|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 10 (November 15), 1999:
pp. 3358-3365
Correction of X-Linked Immunodeficient Mice by Competitive
Reconstitution With Limiting Numbers of Normal Bone Marrow Cells
By
Jurg Rohrer and
Mary Ellen Conley
From the Department of Immunology, St Jude Children's Research
Hospital, Memphis, TN; and the Department of Pediatrics, University of
Tennessee, Memphis, TN.
 |
ABSTRACT |
Gene therapy for inherited disorders is more likely to succeed if
gene-corrected cells have a proliferative or survival advantage compared with mutant cells. We used a competitive reconstitution model
to evaluate the strength of the selective advantage that Btk normal
cells have in Btk-deficient xid mice. Whereas 2,500 normal bone
marrow cells when mixed with 497,500 xid cells restored serum
IgM and IgG3 levels to near normal concentrations in 3 of 5 lethally
irradiated mice, 25,000 normal cells mixed with 475,000 xid
cells reliably restored serum IgM and IgG3 concentrations and the
thymus-independent antibody response in all transplanted mice.
Reconstitution was not dependent on lethal irradiation, because
sublethally irradiated mice all had elevated serum IgM and IgG3 by 30 weeks postreconstitution when receiving 25,000 normal cells.
Furthermore, the xid defect was corrected with as few as 10%
of the splenic B cells expressing a normal Btk. When normal donor cells
were sorted into B220+/CD19+ committed B
cells and B220 /CD19 cell populations,
only the B220/CD19 cells provided
long-term B-cell reconstitution in sublethally irradiated mice. These
findings suggest that even inefficient gene therapy may provide
clinical benefit for patients with XLA.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
MUTATIONS IN THE cytoplasmic tyrosine
kinase Btk are responsible for the xid phenotype in mice and
X-linked agammaglobulinemia (XLA) in humans.1-7 Although
Btk is expressed in all blood cells except T cells and plasma
cells,1,2,8-10 adverse effects of mutations in this enzyme
are restricted to the B-cell lineage.11-16 Cross-linking of
a variety of B-cell surface receptors, including (and perhaps most
importantly) the antigen receptor complex,17-25 can
activate and phosphorylate Btk, but the exact mechanisms by which
mutations in Btk result in the failure of normal B-cell development are
not well understood.
Defects in Btk have more severe consequences in the human compared with
the mouse. Patients with XLA have profound hypogammaglobulinemia affecting all isotypes, an absence of antigen-specific antibodies, and
less than 1% of the normal number of B cells.12,26-29 Bone marrow studies in these patients show normal numbers of pro-B cells but
markedly reduced numbers of pre-B cells.15 By contrast, mice with defects in Btk, both knock out mice that do not express Btk
and CBA/N (xid) mice that have a spontaneously occurring single amino acid substitution in the pleckstrin homology domain of Btk, have
decreased concentrations of serum IgM and IgG3 but normal concentrations of IgG1, IgG2a, and IgG2b.5-7,16 These mice
fail to make antibodies to some T-cell-independent antigens but they have normal or near normal titers of antibody to T-cell-dependent antigens. The number of splenic B cells in Btk deficient mice is
decreased to 30% to 50% of normal, and there is an absence of a
mature B-cell population. However, the numbers of B-cell precursors and
immature B cells are normal. It is not clear why mutations in Btk cause
a less severe block in B-cell differentiation in the mouse compared
with the human, but it is likely that genetic factors play a role.
Although mice that are null for CD40 or the nude gene have normal
numbers of B cells, mice that are doubly mutant for Btk and CD40 or
nu/nu have less than 5% of the normal number of peripheral B
cells.30-32
Mice with mutations in Btk can act as useful models to evaluate new
strategies for treatment of patients with XLA. As a prelude to studies
directed toward gene therapy, several Btk transgenes have been bred
into Btk deficient mice.33-35 In one model, murine Btk cDNA
transcription was driven by an Ig enhancer and
promoter.33,36 Xid or Btk / mice with
1 copy of this transgene had approximately 25% of the normal amount of
Btk as analyzed by Western blot, whereas those with 2 copies had 50%
of the normal amount of Btk.36 Mice with either 1 or 2 copies of the transgene had normal numbers of mature splenic B cells,
but they had antibody responses to TNP-Ficoll and serum concentrations
of IgM and IgG3 that were significantly decreased compared with
wild-type controls but improved compared with xid controls.
Drabek et al34 have shown correction of Btk-deficient mice
by a human Btk cDNA transgene with regulatory elements from the murine
major histocompatibility complex (MHC) class II region. Like the
transgene driven by the Ig enhancer and promoter described above, this
transgene was not expressed before the pre-B-cell stage of
differentiation. In addition, it was expressed in thymic epithelium,
activated T cells, monocytes, and at low levels in other tissues.
Western blot analysis of splenic lysates from Btk-deficient mice
carrying the human Btk transgene demonstrated approximately the same
amount of Btk protein as those from wild-type mice. These studies
indicate that tight regulation of Btk expression is not required for
correction of serum concentrations of IgM and IgG3, the capacity to
make antibody to T-cell-independent antigens, or the development of
normal numbers of mature B cells. Further, ectopic expression of Btk
does not appear to be deleterious. These studies provide support for
the possibility that gene therapy for XLA may be a realistic goal.
Current techniques for introducing therapeutic genes into hematopoietic
stem cells tend to be inefficient.37,38 However, studies in
lethally irradiated xid mice reconstituted with equal mixtures
of xid and wild-type marrow indicate that B-cell precursors with normal Btk have a selective advantage in proliferation or survival
over Btk-deficient precursors.39 Four months after transplantation, B cells but not other cell lineages are derived exclusively from the normal donor. Studies in women or mice that are
heterozygous for the defect in Btk yield similar results. All of the B
cells in carrier females are derived from precursors that have the
normal X chromosome, the one not bearing the Btk defect, as the active
X.13,14,40-42 To examine the strength of the selective
advantage that B-cell precursors with normal expression of Btk might
have over Btk-deficient cells, we treated lethally or sublethally
irradiated xid mice with xid bone marrow supplemented with limiting numbers of bone marrow cells from a wild-type donor and
monitored production of IgM, IgG3, and antigen-specific antibody.
| |
MATERIALS AND METHODS |
Mice.
CBA/N (xid) and CBA/J (wild-type) mice, which were initially
obtained from The Jackson Laboratory (Bar Harbor, ME), were bred and
maintained at the St. Jude Children's Research Hospital Animal Research Center (Memphis, TN). The CBA/N and CBA/J strains diverged from the CBA/Ca background approximately 50 years ago (~120
generations). The only known difference between the strains is the
xid mutation in the CBA/N strain. Only male mice were used in
the reconstitution experiments, and recipients and donors were
age-matched and used between the ages of 5 to 6 weeks. A
137Cs source was used to irradiate mice at a dose rate of
125 rad/min 24 hours before bone marrow transplant.
Preparation of cell suspensions for adoptive transfers and
semiquantitative polymerase chain reaction (PCR).
Mice were killed by cervical dislocation and bone marrow cells were
flushed from tibias and femurs with phosphate-buffered saline (PBS)
supplemented with 5% heat-inactivated fetal calf serum (FCS; JRH
Biosciences, Lenexa, KS). After passing the suspension through a
70-µm filter, cells were counted, washed, and resuspended in PBS for
injection into xid recipient mice via the lateral tail vein.
For the cell sorting experiments, spleens were harvested into RPMI
media supplemented with 5% heat-inactivated FCS and crushed to a
single-cell suspension between the frosted ends of 2 microscope slides.
Red blood cells were lysed in an equal volume of Gey's solution
(0.83% ammonium chloride, 0.1% potassium bicarbonate) for 10 minutes
at room temperature, and the remaining lymphocytes were washed and
resuspended in staining buffer (PBS, 1% bovine serum albumin [BSA],
0.1% sodium azide). Bone marrow cells were harvested as described
above and resuspended in PBS only. Both samples were blocked for 10 minutes in 10% normal mouse serum, at which time spleen cells were
stained with phycoerythrin-conjugated anti-B220 and fluorescein
isothiocyanate-conjugated anti-Thy 1.2 (Pharmingen, La Jolla, CA).
Stained cells were washed twice in staining buffer and sorted into
B-cell and T-cell populations using a Becton Dickinson FACStar-plus
cell sorter (Palo Alto, CA). For all sorted spleen samples, the purity
of the sorted B- and T-cell populations was greater than 95%, with
less than 2% contaminating cells. Bone marrow cells were stained with
phycoerythrin-conjugated anti-B220 and fluorescein
isothiocyanate-conjugated anti-CD19 (Pharmingen), washed twice in PBS,
and sorted as above. The purity of the
B220+/CD19+ population was 95.5% pure, with
3.4% contaminating B220/CD19
cells. Similarly, the purity of the
B220/CD19 population was 95.8%,
with 0.5% contaminating B220+/CD19+ cells.
Serum Ig detection and immunizations.
To determine serum Ig concentrations, mice were bled via the
retro-orbital plexus and samples were spun at 4°C for 15 minutes in
a micro-centrifuge. Plasma was collected and stored in aliquots at
80°C, and total serum IgM and IgG3 antibody concentrations were determined by sandwich enzyme-linked immunosorbent assay (ELISA).
Ninety-six-well maxisorp plates (NUNC, Roskilde, Denmark) were coated overnight at 4°C with 50 µL of 10 µg/mL polyclonal anti-IgM or anti-IgG3 (Southern Biotechnology Associates, Birmingham, AL). Plates were washed with PBS supplemented with 0.05% Tween 20 and
blocked with a 3% BSA solution in PBS for 2 hours at room temperature.
After 3 washes, diluted plasma samples were added to the coated wells
for overnight incubation at 4°C. Plasma samples were serially
diluted in wash buffer supplemented with 0.5% BSA. After overnight
incubation, plates were washed and polyclonal alkaline
phosphatase-conjugated anti-IgM or anti-IgG3 (Southern Biotechnology
Associates) was added to the wells at 1 µg/mL and left at room
temperature for 2 hours. The phosphatase substrate, p-Nitrophenyl
phosphate (Sigma, St Louis, MO), was dissolved in 100 mmol/L Tris, 100 mmol/L sodium chloride, 5 mmol/L magnesium chloride, and 10%
diethanolamine, pH 9.5, and added to the plates for 30 minutes, at
which time the OD405 was measured on a Bio-Rad microplate
reader (Richmond, CA). Antibody concentrations were calculated by using
purified mouse IgM and IgG3 antibodies (Southern Biotechnologies) as
standards. The levels of detection for serum IgM and IgG3 were 1 µg/mL and 3 µg/mL, respectively.
To measure the T-cell-independent immune response, mice were immunized
with 50 µg NP-Ficoll (Biosearch Technologies, Novato, CA) in PBS
injected intraperitoneally. Plasma samples were obtained 10 days
postimmunization and NP-specific antibody titers were determined by
ELISA. Plates were coated with 10 µg/mL NP-BSA (Biosearch Technologies, Novato, CA), and diluted serum samples were assayed as
described above. Antibody titer was calculated as the fold increase
compared with the average preimmunization titers of the normal CBA/J
control mice.
Semiquantitative PCR.
DNA was extracted from freshly isolated bone marrow cells and sorted
splenic B cells and T cells using the QIAamp tissue kit (Qiagen,
Valencia, CA). Genomic PCR primers GACTGTGGAAGAAGGAGC and
GGCATAGAGTGAGTTCTTAC were used to amplify Btk exon 2 from 200 ng of
genomic DNA in the presence of 32P using the following
cycling conditions: 95°C for 45 seconds, 60°C for 1 minute, and
72°C for 1 minute, repeated 15 times. The xid mutation, a C
to T transition in exon 2 of Btk, results in the loss of a Hha
I restriction site, making it possible to distinguish between the
wild-type and xid alleles by digesting the 558-bp PCR product
with Hha I (New England Biolabs, Beverly, MA). For the
wild-type allele, 3 fragments of 222, 45, and 291 bp are seen, whereas
the xid allele gives 2 fragments of 222 and 336 bp. Fragments were separated on a 6% polyacrylamide gel; the gel was dried and exposed to x-ray film or a storage phosphor screen (Molecular Dynamics,
Eugene, OR) for quantitation of signal strength using the Molecular
Dynamics phosphorimager and imagequant software. By comparing the
intensity of the wild-type-specific 291-bp fragment with that of the
common 222-bp fragment, the degree of chimerism was calculated in the
reconstituted mice. The sensitivity of the assay was determined by
preparing known mixtures of xid and wild-type genomic DNA, with
the percentage of wild-type DNA in the mixtures being 0.1%, 0.5%,
1%, 5%, 10%, and 50%. The lowest dilution of normal DNA that still
gave a signal in the reaction was 0.5%.
| |
RESULTS |
Restoration of B-cell function in xid mice can be achieved with 25,00 or fewer normal cells.
The strength of the selective advantage of B-cell precursors with
normal Btk over those with mutant Btk was examined in a murine model in
which lethally irradiated (900 rad) CBA/N xid mice with mutant
Btk were reconstituted with xid bone marrow supplemented with
limiting numbers of cells from an MHC-matched, closely related strain
of mice with normal Btk, CBA/J. The importance of the ratio of normal
to mutant precursors versus the absolute number of normal precursors
was evaluated by infusing xid mice with 5.0 × 106 or 0.5 × 106 cells of which either
5% or 0.5% were from the CBA/J wild-type donor. Five mice were
included in each group, and mice were analyzed individually. Serum
concentrations of IgM and IgG3, the isotypes most severely affected by
the Btk mutation, were measured at 6-week intervals.
Xid mice that received 250,000 (5% of 5.0 × 106) bone marrow cells from the wild-type control CBA/J
mice demonstrated an increase in serum IgM by 6 weeks posttransplant
and by 12 weeks after the transplant all of the mice had serum IgM
concentrations that were within the normal range seen in the untreated
CBA/J control mice (Fig 1A). These mice
maintained their elevated IgM levels to 30 weeks posttransplant, at
which stage the average concentration was 286.8 ± 35.5 µg/mL
compared with 327.1 ± 40.1 µg/mL for the wild-type controls and
32.5 ± 7.8 µg/mL for the xid control mice. Mice that
received 25,000 wild-type cells, either as 0.5% of 5.0 × 106 cells or as 5% of 0.5 × 106 cells,
were very similar to the mice receiving 250,000 wild-type cells,
although there was a slight delay in IgM production in mice that
received 0.5% of the total bone marrow cells as wild-type cells. By 30 weeks posttransplant, the 0.5% group had an average serum IgM
concentration of 219.1 ± 58.2 µg/mL and the 5% group averaged
274.3 ± 32.1 µg/mL. In contrast, mice that received 2,500 cells
(0.5% of 0.5 × 106) showed a variable response.
Three of the mice demonstrated an increase in serum IgM such that by 30 weeks after transplant the concentration of IgM was 30% to 90% of
normal (164.7 ± 86.0 µg/mL). The remaining 2 mice did not differ
from the untreated xid mice 54.6 ± 29.7. The concentrations
of serum IgG3 followed a similar trend. At 6 weeks posttransplant, the
concentrations of IgG3 were similar to the untreated xid
control; however, in the mice that received at least 25,000 wild-type
cells, an increase in IgG3 was seen by 12 weeks after the transplant
and by 18 weeks after transplant, and the concentrations of IgG3 were
within the normal range seen in control mice with normal Btk. By 30 weeks posttransplant, mice that received 250,000 wild-type cells had
201.8 ± 72.9 µg/mL serum IgG3 compared with 187 ± 92.6 µg/mL for the wild-type and 9.8 ± 5.1 µg/mL for the xid
controls. Similarly mice that received 25,000 normal cells as 0.5% of
5 × 106 or 5% of 0.5 × 106 had
239.0 ± 110.6 µg/mL and 192.8 ± 66.5 µg/mL, respectively. In the group of mice that received 2,500 wild-type bone marrow cells,
the 3 mice that demonstrated an increase in IgM also showed an increase
in IgG3 (67.0 ± 37.2 µg/mL). The remaining 2 mice in this group
were similar to the Btk mutant xid mice (10.5 ± 5.1 µg/mL). These findings indicate that relatively small numbers of
wild-type cells can have a significant effect on serum Ig
concentrations.
View larger version (27K):
[in this window]
[in a new window]
| Fig 1.
Serum IgM (A) and IgG3 (B) concentrations in
reconstituted and control mice measured at 6-week intervals
postreconstitution. Time (in weeks) postreconstitution is on the x-axis
and Ig concentration in micrograms per milliliter is on the y-axis. The
stippled area represents the range seen in 9 CBA/J normal control mice
and the ( ) denotes the CBA/N xid control levels (5 mice).
For the reconstituted mice that were all lethally irradiated (900 rad,
5 mice per group), ( ) and ( ) denote mice that received 5.0 × 106 total cells, of which 5% or 0.5% were normal,
respectively; ( ) corresponds to mice that received 0.5 × 106 total cells, of which 5% were normal; ( ) indicates
the 3 responding mice that received 0.5 × 106 total
cells, of which 0.5% were normal, and (*) shows the 2 mice in this
group that did not have significantly increased serum IgG3.
|
|
Xid mice are unresponsive to the T-cell-independent antigen
NP-Ficoll; therefore, this antigen was chosen to evaluate the correlation of serum Ig concentrations with the capacity to make antibody after antigen challenge. Mice were injected intraperitoneally with NP-Ficoll 18 weeks posttransplant, and 10 days later, NP-specific antibodies were measured by ELISA. As shown in
Fig 2, all transplanted mice that achieved
IgM and IgG3 concentrations within the normal range made IgM anti-NP
titers equivalent to those seen in the CBA/J control mice. Of the mice
that received 2,500 wild-type cells, the 3 with the highest
concentrations of serum IgM and IgG3 had anti-NP titers that were above
those seen in the xid control but below those seen in the
wild-type mice.
View larger version (15K):
[in this window]
[in a new window]
| Fig 2.
Measurement of the serum IgM response against the
T-cell-independent antigen NP-Ficoll. Results are for individual mice
with () the preimmunization titer and ( ) the postimmunization
titer. All titers were normalized to the average preimmunization titer
obtained for the CBA/J control mice. Groups 1 and 2 received 5.0 × 106 total cells, of which 5% or 0.5% were normal,
respectively, whereas groups 3 and 4 received 0.5 × 106
total cells, of which 5% or 0.5% were normal, respectively. Responses
seen in xid (xid) and wild-type (WT) control mice are
indicated.
|
|
Lethal irradiation is not required for successful engraftment of
donor cells.
There are significant medical risks associated with the intense
chemotherapy or lethal irradiation required for most types of bone
marrow transplantation. Gene therapy is a more realistic goal if gene
correction can occur in the absence of life-threatening ablative
therapy. To evaluate the requirements for lethal irradiation, recipient
xid mice were exposed to 900, 450, 200, 100, 50, or 0 rad and
reconstitution by competitive B-cell repopulation was monitored as
before. All mice received a total of 0.5 × 106 cells,
of which 25,000 (5%) were from wild-type CBA/J donors. By 12 weeks
postreconstitution, mice that were exposed to 450 or 200 rad had serum
IgG3 concentrations equivalent to the control group that had received
900 rad (Fig 3A). However, mice exposed to
100, 50, or 0 rad were not significantly different from xid controls. By 18 weeks postreconstitution, some of the mice in the
groups that had received either 100 or 50 rad had achieved normal
concentrations of IgG3. This trend continued until 30 weeks posttransplant, when 3 mice in the group that had received 50 rad and 1 mouse in the group that had received 0 rad demonstrated IgG3
concentrations within the normal range. A subset of mice, ie, the mice
that were exposed to 450, 100, or 50 rad, were maintained for 42 weeks
after transplant to permit evaluation of the persistence of the
reconstitution. At that time, all of the mice, including the mice that
received 50 rad, had IgG3 concentrations within the normal range. As in
the previous experiments, the concentrations of IgM correlated with the
concentrations of IgG3 and the increase in IgM generally preceded the
increase in IgG3 (data not shown).
View larger version (26K):
[in this window]
[in a new window]
| Fig 3.
The effect of reduced radiation on serum IgG3
reconstitution at 12, 18, 24, and 30 weeks posttransplant (A) and on
the response to the T-cell-independent antigen NP-Ficoll (B) is shown.
Concentrations are given in micrograms per milliliter and the radiation
doses are indicated on the x-axis. All mice received 0.5 × 106 total cells, of which 5% were normal. WT, normal CBA/J
mice; xid, CBA/N mice. Each group contained 5 mice, except for
the xid controls, which contained 4 mice.
|
|
The lethally and sublethally irradiated mice were immunized with
NP-Ficoll 18 weeks after bone marrow reconstitution. The mice exposed
to 450 rad developed NP-specific antibody titers comparable to both the
lethally irradiated recipient control group and to the wild-type CBA/J
control group (Fig 3B). Only 1 of the 5 mice exposed to 200 rad had a
normal response to NP-Ficoll. This was not the mouse with the highest
concentration of serum IgG3. None of the mice that received lower doses
of irradiation developed antibody to NP-Ficoll.
Long-term B-cell repopulation requires an undifferentiated precursor.
The delay in the onset of IgG3 production and the persistence of normal
concentrations of Igs for 30 to 40 weeks after transplantation suggested that reconstitution was due to the engraftment of
undifferentiated B-cell precursors. To examine this question,
sublethally irradiated (450 rad) xid recipients were
transplanted as before with a total of 0.5 × 106 bone
marrow cells, of which 5% or fewer were derived from CBA/J mice and
the remaining cells were from CBA/N xid mice. The wild-type cells were sorted into B220+/CD19+ cells and
B220/CD19 cells, and the sorted
cells were added to the xid bone marrow in numbers
proportionate to the percentage of those cells in 25,000 unsorted
cells. In 1 group of mice, the sorted cells were pooled to mimic the
original unsorted population of cells. The mice that received the
B220/CD19 cells developed an
increase in the concentration of serum IgG3 (89.4 ± 44.9 µg/mL at
30 weeks) that was almost identical to that seen in the mice receiving
the pooled cells (88.8 ± 25.1 µg/mL at 30 weeks) and similar to
those that received unsorted cells (147.0 ± 53.4 µg/mL at 30 weeks; Fig 4). By contrast, the mice that
received B220+/CD19+ cells were
indistinguishable from xid controls (9.4 ± 2.1 µg/mL and
11.0 ± 9.9 µg/mL, respectively). The relative decrease in the
concentration of serum IgG3 in the mice that received the B220+/CD19+ cells or the pooled sorted cells
compared with the unsorted cells may be attributed to the effects of
the manipulation required for the sort.
View larger version (37K):
[in this window]
[in a new window]
| Fig 4.
Functional B-cell reconstitution requires engraftment of
an undifferentiated precursor. The stippled area represents the normal
range for 9 wild-type CBA/J mice, and xid controls (5 mice) are
denoted by (). All mice were exposed to a sublethal dose of 450 rad
and then transplanted with 0.5 × 106 cells, of which 5%
were normal. () Mice that received unsorted wild-type cells; ()
mice that received the uncommitted,
B220/CD19, wild-type cells; () mice
that received committed B220+/CD19+
wild-type B cells; and () mice that received the pooled fractions of
committed and uncommitted wild-type cells. Each experimental group
contained 5 mice.
|
|
Functional B-cell reconstitution can be achieved when as few as 10%
of peripheral B cells express normal Btk.
In the lethally irradiated mice, one might expect the percentage of
cells in the bone marrow with normal Btk to be similar to the
percentage of wild-type cells in the reconstituting bone marrow
infusion; however, it was not clear whether all of the peripheral blood
B cells would have normal Btk in the mice that had demonstrated
complete reconstitution of IgM and IgG3 concentrations as well as
normal antibody responses to NP-Ficoll. To address this question,
genomic DNA was extracted from bone marrow cells and B220+
splenic B cells 30 weeks after transplantation. A semiquantitative PCR
was used to distinguish wild-type Btk from Btk with the xid mutation. The xid mutation, a C to T transition in exon 2 of
Btk, results in the loss of a Hha I restriction site;
therefore, this region of the gene was amplified by PCR and the 558-bp
product was digested with Hha I. The xid allele
demonstrated 222- and 336-bp fragments, whereas the wild-type allele
gave fragments of 222, 45, and 291 bp. By comparing the intensity of
the wild-type specific 291-bp fragment with that of the common 222-bp
fragment, the degree of chimerism was calculated in the reconstituted mice.
As expected, in lethally irradiated mice, the percentage of bone marrow
cells with normal Btk mirrored the percentage of CBA/J cells in the
initial bone marrow infusion. In xid mice that received 5 × 106 cells, of which 5% were from the Btk normal
donor, 4% of the cells had normal Btk (Fig
5). Similarly, in mice that received the same total number of cells but
of which only 0.5% were from the wild-type CBA/J mice, approximately
1% of the cells had normal Btk. However, in splenic B cells, there was
a marked increase in the percentage of cells with wild-type Btk,
ranging from 40% in mice that received 250,000 wild-type cells to 10%
in mice that had received 25,000 wild-type cells. This corresponds to
an approximate 10-fold enrichment for B cells with normal Btk in the
spleen compared with the bone marrow (ie, an increase from 4% to 40%
and an increase from 1% to 10%, respectively).
View larger version (24K):
[in this window]
[in a new window]
| Fig 5.
Semiquantitative PCR analysis was used to determine the
proportion of wild-type Btk-containing cells in the bone marrow ()
and in purified B cells from the spleen (). Groups 1 through 3 were
lethally irradiated (900 rad) and received either 5.0 × 106 total cells (groups 1 and 2) or 0.5 × 106
total cells (group 3), of which either 5% (groups 1 and 3) or 0.5%
(group 2) were wild-type. Groups 4 through 8 received reducing amounts
of radiation of 450, 200, 100, 50, or 0 rad, respectively, and all mice
received 0.5 × 106 total cells, of which 5% were normal.
Five mice were included in each experimental group. Values represent
the average for each group ± standard deviation. In groups 2 through
8, all of the mice had between 0.1% and 1% normal Btk in the bone
marrow.
|
|
In mice that were sublethally irradiated and received 0.5 × 106 total cells of which 5% were wild-type, the percentage
of bone marrow cells with normal Btk was approximately 0.5% in mice
that were exposed to 450 or 200 rad and at the level of detection in mice that were exposed to less than 200 rad. By contrast, B cells with
normal Btk constituted 16% of the splenic B cells in mice that
received 450 rad, 6% of the B cells in mice that received 200 rad, and
3% in mice that received 100 rad. Between 0.1% and 0.5% wild-type
Btk was seen in the splenic B cells from mice exposed to less than 100 rad. These results demonstrate that normal concentrations of IgM and
IgG3 and normal responses to NP-Ficoll could be achieved in mice that
had as few as 10% of the B cells expressing normal Btk.
| |
DISCUSSION |
The results of this report provide strong support for the hypothesis
that the selective advantage of B-cell precursors with normal Btk over
those with mutant Btk can be used to provide clinical benefit to
patients with mutations in Btk, patients with XLA. Lethally and sublethally irradiated Btk-deficient xid mice
predictably developed normal concentrations of IgG3 and the ability to
make antibodies to NP-Ficoll when they received 25,000 unmanipulated wild-type bone marrow cells along with 475,000 syngeneic bone marrow
cells to provide hematopoietic recovery. As few as 2,500 wild-type
cells altered B-cell function in 3 of 5 lethally irradiated xid
mice. An increase in serum Igs was first detected 6 weeks after marrow
infusion and was persistent until the end of the experiment, 30 to 40 weeks postinfusion. In unirradiated mice and mice that received very
low doses of irradiation, there was a slow increase in the
concentration of serum Igs after the infusion of 25,000 wild-type bone
marrow cells, such that by 30 weeks after the infusion, all of the mice
that were exposed to 50 rad and half of the unirradiated mice
demonstrated IgG3 concentrations higher than those seen in the
xid controls.
The identity of the cells responsible for reconstitution in this model
was addressed by separating bone marrow cells into those expressing
cell surface markers characteristic of precursors committed to the
B-cell lineage, CD19 and B220, and those that were negative for these
markers. The mice that received cells that did not express the
B-cell-specific markers demonstrated an increase in IgG3 concentration
that was similar to that seen in mice that received unmanipulated
cells, whereas the mice that received committed B cells had IgG3 levels
comparable to the untreated xid controls. This demonstrates
that the reconstituting cells are derived from immature precursors, but
it does not clarify whether the reconstituting cells are multipotent
stem cells that could give rise to all hematopoietic lineages or
whether there might be self-renewing precursors that are restricted to
the B-cell lineage. Studies that have examined the phenotype and
frequency of bone marrow stem cells with long-term multilineage
potential have estimated that these cells occur with a frequency of
less than 1 in 10,000 to 20,000.43,44 Our ability to
provide long-term increases in IgM and IgG3 in xid mice with as
few as 2,500 cells argues for a progenitor that occurs with a higher
frequency but a more restricted potential.45,46
Others have shown reconstitution of B-cell function in xid
mice; however, these studies have usually evaluated immune function shortly after reconstitution or they examined mice receiving large numbers of wild-type cells. Quintans et al47 treated
unirradiated mice carrying the xid mutation with 20 × 106 normal splenic B cells and demonstrated the acquisition
of the ability to make an antiphosphocholine antibody 2 weeks later. In
another set of experiments, Quan et al48 demonstrated that 20 × 106 neonatal liver cells could reconstitute
unirradiatated xid males, whereas mice that were exposed to 300 rad could be reconstituted with 106 normal neonatal liver
cells. These investigators noted that reconstitution of xid
mice was influenced by 4 variables: (1) the number of normal cells
infused, (2) the irradiation dose, (3) the time after transplantation, and (4) the specific antigen used to evaluate the immune response. Our
results emphasize the importance of the first 3 variables and suggest
that the fourth variable might be expanded to indicate that
reconstitution may vary depending on the method used to evaluate alterations in B-cell function. Serum Ig concentrations were a sensitive indicator of improved B-cell function, but an increase in
serum IgM and IgG3 was not always associated with the ability to make
antibody to NP-Ficoll.
The delay in production of IgG3 in this model may be explained, at
least in part, by the absence of a selective advantage for precursors
with normal Btk at the earliest stages of B-cell differentiation in the
mouse.7 The expansion of the B cells or B-cell precursors
with normal Btk may occur at varying stages of B-cell differentiation
depending on the circumstances. This may help explain why mice that
were lethally irradiated and received very low numbers (2,500) of
normal donor bone marrow cells had low concentrations of IgG3 but
detectable antibody to NP-Ficoll, whereas the animals that received
25,000 donor cells but low doses of irradiation (<200 rad) had low
concentrations of IgG3 but no antibody to NP-Ficoll. In the lethally
irradiated mice, there may have been expansion of very early precursors
that may have permitted a broad antibody repertoire even in animals
with low concentrations of IgM and IgG3. In contrast, the B-cell
expansion may have occurred at a later stage of differentiation in the
mice that received little or no irradiation. As a result, these mice may have a more limited antibody repertoire.
Because the block in B-cell differentiation in humans with defects in
Btk is earlier and more severe than the block seen in mice with defects
in the same gene, the selective advantage for B-cell precursors with
normal Btk would presumably be stronger in the human compared with the
mouse. Our studies suggest that improvements in B-cell function may be
slow, but those improvements are likely to be long-lasting. The degree
of B-cell reconstitution required to provide clinical benefit to
patients with XLA is not clear. Some patients with XLA who have a
milder disease as characterized by slightly higher concentrations of
serum Igs or more B cells than expected usually have fewer
life-threatening infections, and some of these patients do well in the
absence of consistent gammaglobulin therapy.49-51
When compared with other genetic disorders for which gene therapy might
be considered, XLA appears to have several advantages. Tight regulation
of gene expression is not an absolute requirement, although it is
likely that maximum benefit will be achieved by strategies that mimic
endogenous expression.33-36 In contrast to patients with
adenosine deaminase deficiency or other forms of severe combined
immunodeficiency, patients with XLA could be maintained on routine
therapy, intravenous gammaglobulin, and prophylactic antibiotics during
reconstitution without compromising the success of treatment. Finally,
the strong selective advantage of gene corrected cells may permit
successful therapy even when gene correction is inefficient and the
patient has not received ablative therapy.
| |
FOOTNOTES |
Submitted March 10, 1999; accepted July 6, 1999.
Supported in part by National Institutes of Health Grant No. AI25129,
March of Dimes Grant No. FY97-0384, National Cancer Institute CORE
Grant No. P30 CA 21765, the Assisi foundation, the American Lebanese
Syrian Associated Charities, and funds from the Federal Express Chair
of Excellence.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Mary Ellen Conley, MD, St Jude Children's
Research Hospital, 332 N Lauderdale, Memphis, TN 38105; e-mail:
maryellen.conley{at}stjude.org.
| |
REFERENCES |
1.
Tsukada S, Saffran DC, Rawlings DJ, Parolini O, Allen RC, Klisak I, Sparkes RS, Kubagawa H, Mohandas T, Quan S, Belmont JW, Cooper MD, Conley ME, Witte ON:
Deficient expression of a B cell cytoplasmic tyrosine kinase in human X-linked agammaglobulinemia.
Cell
72:279, 1993[Medline]
[Order article via Infotrieve]
2.
Vetrie D, Vorechovsky I, Sideras P, Holland J, Davies A, Flinter F, Hammarstrom L, Kinnon C, Levinsky R, Bobrow M, Smith CIE, Bentley DR:
The gene involved in X-linked agammaglobulinemia is a member of the src family of protein-tyrosine kinases.
Nature
361:226, 1993[Medline]
[Order article via Infotrieve]
3.
Thomas JD, Sideras P, Smith CIE, Vorechovsky I, Chapman V, Paul WE:
Colocalization of X-linked agammaglobulinemia and X-linked immunodeficiency genes.
Science
261:355, 1993[Abstract/Free Full Text]
4.
Rawlings DJ, Saffran DC, Tsukada S, Largaespada DA, Grimaldi JC, Cohen L, Mohr RN, Bazan JF, Howard M, Copeland NG, Jenkins NA, Witte ON:
Mutation of unique region of Bruton's tyrosine kinase in immunodeficient XID mice.
Science
261:358, 1993[Abstract/Free Full Text]
5.
Kerner JD, Appleby MW, Mohr RN, Chien S, Rawlings DJ, Maliszewski CR, Witte ON, Perlmutter RM:
Impaired expansion of mouse B cell progenitors lacking Btk.
Immunity
3:301, 1995[Medline]
[Order article via Infotrieve]
6.
Khan WN, Alt FW, Gerstein RM, Malynn BA, Larsson I, Rathbun G, Davidson L, Muller S, Kantor AB, Herzenberg LA, Rosen FS, Sideras P:
Defective B cell development and function in Btk-deficient mice.
Immunity
3:283, 1995[Medline]
[Order article via Infotrieve]
7.
Hendriks RW, de Bruijn MF, Maas A, Dingjan GM, Karis A, Grosveld F:
Inactivation of Btk by insertion of lacZ reveals defects in B cell development only past the pre-B cell stage.
EMBO J
15:4862, 1996[Medline]
[Order article via Infotrieve]
8.
Genevier HC, Hinshelwood S, Gaspar HB, Rigley KP, Brown D, Saeland S, Rousset F, Levinsky RJ, Callard RE, Kinnon C, Lovering RC:
Expression of Bruton's tyrosine kinase protein within the B cell lineage.
Eur J Immunol
24:3100, 1994[Medline]
[Order article via Infotrieve]
9.
Smith CIE, Baskin B, Humire-Greiff P, Zhou J-N, Olsson PG, Maniar HS, Kjellén P, Lambris JD, Christensson B, Hammarström L, Bentley D, Vetrie D, Islam KB, Vorechovsky I, Sideras P:
Expression of Bruton's agammaglobulinemia tyrosine kinase gene, BTK, is selectively down-regulated in T lymphocytes and plasma cells.
J Immunol
152:557, 1994[Abstract]
10.
de Weers M, Verschuren MCM, Kraakman MEM, Mensink RGJ, Schuurman RKB, Van Dongen JJM, Hendricks RW:
The Bruton's tyrosine kinase gene is expressed throughout B cell differentiation from early precursor B cell stages preceding immunoglobulin gene rearrangement up to mature B cell stages.
Eur J Immunol
23:3109, 1993[Medline]
[Order article via Infotrieve]
11.
Pearl ER, Vogler LB, Okos AJ, Crist WM, Lawton IAR, Cooper MD:
B lymphocyte precursors in human bone marrow: An analysis of normal individuals and patients with antibody-deficiency states.
J Immunol
120:1169, 1978[Abstract/Free Full Text]
12.
Conley ME:
B cells in patients with X-linked agammaglobulinemia.
J Immunol
134:3070, 1985[Abstract]
13.
Conley ME, Brown P, Pickard AR, Buckley RH, Miller DS, Raskind WH, Singer JW, Fialkow PJ:
Expression of the gene defect in X-linked agammaglobulinemia.
N Engl J Med
315:564, 1986[Medline]
[Order article via Infotrieve]
14.
Fearon ER, Winkelstein JA, Civin CI, Pardoll DM, Vogelstein B:
Carrier detection in X-linked agammaglobulinemia by analysis of X-chromosome inactivation.
N Engl J Med
316:427, 1987[Abstract]
15.
Campana D, Farrant J, Inamdar N, Webster ADB, Janossy G:
Phenotypic features and proliferative activity of B cell progenitors in X-linked agammaglobulinemia.
J Immunol
145:1675, 1990[Abstract]
16.
Wicker LS, Scher I:
X-linked immune deficiency (xid) of CBA/N Mice.
Curr Top Microbiol Immunol
124:87, 1986[Medline]
[Order article via Infotrieve]
17.
de Weers M, Brouns GS, Hinshelwood S, Kinnon C, Schuurman RKB, Hendriks RW, Borst J:
B-cell antigen receptor stimulation activates the human Bruton's tyrosine kinase, which is deficient in X-linked agammaglobulinemia.
J Biol Chem
269:23857, 1994[Abstract/Free Full Text]
18.
Aoki Y, Isselbacher KJ, Pillai S:
Bruton tyrosine kinase is tyrosine phosphorylated and activated in pre-B lymphocytes and receptor-ligated B cells.
Proc Natl Acad Sci USA
91:10606, 1994[Abstract/Free Full Text]
19.
Sato S, Katagiri T, Takaki S, Kikuchi Y, Hitoshi Y, Yonehara S, Tsukada S, Kitamura D, Watanabe T, Witte O, Takatsu K:
IL-5 receptor-mediated tyrosine phosphorylation of SH2/SH3-containing proteins and activation of Bruton's tyrosine and Janus 2 kinases.
J Exp Med
180:2101, 1994[Abstract/Free Full Text]
20.
Kawakami Y, Yao L, Miura T, Tsukada S, Witte ON, Kawakami T:
Tyrosine phosphorylation and activation of Bruton tyrosine kinase upon Fc RI cross-linking.
Mol Cell Biol
14:5108, 1994[Abstract/Free Full Text]
21.
Matsuda T, Takahashi-Tezuka M, Fukada T, Okuyama Y, Fujitani Y, Tsukada S, Mano H, Hirai H, Witte ON, Hirano T:
Association and activation of Btk and Tec tyrosine kinases by gp130, a signal transducer of the interleukin-6 family of cytokines.
Blood
85:627, 1995[Abstract/Free Full Text]
22.
Kikuchi Y, Yasue T, Miyake K, Kimoto M, Takatsu K:
CD38 ligation induces tyrosine phosphorylation of Bruton tyrosine kinase and enhanced expression of interleukin 5-receptor alpha chain: synergistic effects with interleukin 5.
Proc Natl Acad Sci USA
92:11814, 1995[Abstract/Free Full Text]
23.
Kitanaka A, Mano H, Conley ME, Campana D:
Expression and activation of the nonreceptor tyrosine kinase Tec in human B cells.
Blood
91:940, 1998[Abstract/Free Full Text]
24.
Desiderio S:
Role of Btk in B cell development and signaling.
Curr Opin Immunol
9:534, 1997[Medline]
[Order article via Infotrieve]
25.
Satterthwaite AB, Li Z, Witte ON:
Btk function in B cell development and response.
Semin Immunol
10:309, 1998[Medline]
[Order article via Infotrieve]
26.
Lederman HM, Winkelstein JA:
X-linked agammaglobulinemia: An analysis of 96 patients.
Medicine
64:145, 1985[Medline]
[Order article via Infotrieve]
27.
Sideras P, Smith CIE:
Molecular and cellular aspects of X-linked agammaglobulinemia.
Adv Immunol
59:135, 1995[Medline]
[Order article via Infotrieve]
28.
Ochs HD, Winkelstein J:
Disorders of the B-cell system, in
Stiehm ER
(ed):
Immunologic Disorders in Infants and Children. Philadelphia, PA, Saunders, 1996, p 296
29.
Conley ME, Cooper MD:
Genetic basis of abnormal B cell development.
Curr Opin Immunol
10:399, 1998[Medline]
[Order article via Infotrieve]
30.
Wortis HH, Burkly L, Hughes D, Roschelle S, Waneck G:
Lack of mature B cells in nude mice with X-linked immune deficiency.
J Exp Med
155:903, 1982[Abstract/Free Full Text]
31.
Oka Y, Rolink AG, Andersson J, Kamanaka M, Uchida J, Yasui T, Kishimoto T, Kikutani H, Melchers F:
Profound reduction of mature B cell numbers, reactivities and serum Ig levels in mice which simultaneously carry the XID and CD40 deficiency genes.
Int Immunol
8:1675, 1996[Abstract/Free Full Text]
32.
Khan WN, Nilsson A, Mizoguchi E, Castigli E, Forsell J, Bhan AK, Geha R, Sideras P, Alt FW:
Impaired B cell maturation in mice lacking Bruton's tyrosine kinase (Btk) and CD40.
Int Immunol
9:395, 1997[Abstract/Free Full Text]
33.
Faust EA, Rawlings DJ, Saffran DC, Witte ON:
Development of btk transgenic mice.
Curr Top Microbiol Immunol
194:363, 1995[Medline]
[Order article via Infotrieve]
34.
Drabek D, Raguz S, De Wit TP, Dingjan GM, Savelkoul HF, Grosveld F, Hendriks RW:
Correction of the X-linked immunodeficiency phenotype by transgenic expression of human Bruton tyrosine kinase under the control of the class II major histocompatibility complex Ea locus control region.
Proc Natl Acad Sci USA
94:610, 1997[Abstract/Free Full Text]
35.
Maas A, Dingjan GM, Savelkoul HF, Kinnon C, Grosveld F, Hendriks RW:
The X-linked immunodeficiency defect in the mouse is corrected by expression of human Bruton's tyrosine kinase from a yeast artificial chromosome transgene.
Eur J Immunol
27:2180, 1997[Medline]
[Order article via Infotrieve]
36.
Satterthwaite AB, Cheroutre H, Khan WN, Sideras P, Witte ON:
Btk dosage determines sensitivity to B cell antigen receptor cross-linking.
Proc Natl Acad Sci USA
94:13152, 1997[Abstract/Free Full Text]
37.
Crystal RG:
Transfer of genes to humans: Early lessons and obstacles to success.
Science
270:404, 1995[Abstract/Free Full Text]
38.
Ross G, Erickson R, Knorr D, Motulsky AG, Parkman R, Samulski J, Straus SE, Smith BR:
Gene therapy in the United States: A five-year status report.
Hum Gene Ther
7:1781, 1996[Medline]
[Order article via Infotrieve]
39.
Sprent J, Bruce J:
Physiology of B cells in mice with X-linked immunodeficiency (xid) III. Disappearance of xid B cells in double bone marrow chimeras.
J Exp Med
160:711, 1984[Abstract/Free Full Text]
40.
Conley ME, Puck JM:
Carrier detection in typical and atypical X-linked agammaglobulinemia.
J Pediatr
112:688, 1988[Medline]
[Order article via Infotrieve]
41.
Nahm MH, Paslay JW, Davie JM:
Unbalanced X chromosome mosaicism in B cells of mice with X-linked immunodeficiency.
J Exp Med
158:920, 1983[Abstract/Free Full Text]
42.
Forrester LM, Ansell JD, Micklem HS:
Development of B lymphocytes in mice heterozygous for the X-linked immunodeficiency (xid) mutation: Xid inhibits development of all splenic and lymph node B cells at a stage subsequent to their initial formation in bone marrow.
J Exp Med
165:949, 1987[Abstract/Free Full Text]
43.
Osawa M, Hanada K-I, Hamada H, Nakauchi H:
Long-term lymphohematopoietic reconstitution by a single CD34-low/negative hematopoietic stem cell.
Science
273:242, 1996[Abstract]
44.
Szilvassy SJ, Humphries RK, Lansdorp PM, Eaves AC, Eaves CJ:
Quantitative assay for totipotent reconstituting hematopoietic stem cells by a competitive repopulation strategy.
Proc Natl Acad Sci USA
87:8736, 1990[Abstract/Free Full Text]
45.
Palacios R, Samaridis J:
Bone marrow clones representing an intermediate stage of development between hematopoietic stem cells and pro-T-lymphocyte or pro-B-lymphocyte progenitors.
Blood
81:1222, 1993[Abstract/Free Full Text]
46.
Carlsson L, Candeias S, Staerz U, Keller G:
Expression of Fc gamma RIII defines distinct subpopulations of fetal liver B cell and myeloid precursors.
Eur J Immunol
25:2308, 1995[Medline]
[Order article via Infotrieve]
47.
Quintans J, McKearn JP, Kaplan D:
B cell heterogeneity. I. A study of B cell subpopulations involved in the reconstitution of an X-linked immune defect of B cell differentiation.
J Immunol
122:1750, 1979[Abstract/Free Full Text]
48.
Quan ZS, Dick RF, Regueiro B, Quintans J:
B cell heterogeneity. II. Transplantation resistance in xid mice which affects the ontogeny of B cell subpopulations.
Eur J Immunol
11:643, 1981[Medline]
[Order article via Infotrieve]
49.
Saffran DC, Parolini O, Fitch-Hilgenberg ME, Rawlings DJ, Afar DEH, Witte ON, Conley ME:
A point mutation in the SH2 domain of Bruton's tyrosine kinase in atypical X-linked agammagobulinemia.
N Engl J Med
330:1488, 1994[Free Full Text]
50.
Bykowsky MJ, Haire RN, Ohta Y, Tang H, Sung SS, Veksler ES, Greene JM, Fu SM, Litman GW, Sullivan KE:
Discordant phenotype in siblings with X-linked agammaglobulinemia.
Am J Hum Genet
58:477, 1996[Medline]
[Order article via Infotrieve]
51.
Kornfeld SJ, Haire RN, Strong SJ, Tang H, Sung S-SJ, Fu SM, Litman GW:
A novel mutation (Cys145-stop) in Bruton's tyrosine kinase is associated with newly diagnosed X-linked agammglobulinemia in a 51-year-old male.
Mol Med
2:619, 1996[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
K. D. Bunting
XLA gene therapy turns a corner
Blood,
September 1, 2004;
104(5):
1236 - 1236.
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. W. Yu, R. S. Tabuchi, R. M. Kato, A. Astrakhan, S. Humblet-Baron, K. Kipp, K. Chae, W. Ellmeier, O. N. Witte, and D. J. Rawlings
Sustained correction of B-cell development and function in a murine model of X-linked agammaglobulinemia (XLA) using retroviral-mediated gene transfer
Blood,
September 1, 2004;
104(5):
1281 - 1290.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION