/RBCs and shaded
histograms, representing positive control RBCs or transfected cells.
Mean fluorescence intensity (as a measure of antibody binding) in log
scale is on the x-axis and the relative number of cells is represented
on the y-axis.
|
|
Kpa/Kpb polymorphism.
Alloanti-Kpa (n = 3) specifically detected cells
transfected with cDNA encoding the amino acid substitution Arg281Trp,
while alloanti-Kpb (n = 3 that had reacted with the
wild-type Kell) did not detect the mutant protein (for representative
histograms, see Fig 2). This confirmed that
the presence of C or T at position 961 was sufficient to give rise to
the expression of Kpb or Kpa antigens,
respectively.
View larger version (26K):
[in this window]
[in a new window]
| Fig 2.
Expression analysis of Kpa/ Kpb
polymorphism. Flow cytometric analysis of 293T cells transiently
transfected either with pRc/CMV-wt encoding the high incidence antigen
Kpb or with the Kell cDNA encoding the C961 to T mutation
associated with Kpa antigen (pRc/CMV-Kpa).
Alloimmune sera used were anti-Kpb (RAU) and
anti-Kpa (JH).
|
|
Jsa/Jsb polymorphism.
Using anti-Jsa (n = 2) and anti-Jsb (n = 2), we found that the introduction of a single point T1910C
mutation into the Kell gene was sufficient to allow expression of
Jsa as detected by anti-Jsa (which did not
detect the wild-type Kell protein), and the expressed protein was
unreactive with anti-Jsb (for representative histograms,
see Fig 3).
View larger version (27K):
[in this window]
[in a new window]
| Fig 3.
Expression analysis of Jsa/Jsb
polymorphism. Flow cytometric analysis of 293T cells transiently
transfected either with pRc/CMV-wt encoding the high incidence antigen
Jsb or with the Kell cDNA encoding the T1910 to C mutation
associated with Jsa antigen (pRc/CMV-Jsa).
Alloimmune sera used were anti-Jsb (NM) and
anti-Jsa (AM).
|
|
Two low incidence antigens on a single Kell protein.
To date, RBCs that carry two low incidence antigens on a single Kell
protein have not been observed. To test whether this may be due to
conformational constraints on the Kell protein, we created a Kell
double mutant that encodes two low incidence antigens (K and
Jsa) on a single Kell protein. This expression vector was
introduced into 293T cells and tested for the simultaneous surface
expression of K and Jsa antigens. Using flow cytometry, we
found that the transfected cells were detected by anti-Jsa
(n = 2) and anti-K (n = 2) and were no longer reactive with
anti-Jsb (n = 2) or anti-k (n = 2) (see
Fig 4, for representative histograms). This
indicates that a single Kell protein can express the two low incidence
antigens K and Jsa.
View larger version (31K):
[in this window]
[in a new window]
| Fig 4.
Surface expression of two low incidence antigens on a
single Kell protein. Flow cytometric analysis of 293T cells transiently
transfected with the Kell cDNA encoding mutations responsible for K and
Jsa antigens (pRc/CMV-K/Jsa). Alloimmune sera
used were anti-Jsa (AM), and anti-K (6735416),
Jsb (NM), and anti-k (GUE).
|
|
Weakening of Kell antigens in Kpa transfectants.
Whereas it is not possible to compare the reactivity of antibodies with
antithetical antigens (such as Kpa/Kpb), it is
possible to compare the expression levels of high incidence Kell
antigens on the different RBC phenotypes. Classically, the Kpa RBC phenotype has been shown to cause weakening
of high incidence Kell system antigens on the same Kell molecule as
assayed by serological methods. Similarly, by flow cytometry, we
found that whereas the Kpa antigen expression was readily
detected by anti-Kpa (Fig 2), there was over a twofold
depression of every other high incidence Kell antigen tested including
K14, Jsb, and k in Kp(a+b) RBCs as compared with
wild-type or Kp(abc+) RBCs (for K14 expression levels,
see Table 1). Interestingly, a comparable level of depression of (high
incidence) Kell antigens was also observed in 293T cells transfected
with the mutant construct encoding the Kpa antigen, but not
with cells transfected with wild-type (pRc/CMV wt) or Kpc
(pRc/CMV Kpc) encoded plasmids (Table 2). In fact, none of
the other mutant constructs (pRc/CMV-Jsb, pRc/CMV-K, or
pRc/CMV-K/Jsa) showed this depression of Kell antigens
(data not shown). Because we have used heterologous regulatory
sequences (ie, the CMV promoter) and the cDNA to express
Kpa, these results confirm that sequences outside of the
coding region of the KPA gene or incorrect splicing events are
not responsible for the weakening of Kell antigens in Kp(a+) RBCs.
Therefore, these data strongly suggest that the reduction in the Kell
antigens in the Kp(a+) RBCs is at the posttranscriptional level.
Immunoblotting.
To determine the levels of Kell protein in RBC membranes of Kell
variants, proteins extracted from RBCs were tested by immunoblotting with a polyclonal anti-Kell (see Materials and Methods). A specific band of apparent molecular weight of 93 kD, characteristic of Kell
glycoprotein, was detected with both wild-type and Kp(a+) RBC membrane
preparations, but the intensity of the band was reduced in the Kp(a+)
RBC membranes (in Fig 5A, compare lanes 2 and 3). This shows that the depression of Kell antigens in
Kp(a+) RBCs is due to a reduced amount of Kell glycoprotein at the cell
surface and not due to conformational/folding defect of the Kell
protein that leads to inaccessibility to Kell antibodies.
View larger version (28K):
[in this window]
[in a new window]
| Fig 5.
Immunoblotting of Kell protein in RBCs and transfectants.
(A) RBC membrane preparations were separated on a 4-12% gradient
SDS-PAGE under reducing conditions and immunoblotted with a polyclonal
anti-Kell (see Materials and Methods). Lane 1, Kell null RBCs; lane 2, Kp(b+) (wt) RBCs; lane 3, Kp(a+) RBCs. (B) Protein extracts from
293T transfected cells and RBC membrane preparations were separated on
SDS-PAGE under reducing conditions and immunoblotted with the
polyclonal anti-Kell. Lane 1, mock-transfected cells; lane 2, Kp(a+)
RBCs; lane 3, Kp(b+) (wt) RBCs; lane 4, cells transfected with
pRc/CMV-wt Kell; lane 5, cells transfected with
pRc/CMV-Kpa; lane 6, cells transfected with
pRc/CMV-Kpc. The amount of protein loaded in lanes 1, 2, and 3 in (A) was threefold more than in (B) lanes 2 and 3.
|
|
Because mature RBCs lack internal organelles, it is only possible to
assess the properties of the cell surface-associated Kell protein in an
RBC "ghost" preparation. To compare the characteristics of the
variant Kell glycoproteins in cells with intact intracellular organelles, extracts from mock, wild-type and Kpa
transfected cells were analyzed by immunoblotting (Fig 5B, lanes 1, 4, and 5). As control, cells expressing the Kpc antigen, which
is associated with amino acid substitution Arg281Gln in the same codon
as that of Kpa, were also analyzed (Fig 5B, lane 6).
Interestingly, expression of wild-type Kell, Kpa, and
Kpc yielded two species (Fig 5B, lanes 4 through 6, upper
and lower). However, the amount of the upper species in protein
extracts of the Kpa transfectant was barely detectable (Fig
5B, lane 5). Moreover, the upper species appeared to comigrate with
Kell protein extracted from RBCs (Fig 5B, compare lane 3 with lanes 4 through 6).
Endo-H treatment of transfected cells.
Because there are five potential N-glycosylation sites in the Kell
protein, it may be that the two species in the Kell transfectants have
different N-glycan moieties and/or are localized in different intracellular compartments. To address this possibility, we treated wild-type Kell and Kpa transfectants with endoglycosidase H
(endo-H) (Fig 6). Endo-H cleaves
"high-mannose," but not "complex" oligosaccharide chains from proteins.23 Conversion from high-mannose to complex
oligosaccharides occurs in the medial Golgi through the addition of
N-acetylglucosamine to trimmed carbohydrate chains.24 After
endo-H digestion, there was a shift in mobility of the lower Kell
species corresponding to removal of N-linked glycans, from both
wild-type and Kpa-transfected cell extracts (endo-H
sensitive) (in Fig 6, compare lanes 2 and 3 with lanes 5 and 6). Thus,
the N-glycans of this Kell species are not processed, suggesting that
the lower species are retained in a pre-medial Golgi compartment. In
contrast, the upper species were endo H-resistant (Fig 6) and by
inference, they have reached the medial Golgi. Together these data
strongly suggest that the Kpa mutation results in the
aberrant transport of Kell protein to the cell surface.
View larger version (49K):
[in this window]
[in a new window]
| Fig 6.
Endo-H treatment of wild-type Kell and
Kpa-transfected cell extracts. Cell extracts from
mock-transfected cells (lanes 1 and 4) and cells transfected with
pRC/CMV-wt Kell (lanes 2 and 5) or pRC/CMV-Kpa (lanes 3 and
6) were treated with (lanes 4 through 6) or without endo H (lanes 1 through 3), separated on SDS-PAGE and immunoblotted with the polyclonal
anti-Kell.
|
|
Surface biotinylation of transfected cells.
To determine whether the upper Kell species, which are endo-H
resistant, are present at the cell surface, we performed surface biotinylation studies on wild-type and Kpa expressing
transfected cells. As shown in Fig 7, only
the upper Kell bands were detected in the biotinylated fractions, ie,
the cell surface-associated fractions (in Fig 7, lanes 4 and 5).
Moreover, there was considerably less of these upper species in
Kpa-expressing transfected cells than in the wild-type
Kell-expressing transfectants (Fig 7, compare lanes 4 and 5), as had
been observed in Kp(a+) RBC membrane preparation (Fig 5). The lower,
endo-H sensitive bands were only present in the nonbiotinylated
fractions (Fig 7, lanes 7 and 8) and absent from the surface-labeled
fraction. This is consistent with their presence in an intracellular
compartment.
View larger version (45K):
[in this window]
[in a new window]
| Fig 7.
Surface biotinylation of wild-type Kell and
Kpa transfectants. 293T cells transfected with pRc/CMV-wt
(WT) (lanes 2, 5, and 7), pRc/CMV-Kpa (Kpa)
(lanes 3, 4, and 8) and mock (MOCK) (lanes 1, 6, and 9) were surface
biotinylated and the protein extracts immunoprecipitated using
streptavidin beads, separated on SDS-PAGE, and immunoblotted with the
polyclonal anti-Kell or with anti- tubulin to control for equal
amounts of protein in each lane. Total extract refers to cell extracts
lysed in Triton X-100 before immunoprecipitation with the streptavidin
beads. Biotinylated fraction is the streptavidin immunoprecipitated
fraction and therefore constitutes the cell surface-associated
proteins. Nonbiotinylated fraction represents the components in the
lysed cell extract that was not immunoprecipitated with the
streptavidin beads.
|
|
| |
DISCUSSION |
We have established a heterologous Kell expression system with similar
antigenic properties as the native RBCs and were able to conclusively
show that a single point mutation introduced into the wild-type
KEL gene is solely responsible for expression of the low
incidence antigens: K, Kpa, and Jsa. Thus, the
molecular genotyping of these antigens can be restricted to the
analysis of the point mutations alone. Furthermore, because the point
mutations lead to either the loss or gain of a restriction enzyme
site,6 PCR-based restriction fragment length polymorphism (RFLP) assays can be used for genotyping of the three clinically significant antithetical Kell antigens: K/k,
Kpa/Kpb, and Jsa/Jsb.
Despite a deliberate search, a Kell protein that carries two low
incidence antigens has not been described.9 In this report, we have shown that two low incidence antigens can be expressed on the
same Kell protein. This demonstrates that the failure to encode more
than one low incidence antigen on a single Kell protein is not due to
conformational constraints on the protein, as previously thought, but
rather is a consequence of statistical improbability of two rare
genetic events occurring on a single chromosome.
We found that the weakening of Kell antigens in Kp(a+) RBCs can be
explained by the presence of a reduced level of the Kell protein at the
cell surface, rather than inaccessibility of the antigens to Kell
antibodies. In addition, because the cDNA was used to express
Kpa, events that cause reduced expression due to genomic
regulatory sequences (such as incorrect splicing or transcriptional
regulation) can be ruled out. Because Kell is a highly folded
glycoprotein, the Arg (charged, basic amino acid) to Trp (noncharged
bulky aromatic amino acid) substitution that gives rise to the
Kpa antigen could interfere with the biosynthetic folding
of the Kell protein and, therefore, may not be transported to the cell surface. Consistent with this, we found that in
Kpa-transfected cells where the weakening of Kell antigens
as seen in RBCs is mimicked, most of the steady state Kell protein is retained within the cell (see below).
Kell protein extracted from wild-type transfectants migrates as two
species in SDS-PAGE, whereas the RBC membrane Kell protein runs as a
single band. As demonstrated by surface biotinylation studies, the
upper, endo-H-resistant species of the Kell transfectants is present
at the cell surface and appears to comigrate with the RBC membrane Kell
protein and probably represents the form of protein that is present in
the native RBC membrane. By contrast, the lower species of the Kell
transfectants were absent from surface biotinylated fractions and were
endo-H-sensitive. Because there is no precedent for endo- H-sensitive
N-glycosylated protein species that are transported to the cell
surface, it is inferred that these lower species never reach the cell
surface, and pulse-chase experiments can be performed to firmly confirm
this. Thus, the lower species could represent the immature form(s) of
Kell glycoprotein, which are retained in an intracellular compartment,
most probably in the endoplasmic reticulum (ER). In Kpa
transfectants, most of the glycosylated Kell species are endo H-sensitive. Because mature Kell protein is highly folded with five
potential N-linked glycans, it is conceivable that the quality control
mechanisms in the ER25 would ensure that misfolded Kell species are not deployed to the cell surface. This is unlike the molecular basis of previously studied blood group variants [one type
of Co(ab) and Fyx RBCs] where protein
instability rather than defects in protein trafficking are responsible
for reduced expression. Thus, in Colton null [Co(ab)]
blood group variant, although the mutation (P38L) does not alter the
initial level of the CHIP protein synthesis, it affects the
glycosylation of the mutant polypeptide and the amount of protein
within the cell decreases over time.5 Similarly, the
missense mutation responsible for the weak Duffy phenotype (Fyx) does not result in the retention of the Duffy protein
in an intracellular compartment, but rather it affects the steady state level of protein.4
Interestingly, Kpc antigen expression, which is associated
with an amino acid substitution to glutamine (polar, uncharged) in the
same codon as Kpa,14 does not result in
weakening of other Kell antigens on Kp(c+) RBCs.26
Consistent with this, we found similar levels of Kell protein and
antigens in Kpc-transfected cells as in wild-type Kell
transfectants. Analysis of the crystal structure of Kell will be needed
to explain why Arg281Trp and not Arg281Gln has such a drastic effect on
the Kell glycoprotein.
Kell is associated with Kx protein in RBC
membranes.17,27,28 In McLeod phenotype RBCs where the Kx
protein is absent, there is a depression of all Kell
antigens.7 Based on these observations, it is possible that
the Kell protein may be dependent on Kx for transport to the cell
surface. However, heterologous cell surface expression of the common
Kell protein in several cell lines has been shown not to require
Kx,6,17,29,30 indicating that transport of Kell protein to
the plasma membrane does not require heterologous expression of Kx.
Alternatively, it may be that these Kell expression systems expressed
endogenous Kx or Kx-related protein. In our heterologous system, all
Kell cDNAs tested were expressed at levels comparable to those seen in
RBCs and were correctly folded as determined by the expression of
several conformational antigens. Moreover, cotransfection with an
XK-expressing plasmid vector did not enhance the expression of the Kell
antigens even in the context of the Kpa mutation (data not
shown). However, these results do not rule out the possibility that
there is endogenous Kx or Kx-related protein in the 293 cells and that
the failure of these cells to transport Kpa-encoded Kell
protein may be due to abnormal interaction with Kx. Coprecipitation
experiments to test the interaction of Kx and Kell in Kp(a+) RBCs and
transfectants are required to test this possibility.
It is interesting that anti-Kpa may sometimes be of high
titer and cause HDN in infants.7,31 Thus, the
amino acid substitution responsible for Kpa is immunogenic
because even in the presence of reduced levels of protein, Kp(a+) RBCs
can induce an immune response to this particular antigen. Further
molecular studies to understand the processing of Kell protein and
structure of the Kpa antigen are required to address this point.
| |
ACKNOWLEDGMENT |
We are grateful to Ruth Croson-Lowney and Jan Visser for assistance
with some of the flow cytometric analyses. We also thank Colvin Redman
and Christine Lomas-Francis for critically reading the manuscript and
Robert Ratner for preparing the manuscript and figures.
| |
FOOTNOTES |
Submitted November 3, 1998; accepted March 1, 1999.
Supported in part by Grant No. HL54459 from the National Institutes of
Health Specialized Center of Research (SCOR).
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Karina Yazdanbakhsh, PhD, Immunochemistry
Laboratory, New York Blood Center, 310 E 67th St, New York, NY 10021;
e-mail: kyazdan{at}nybc.org.
| |
REFERENCES |
1.
Reid ME, Yazdanbakhsh K:
Molecular insights into blood groups and implications for blood transfusions.
Curr Opin Hematol
5:93, 1998[Medline]
[Order article via Infotrieve]
2.
Tournamille C, Le VK, Gane P, Le Pennec PY, Roubinet F, Babinet J, Cartron JP, Colin Y:
Arg89Cys substitution results in very low membrane expression of the Duffy antigen/receptor for chemokines in Fyx individuals.
Blood
92:2147, 1998[Abstract/Free Full Text]
3.
Reid ME, Rios M, Roye K, Chaudhuri A, Pogo O, Yazdanbakhsh K, Coghlan G, Kosower N, Parasol N:
Molecular basis of Fyx.
Transfusion
38:102S, 1998 (suppl, abstr)
4.
Yazdanbakhsh K, Yu Q, Powell VI:
Reduced expression of the Duffy chemokine receptor in the weak Fyb (Fyx) phenotype is due to a mutation (Arg89Cys) of a conserved residue in the chemokine receptor superfamily.
Blood
92:671a, 1998 (suppl 1, abstr)
5.
Preston GM, Smith BL, Zeidel ML, Moulds JJ, Agre P:
Mutations in aquaporin-1 in phenotypically normal humans without functional CHIP water channels.
Science
265:1585, 1994[Abstract/Free Full Text]
6.
Lee S:
Molecular basis of Kell blood group phenotypes.
Vox Sang
73:1, 1997[Medline]
[Order article via Infotrieve]
7.
Issitt PD, Anstee DJ:
Applied Blood Group Serology. Durham, NC, Montgomery, 1998.
8.
Vaughan JI, Manning M, Warwick RM, Letsky EA, Murray NA, Roberts IAG:
Inhibition of erythroid progenitor cells by anti-Kell antibodies in fetal alloimmune anemia.
N Engl J Med
338:798, 1998[Abstract/Free Full Text]
9.
Race RR, Sanger R:
Blood Groups in Man. Oxford, England, Blackwell, 1975.
10.
Lee S, Zambas ED, Marsh WL, Redman CM:
Molecular cloning and primary structure of Kell blood group protein.
Proc Natl Acad Sci USA
88:6353, 1991[Abstract/Free Full Text]
11.
Lee S, Lin MH, Farmar JG, Cao Y, Redman CM:
Kell blood group protein proteolytically cleaves vasoactive peptides.
Blood
92:4a, 1998 (suppl 1, abstr)
12.
Daniels G:
Human Blood Groups. Oxford, UK, Blackwell, 1995.
13.
Øyen R, Halverson GR, Reid ME:
Review: Conditions causing weak expression of Kell system antigens.
Immunohematology
13:75, 1997
14.
Lee S, Wu X, Son S, Naime D, Reid M, Okudo Y, Sistonen P, Redman C:
Point mutations characterize KEL10, the KEL3, KEL4, and KEL21 alleles, and the KEL17 and KEL11 alleles.
Transfusion
36:490, 1996[Medline]
[Order article via Infotrieve]
15.
Nichols ME, Rosenfield RE, Rubinstein P:
Monoclonal anti-K14 and anti-K2.
Vox Sang
52:231, 1987[Medline]
[Order article via Infotrieve]
16.
Nichols ME, Rubinstein P, Barnwell J, Rodriguez de Cordoba S, Rosenfield RE:
A new human Duffy blood group specificity defined by a murine monoclonal antibody. Immunogenetics and association with susceptibility to Plasmodium vivax.
J Exp Med
166:776, 1987[Abstract/Free Full Text]
17.
Russo D, Redman C, Lee S:
Association of XK and Kell blood group proteins.
J Biol Chem
273:13950, 1998[Abstract/Free Full Text]
18.
Vallette F, Mege E, Reiss A, Adesnik M:
Construction of mutant and chimeric genes using the polymerase chain reaction.
Nucleic Acids Res
17:723, 1989[Abstract/Free Full Text]
19.
Lee S, Wu X, Reid ME, Zelinski T, Redman C:
Molecular basis of the Kell (K1) phenotype.
Blood
85:912, 1995[Abstract/Free Full Text]
20.
Lee S, Wu X, Reid ME, Redman C:
Molecular basis of the K:6,-7 [Js(a+b-)] phenotype in the Kell blood group system.
Transfusion
35:822, 1995[Medline]
[Order article via Infotrieve]
21.
Liou HC, Sha WC, Scott ML, Baltimore D:
Sequential induction of NF-kappa B/Rel family proteins during B-cell terminal differentiation.
Mol Cell Biol
14:5349, 1994[Abstract/Free Full Text]
22.
Dodge JT, Mitchell C, Hanahan DJ:
The preparation and chemical characteristics of hemoglobin-free ghosts of human erythrocytes.
Arch Biochem Biophys
100:119, 1963[Medline]
[Order article via Infotrieve]
23.
Tarentino AL, Maley F:
Purification and properties of an endo-beta-N-acetylglucosaminidase from Streptomyces griseus.
J Biol Chem
249:811, 1974[Abstract/Free Full Text]
24.
Kornfeld R, Kornfeld S:
Assembly of asparagine-linked oligosaccharides.
Annu Rev Biochem
54:631, 1985[Medline]
[Order article via Infotrieve]
25.
Kopito RR:
ER quality control: The cytoplasmic connection.
Cell
88:427, 1997[Medline]
[Order article via Infotrieve]
26.
Kikuchi M, Endo N, Seno T, Okubo Y, Yamaguchi H:
A Japanese family with two Kp(a-b-c+) members, presumed genotype Kpc/K0.
Transfusion
23:254, 1983[Medline]
[Order article via Infotrieve]
27.
Carbonnet F, Hattab C, Collec E, Le Van Kim C, Cartron JP, Bertrand O:
Immunochemical analysis of the Kx protein from human red cells of different Kell phenotypes using antibodies raised against synthetic peptides.
Br J Haematol
96:857, 1997[Medline]
[Order article via Infotrieve]
28.
Khamlichi S, Bailly P, Blanchard D, Cartron J-P, Bertrand O:
Purification and partial characterization of the erythrocyte Kx protein deficient in McLeod patients.
Eur J Biochem
228:931, 1995[Medline]
[Order article via Infotrieve]
29.
Russo DCW, Lee S, Reid M, Redman CM:
Topology of Kell blood group protein and the expression of multiple antigens by transfected cells.
Blood
84:3518, 1994[Abstract/Free Full Text]
30.
Yazdanbakhsh K, Chaudhuri A, Lee S, Reid ME:
High level expression of blood group antigens in erythroid cells.
Mol Biol Cell
8S:292a, 1997 (abstr)
31.
Smoleniec J, Anderson N, Poole G:
Hydrops fetalis caused by a blood group antibody usually undetected in routine screening.
Arch Dis Child
71:F216, 1994
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
H. D. Moulding, R. L. Martuza, and S. D. Rabkin
Clinical Mutations in the L1 Neural Cell Adhesion Molecule Affect Cell-Surface Expression
J. Neurosci.,
August 1, 2000;
20(15):
5696 - 5702.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L.-C. Yu, Y.-C. Twu, C.-Y. Chang, and M. Lin
Molecular Basis of the Kell-null Phenotype. A MUTATION AT THE SPLICE SITE OF HUMAN KEL GENE ABOLISHES THE EXPRESSION OF KELL BLOOD GROUP ANTIGENS
J. Biol. Chem.,
March 23, 2001;
276(13):
10247 - 10252.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Lee, D. C. W. Russo, A. P. Reiner, J. H. Lee, M. Y. Sy, M. J. Telen, W. J. Judd, P. Simon, M. J. Rodrigues, T. Chabert, et al.
Molecular Defects Underlying the Kell Null Phenotype
J. Biol. Chem.,
July 13, 2001;
276(29):
27281 - 27289.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION