|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 10 (November 15), 1999:
pp. 3405-3412
Characterization of the Mouse von Willebrand Factor Promoter
By
Jiazhen Guan,
Pascale V. Guillot, and
William C. Aird
From the Department of Medicine, Divisions of Molecular Medicine and
Hematology-Oncology, Beth Israel Deaconess Medical Center, Boston, MA.
 |
ABSTRACT |
Expression of the von Willebrand factor (vWF) gene is restricted to
the endothelial and megakaryocyte lineages. Within the endothelium,
expression of vWF varies between different vascular beds. We have
previously shown that the human vWF promoter spanning a region between
 2182 (relative to the start site of transcription) and the end of
the first intron contains information for environmentally responsive,
vascular bed-specific expression in the heart, skeletal muscle, and
brain. In the present study, we cloned the mouse vWF (mvWF) promoter
and studied its function in cultured endothelial cells and transgenic
mice. In transient transfection assays, the mvWF gene was found to be
regulated by distinct mechanisms in different endothelial cell
subtypes. In independent lines of transgenic mice, an mvWF promoter
fragment containing DNA sequences between 2645 and the end of the
first intron directed endothelial cell-specific expression in the
microvascular beds of the heart, brain, and skeletal muscle as well as
the endothelial lining of the aorta. In 1 line of mice, reporter gene
activity was also detected in bone marrow megakaryocytes. Taken
together, these findings suggest that both the mouse and human vWF
promoters are regulated by vascular bed-specific mechanisms.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
ALL BLOOD VESSELS AND arteries
are lined with a continuous monolayer of endothelial cells. One feature
of the endothelium is its rich diversity of regional and organ-specific
phenotypes.1-3 This high degree of heterogeneity is
observed at morphological, structural, and functional levels as well as
in antigen composition and response to growth factors. Endothelial
diversity arises from the physiological adaptation of individual cells
to the surrounding environment. Indeed, the endothelium may be viewed
as a consortium of small enterprises of cells located within blood
vessels of different tissues. Although united in certain common
functions, each enterprise is uniquely adapted to meet the specific
demands of the local environment. The molecular basis of vascular
diversity is poorly understood; little is known about the mechanisms
that underlie the adaptive response of the endothelium to the
microenvironment. One approach to this problem is to study the
mechanisms underlying endothelial cell-specific gene regulation.
von Willebrand factor (vWF) is a multimeric glycoprotein that mediates
adhesion of platelets to the underlying endothelium and serves as a
carrier for the coagulation factor VIII.4,5 Expression of
the vWF gene is restricted to endothelial and megakaryocytic lineages.
Previous investigations have demonstrated the existence of regional
variations in vWF protein and mRNA levels within the vascular
tree.6-10 The vWF gene is therefore a marker of endothelial cell heterogeneity, and the elucidation of its transcriptional regulatory mechanisms may provide important insights into genetic programs that govern the production of vascular diversity.
In recent studies of transgenic mice,11-13 the human vWF
promoter was found to direct expression to discrete regions of the vascular tree. For example, a 733-bp sequence of the human vWF gene
contained information for expression in blood vessels of the
brain,11 whereas a larger promoter fragment containing
2,182 bp 5' flanking sequence, the first exon, and the first
intron also directed LacZ expression to the microvascular
endothelial cell lining of skeletal muscle and heart.12
Expression in the microvascular bed of the heart was shown to be
regulated by a cardiomyocyte-dependent signaling pathway.13
These results suggested that the vWF gene is regulated in a modular
fashion. According to this model, differential expression of vWF is
mediated not by the relative activity of a single transcriptional pathway, but rather by the sum of distinct vascular bed-specific signaling pathways, each beginning in the extracellular milieu and
ending at distinct regions of the promoter. However, an alternative explanation was that the mouse endothelium lacked the capacity to
activate the human promoter in an authentic pattern. To exclude the
existence of interspecies differences in vWF gene regulation, we have
cloned the mouse vWF (mvWF) promoter and tested its
function in transgenic mice. Under in vivo conditions, the mouse
promoter was found to direct cell type-specific expression in
subpopulations of endothelial cells within the heart, skeletal muscle,
brain, and aorta. The overlapping expression pattern of the mouse and human transgenes strongly suggest that the vWF gene is indeed regulated
by vascular bed-specific mechanisms.
| |
MATERIALS AND METHODS |
Library screening and DNA cloning.
A 300-bp polymerase chain reaction (PCR) amplicon, generated from
murine genomic DNA with oligonucleotides corresponding to exon 4-5 sequence, was used to screen a mouse ES cell P1 library (Genome Systems
Inc, St Louis, MO). Primer sequences used were sense 5'
CTCCGTGTATCTTGGGG and antisense 5' TAGGTAGAGTCCTTCGG. Three
separate P1 clones obtained from the screen were hybridized with a
32P-labeled probe spanning the 487 to +246 region of
the human vWF promoter under low stringency conditions. One of the 3 clones (P1-7910) that yielded a positive signal was digested with
Sac I, and the resulting DNA fragments were purified and cloned
into pUC19. Colonies containing mvWF promoter sequences were identified by low-stringency hybridization with a 32P-labeled probe
spanning the 487 to +246 region of the human vWF gene. Sequence
analysis of 1 of the positive clones (mvWF-pUC19-5) showed high
homology to the human vWF promoter and contained a region between
110 and +3000 bp relative to the transcriptional start site.
Additional radiolabeled DNA probes, generated from the 5' end of
the mvWF-pUC19-5 mouse sequence, were used to screen Pst
I-digested fragments of P1-7910 cloned into the pBluescript vector
(Stratagene, La Jolla, CA). One of these clones (pBlue-PP26) contained
mvWF promoter sequence between 2645 and +1092. For restriction
mapping, P1-7910 and E129 mouse tail-derived DNA was digested with
restriction enzymes, loaded on a 0.8% agarose gel, and transferred to
nylon membrane. The membrane was hybridized with
32P-labeled DNA probes, corresponding to sequences within
mvWF promoter. All sequences were determined using automated sequencing
technology on a Model 373A DNA (Perkin-Elmer Corp, Applied Biosystems
Division, Foster City, CA).
For transient transfections, various lengths of the mouse promoter were
inserted into the pGL2-Basic vector (Promega Corp, Madison, WI). To
generate the full-length PIE construct, mvWF-pUC19-5 was digested with
Spe I, blunt-ended with Klenow polymerase, and then digested
with Sac I. The 1.3-kb fragment containing promoter sequences
between 110 and +1257 was ligated into the Sac I and blunted Xho I sites of pGL2-Basic. A PCR-generated fragment
corresponding to the 3' end of the first intron was ligated into
the above-described plasmid digested with Nco I and
HindIII (blunt-ended with Klenow polymerase). To generate the
110 construct, a PCR-generated fragment was obtained (with the
following primers: sense, 5' TGTGGTTTGTCCAAACTCATCAAT; and
antisense, 5' TGCAATAGCTCCAAGTTGCCA), digested with Sac
I, and ligated into the Xho I (blunt-ended with Klenow
polymerase) and Sac I sites of pGL2-Basic. To generate the
110E construct, a PCR generated fragment was generated (with the
following primers: sense, 5' TGTGGTTTGTCCAAACTCATCAAT; and
antisense, 5' CTTGCCCATACAAACAGGGGC), digested with Sac
I, and ligated into the Xho I (blunt-ended with Klenow
polymerase) and Sac I sites of pGL2-Basic. To generate the P
and PE constructs, the 2.8-kb Sac I/Kpn I fragment of
pBlue-PP26 was ligated into Sac I/Kpn I sites of
110 and 110E, respectively. To generate the 110IE
construct, mvWF-pUC19-5 was digested with Spe I (blunted) and
Sac I. The mvWF fragment containing DNA sequence between
110 and +1258 was inserted into pGL2-Basic cut with Xho I (blunt-ended with Klenow polymerase) and Sac I. A
PCR-generated fragment spanning the 5' end of the first intron
was then inserted into the Nco I-HindIII sites of the
plasmid described above. All constructions are verified by dideoxy DNA sequencing.
To create the transgenic construct, mvWFlacZ, a
HindIII/Nco I fragment of mvWF-pUC19-5 was inserted
into a plasmid containing LacZ cDNA coupled to the SV40 poly(A)
tail (gift from Janet Rossant, Mount Sinai Hospital, Toronto, Ontario,
Canada). An Nco I-digested PCR-generated fragment corresponding
to the 3' end of the first intron was ligated into the
above-described plasmid digested with Nco I and Nru I
(blunt-ended with Klenow polymerase). In the final step, a 3.7-kb
Pst I fragment from pBlue-PP26 containing promoter sequences
2645 to +1092 was ligated into the above-described plasmid.
RNA isolation, primer extension, and reverse transcriptase-PCR
(RT-PCR).
Mouse tissue was harvested for total RNA using a guanidinium
thiocyanate phenol-chloroform single-step extraction (Stratagene). Primer extension analysis was performed using an antisense
oligonucleotide corresponding to the sequence from position
+114 to +153 of the mvWF gene (5'
AAGCCATTTTCCTCCTGCGCAACTGCTGGATGGATCTGCTCAG). The oligonucleotide was
end-labeled with [ -32P]ATP using polynucleotide kinase
and 5 × 105 counts/min were incubated with 20 µg
total RNA. The mixture was denatured at 80°C for 15 minutes and
annealed at 42°C in a reaction containing 50 µg total RNA, 50 mmol/L KCl, and 50 mmol/L Tris, pH 8.3, for 3 hours. First-strand
synthesis was performed with avian myleoblastosis virus
(AMV) reverse transcriptase (Promega Corp) and dNTP.
Samples were extracted with phenol chloroform/isoamyl alcohol and
precipitated with ethanol, and the reaction products were resolved on a
6% polyacrylamide denaturing gel. A dideoxy sequencing reaction of the
mvWF-pUC19-5 template was performed with the same primer and included
as size markers. Reactions were repeated from different RNA samples to
confirm the results. For RT-PCR, first-strand cDNA synthesis and PCR
reactions were performed as previously described.12 The
primers used were as follows: (A) 5' GCCATTGTTTCCCGCTGG; (B)
5' CCAGGGCTCTGTGGTGGC; (C) 5' CTTGGAGCTATTGCAGGCAG; (D)
CTTGACAGCAGGTCGGCTCA; and (E) 5' TGCCCATACAAACAGGGGCT.
Tissue culture and transient transfections.
Bovine aortic endothelial cells (BAEC) were generously provided by
Robert D. Rosenberg (Massachusetts Institute of Technology, Cambridge,
MA). Calf pulmonary endothelial cells (CPAE) were obtained from Vikas
Sukhatme (Beth Israel Deaconess Medical Center, Boston, MA). Py-4-1
endothelial cells, a cell line derived from hemangiomas of transgenic
mice expressing the polyoma early region gene, were a generous gift
from Victoria Bautch (University of North Carolina, Chapel Hill,
NC).14 NIH 3T3 cells (CRL-1658) and HEK 293 cells (CRL-1573) were obtained from the American Type Culture
Collection (Manassas, VA). All cells were maintained in
Dulbecco's modified Eagle's medium (DMEM; Life Technologies Inc,
Gaithersburg, MD) supplemented with 10% heat-inactivated fetal calf
serum (FCS; Life Technologies Inc) at 37°C and 5% CO2.
Luciferase reporter plasmids were introduced into cultured cells by
lipofectamine-mediated gene transfer (Life Technologies Inc). All
transfections were performed in triplicate. Cells were seeded at a
density of 25,000 to 50,000 cells per well in 12-well plates. At 60%
to 70% confluence, the cells were incubated with liposome:DNA
complexes containing 3 µL of lipofectamine and 1 µg of test plasmid
and 50 ng of a control plasmid containing the Renilla
luciferase reporter gene under the control of a cytomegalovirus (CMV) enhancer/promoter (Promega Corp). The transfection
mixture was replaced by regular growth medium 5 hours later.
Twenty-four hours later, cells were harvested and lysed according to
the dual-luciferase assay system (Promega Corp). Standard firefly and
Renilla luciferase activity were serially measured in a
luminometer (Lumat LB 9507 model; EG&G Berthold, Bad Wilbad,
Germany). Standard luciferase activity was normalized to
the activity of both the Renilla luciferase reporter gene and
the pGL2-Basic control plasmid.
Generation and analysis of transgenic mice.
The mvWFlacZ construct was digested with Not I and
Xho I, and the fragment containing the upstream promoter
region, the first exon, and intron coupled to LacZ was
separated from vector sequences through agarose gel electrophoresis, as
previously described.11 Microinjections of fertilized mouse
eggs and oviduct transfer techniques were performed as previously
described.11 Founder mice were identified by Southern blot
analysis and mated with wild-type FVB mice to generate stable lines of
transgenic mice.11 Tissues from F1 adult mice were perfused
with paraformaldehyde-containing solution, embedded in OCT compound,
and quickly frozen on dry ice. Frozen sections of 10 µm were
collected in a cryostat, attached to polylysine-coated slides, and
incubated in a solution containing 5-bromo-4-chloro-3-indolyl -D-galactopyranoside (X-Gal) for 24 hours
at 4°C as previously described.11
Accession number.
The DNA sequences that are reported in this manuscript have been
submitted to GenBank with accession no. AF152417.
| |
RESULTS |
Cloning and sequence analysis of the mvWF promoter.
To isolate the 5'-flanking region of the mvWF promoter, a mouse
ES cell P1 library was screened with a probe containing mouse exon 4/5
sequence. One of the 3 positive clones (P1-7910) was found to hybridize
with the human vWF probe comprising nucleotides 487 to +246.
Restriction mapping and Southern blot analysis of the P1 clone and E129
mouse tail-derived genomic DNA showed the organization of the mouse
promoter (Fig 1). A 3,000-bp Sac I
fragment containing 110 bp 5' flanking region, the first and
second exons, the first full intron, and part of the second intron was
subcloned into the pUC19 vector, and a 3,745-bp Pst I insert
containing sequences between 2645 and +1100 was subcloned into
the pBluescript vector. The resulting plasmids, designated mvWF-pUC19-5
and pBlue-PP26, respectively, were used for further analysis.
View larger version (33K):
[in this window]
[in a new window]
| Fig 1.
Structure of the mvWF promoter. (A) Restriction map of an
8-kb region of the mvWF gene is shown. Exons I and II are depicted as
thick and thin solid boxes, respectively. Introns and upstream promoter
sequence are represented by thin lines. Restriction enzymes are
Kpn I (K), Pst I (P), Nco I (N), EcoRI
(R), Xba I (X), Sac I (S), and EcoRV (RV). The
numbers shown are relative to the start site of transcription. (B)
Restriction fragments of P1 DNA or DNA derived from the tail of E129
mice were resolved on 0.8% agarose gel, transferred to a nylon
membrane, and then hybridized with a 32P-labeled probe
derived from sequences within the first exon.
|
|
The sequence of the upstream promoter region, the first 2 exons, and
the first intron of the mvWF gene was determined. As in the case of the
human and bovine vWF genes,15,16 the first exon encodes
5' untranslated sequences and the second exon contains the ATG
translational start site. Exons 1 and 2 are separated by an intron of
approximately 1,260 bp. The exon/intron boundaries are highly conserved
between mouse and human, and the splice donor and acceptor sites
conform with the GT and AT rule. The 5' flanking region contains
a TATA box that is identical to that of the human gene. Overall, the
sequence between 140 and the end of the first exon is 70%
conserved between mouse and human and 54% conserved between all 3 species (Fig 2). An upstream GATA-binding
site at 80 relative to the start site of transcription is
conserved in the mouse, human, and bovine promoters, whereas a
GATA-binding site at the 3' end of the first exon is conserved
only in the mouse and human promoters. Consensus sequences for SP1- and
Ets-binding sites are also present in the upstream promoter region of
the mouse gene. In addition, the 5' flanking region contains a
hexamer GAGCTC and a CA repeat between 1835 and 1804.
View larger version (38K):
[in this window]
[in a new window]
| Fig 2.
Nucleotide sequence of the mvWF promoter. Alignment of
the 5' flanking region and first exon of the mouse, human, and
bovine vWF genes. The numbers of the nucleotide sequence relative to
the start site of transcription are on the right. The transcriptional
start site is marked as +1. The TATA box is in bold. Potential
consensus sites for DNA-binding proteins in the 5' flanking
region and first exon are underlined. The upper strand represents the
mouse sequence (M), the middle strand the human sequence (H), and the
lower strand the bovine sequence (B).
|
|
Determination of the transcriptional start site of the mvWF promoter.
The transcriptional start site was mapped by reverse transcriptase
primer extension analysis. A radiolabeled antisense primer, corresponding to the sequences between +114 and +153, was used in
extension reactions with total RNA from mouse lungs. The major extension product was 153 bp in length and ended at an A residue (Fig 3A). This is identical to the
transcriptional start site reported for the human vWF gene. In
complementary studies, RT-PCR analyses were performed with mouse lung-
and heart-derived cDNA. Primer pairs that included sense primers
beginning 3' of the putative start site and an antisense primer
at +153 yielded PCR products of expected size, whereas primer pairs
derived from the 5' flanking region and first exon did not (Fig
3B).
View larger version (34K):
[in this window]
[in a new window]
| Fig 3.
Determination of the transcriptional start site of the
mvWF gene. (A) In primer extension assays, purified total RNA from
mouse lung tissue (lanes 1 and 2) was used as template. Primer
extension analysis was performed using a 32P-labeled
antisense oligonucleotide spanning the region between +114 and +153
and AMV reverse transcriptase. DNA size markers and a dideoxy
sequencing reaction of mvWF-pUC19-5 generated with the same primer are
included on the left. The arrow indicates the start site of
transcription. (B) In RT-PCR analyses, first-strand cDNA synthesis and
PCR reactions were performed with total RNA from mouse lung (lanes 2, 6, 9, and 12) and heart (lanes 3, 7, 10, and 14) tissue. P1-7910 DNA
template was included as a positive control (lanes 1, 5, 8, and 11). A
100-bp DNA ladder is shown in lanes 4 and 11. The location of the
primers relative to the transcriptional start site (depicted by an
asterisk) is shown above. The primer sequences are described in
Materials and Methods. PCR-generated fragments from cDNA were obtained
only with primer sets D-E (144 bp) and C-E (232 bp).
|
|
Functional analysis of the murine vWF promoter in transient
transfection assays.
To test the function of the upstream promoter region, the first exon,
and the first intron under in vitro conditions, the various promoter
fragments (Fig 4) were fused to the
luciferase reporter gene in pGL2-Basic, and the resulting constructs
were transiently transfected into cultured cells. The plasmid
constructs were cotransfected with a Renilla luciferase
reporter gene to control for transfection efficiency, and the
luciferase activity was further normalized to that of the promoterless
pGL2-Basic vector. The vWF promoter was active in NIH 3T3 and HEK 293 cells (Fig 4). The intron had enhancing activity in both cell types, particularly in the context of the 110 upstream promoter region. In general, the various vWF constructs expressed at higher levels in
endothelial cells compared with nonendothelial cells. In Py-4-1 endothelial cells, the intron contained significant enhancing activity
(9.6-fold), the first exon had no overall effect on expression levels,
and the 5' flanking region demonstrated a strong repressive activity in the context of the full-length promoter (Fig 4). In BAEC,
the first intron and first exon both had a moderate enhancing effect
(2.1- and 2-fold, respectively), whereas the 5' flanking sequence
had an overall repressing effect (1.9-fold). Finally, in CPAE, the
first intron had no effect, the first exon had a moderate enhancing
effect (1.8-fold), and the 5' flanking sequence served to repress
activity (1.7-fold).
View larger version (26K):
[in this window]
[in a new window]
| Fig 4.
Promoter activity of the mvWF 5' flanking region,
first exon, and first intron in various cell lines. The mvWF promoter
fragments were coupled to the luciferase reporter gene and named
according to the scheme shown (upper left). Nonendothelial cells (NIH
3T3 and HEK) and endothelial cells (Py-4-1, CPAE, and BAEC) were
transiently transfected with the mvWF luciferase constructs and
harvested 24 hours later for luciferase activity. The
results show the mean and standard deviation of luciferase light units
obtained in triplicate from 1 representative experiment. More
than 3 independent experiments were performed with each cell line.
Luciferase light units are corrected both for transfection efficiency
(as described in Materials and Methods) and for the activity of a
promoterless PGL2-Basic vector.
|
|
Functional analysis of the murine vWF promoter in transgenic mice.
A total of 6 independent lines of transgenic mice were generated with a
fragment of the mvWF promoter containing 2,645 bp 5' flanking
sequence, the first exon, and first intron. In 3 of these lines,
transgene expression was not detectable in any tissue. In the other 3 lines, the X-Gal reaction product was detected in a subpopulation of
endothelial cells of brain, heart, skeletal muscle, and aorta
(Fig 5A through E). In the brain, reporter
gene activity was detected in small- and medium-sized blood vessels. In
the heart and skeletal muscle, expression was limited to the endothelial cell lining of myocardial capillaries. The level of transgene expression, as judged by the degree of LacZ staining, varied slightly between the 3 lines. In 1 of the 3 expressing lines of
mice, the X-Gal reaction product was also detected in bone marrow
megakaryocytes (Fig 5F).
View larger version (77K):
[in this window]
[in a new window]
| Fig 5.
The mvWF LacZ transgene is expressed in a
vascular bed-specific pattern. LacZ staining of 10-µm tissue
sections from mvWFlacZ line no. 47 shows reporter gene activity
in endothelial cells of the heart (A), skeletal muscle (B), and brain
(D). An en face preparation of the thoracic aorta shows diffuse
LacZ staining of endothelial cells (C). A bone marrow aspirate
shows the X-Gal reaction product in megakaryocytes (F). There is no
detectable -galactosidase activity in other tissues (E shows lung).
The blue staining in the lung represents backgound.
|
|
| |
DISCUSSION |
The structural organization of the mouse, human, and bovine vWF
promoters, including the intron-exon boundaries, the length of the
first exon and first intron, and the sequence of the 5' flanking
region, is closely related. Several consensus sequences for
cis-acting elements are found in the immediate upstream
promoter region and first exon. Two GATA-binding consensus sequences,
located at positions 80 and +215 relative to the start site of
transcription, are conserved between the mouse and human vWF promoters.
The upstream GATA-binding site is also present in the bovine vWF
promoter. A palindromic hexamer GAGCTC at position 110 of the
mvWF gene is also found within the intronic enhancer of the endothelial cell-specific Tie-2 gene17 and is a putative binding site
for bZIP-related transcription factors.18 The poly(dG-dT)
· poly(dA-dC) elements that are present in the upstream promoter
region of the mvWF gene are also found in the human and bovine vWF
promoters15,16 as well in as the Tie-2 intronic
enhancer.17
Our understanding of the functional role of promoter elements in
mediating endothelial cell-specific expression is largely based on
transient transfection assays. For example, the human vWF promoter has
been shown to be regulated by a repressor-derepressor mechanism under
in vitro conditions. An NF1-binding site between 440 and
487 and an Oct-1-binding site between 133 and 125 were found to repress transcription in cultured endothelial and nonendothelial cell types, an effect that was offset in endothelial cells by a GATA-binding site within the first exon.19-21
Binding sites for other transcription factors, including
Sp1,22 NF -b,23 Ets-1,24 and
PEA-3,17 have been implicated in the regulation of
endothelial cell-specific genes. Of these, an Ets-1 motif in the
upstream promoter region has been shown to play a role in mediating
expression of the human vWF gene.25
In transient transfection assays, the mvWF promoter was found to be
regulated by different mechanisms in different endothelial cell types.
For example, the first exon conferred enhancing activity in bovine
aortic and pulmonary artery endothelial cells, but not in mouse-derived
Py-4-1 endothelial cells. On the other hand, sequences within the first
intron enhanced expression in Py-4-1 endothelial cells and bovine
aortic endothelial cells, but not in calf pulmonary endothelial cells.
It is tempting to speculate that these differences reflect biologically
relevant cell subtype-specific transcriptional control mechanisms that
are intrinsic to the cells. However, in keeping with current models of
endothelial cell gene regulation, we predict that the discordant
mechanisms represent variable degrees of phenotypic drift. According to
this notion, the uncoupling of endothelial cells from their natural
environment induces an alteration in transcriptional regulatory
mechanisms and programmed gene expression. The extent to which the
phenotype of the cultured cell resembles its in vivo counterpart is
likely to depend on the origin of the cell, the culture conditions, and the passage number. Regardless of the mechanism of differential gene
regulation in tissue culture, these findings underscore the need for
caution in interpreting the results of in vitro transfection assays.
Recent transgenic studies of the human vWF gene have uncovered a
complex model of transcriptional regulation in which expression is
governed by vascular bed-specific signaling pathways.11-13
This paradigm of gene regulation is extended in the present study. In
transgenic mice, a region of the mouse promoter that spans the 2,645 bp
5' flanking region, the first exon, and first intron was found to
direct vascular bed-specific expression in subpopulations of
endothelial cells within the heart, skeletal muscle, and brain. By
contrast, -galactosidase activity was consistently absent in organs
such as the lung, liver, and spleen. This pattern is unlikely to be
explained by differences in the stability of the X-Gal reaction
product, because widespread -galactosidase activity has been
demonstrated in the endothelium of other transgenic
models.17,26 Indeed, the pattern of expression is similar
to that reported for the human transgene and suggests that vascular
bed-specific gene regulation is evolutionarily conserved between species.
In contrast to the human vWF transgene, the mouse promoter also
contained information for expression in aortic endothelial cells.
Moreover, in 1 of the 3 lines of mice, the X-Gal reaction product was
detected in megakaryocytes. Although it is difficult to draw
conclusions from 1 expressing line, this finding suggests that the
mouse promoter contains information for megakaryocyte-specific expression when integrated into an appropriate chromatin environment.
Recent studies of other endothelial cell-specific transgenes have also
demonstrated differential expression within the vascular tree. For
example, the upstream promoter of the Tie-2 gene was shown to direct
expression to distinct endothelial cell subpopulations within
transgenic embryos,27 whereas the inclusion of an intronic enhancer region conferred widespread expression in adult
endothelium.17 A 5.9-kb fragment of the murine
preproendothelin-1 promoter directed differential expression within the
endothelium and vascular smooth muscle cells of adult transgenic
mice.28 In the latter study, expression levels in
endothelial cells varied not only between arteries, veins, and
capillaries, but also between vascular beds of different
organs.28 In a transgenic analysis of the human endothelial
nitric oxide synthase gene, a 1,600-bp region of the promoter was also
shown to contain information for vascular bed-specific expression.29 Taken together, these results are consistent
with our own observations of differential vWFlacZ expression
and provide strong support for the existence of regional differences in
the mechanisms of endothelial cell gene regulation.
The potential importance of combinatorial gene regulation as a more
general transcriptional control mechanism is supported by studies of
other cell lineages. In transgenic mice, the  1(1) collagen gene was
shown to possess different cis elements required for expression
in fibroblasts of the skin as compared with fibroblasts within the
fascia.30 In another investigation,31
expression of the CD4 gene in transgenic mice was shown to be governed
by distinct regulatory elements in separate T-cell subsets. In a recent
study of the muscle-specific SM22 gene,32 a 445-bp
region of the promoter directed expression in the vascular smooth cells of arteries as well as cardiac and skeletal myocytes in a
temporospatial pattern similar to that of the endogenous gene. However,
in contrast to the endogenous gene, transgene expression was absent in
venous and visceral smooth muscle cells. The promoter region of yet
another muscle-specific gene (MLC-3F) was found to contain distinct DNA regions capable of distinguishing between regulatory programs within
the various chambers of the transgenic heart.33 These reports provide additional evidence that transcriptional control mechanisms may differ between subpopulations of cells and reinforce the
notion that not all cell types within a given lineage are alike.
In summary, we have shown that the mvWF promoter is highly homologous
to the human vWF gene in both structure and function. The results
support the notion that the vWF gene is regulated in a modular fashion
from one vascular bed to another. The existence of multiple vascular
bed-specific signaling pathways would enhance the capacity of
endothelial cells to adapt to the needs of the local environment. At
the same time, it might also render the endothelium more vulnerable to
focal dysfunction and pathology. Indeed, further elucidation of these
pathways would provide an initial framework for manipulating and
regulating activity in specific subpopulations of endothelial cells in vivo.
| |
ACKNOWLEDGMENT |
The authors thank Cecil Denis and Denisa Wagner for providing us with
mvWF exon 4/5 DNA sequence. We also thank Nadia Jahroudi and Nick
Shworak for their helpful discussions.
| |
FOOTNOTES |
Submitted March 15, 1999; accepted July 14, 1999.
Supported by National Institutes of Health Grant No. HL60585-01.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to William C. Aird, MD, Molecular Medicine,
RW-663, Beth Israel Deaconess Medical School, Boston, MA 02215; e-mail:
waird{at}caregroup.harvard.edu.
| |
REFERENCES |
1.
Gerritsen ME:
Functional heterogeneity of vascular endothelial cells.
Biochem Pharmacol
36:2701, 1987[Medline]
[Order article via Infotrieve]
2.
Page C, Rose M, Yacoub M, Pigott R:
Antigenic heterogeneity of vascular endothelium.
Am J Pathol
141:673, 1992[Abstract]
3.
Cines DB, Pollak ES, Buck CA, Loscalzo J, Zimmerman GA, McEver RP, Pober JS, Wick TM, Konkle BA, Schwartz BS, Barnathan ES, McCrae KR, Hug BA, Schmidt AM, Stern DM:
Endothelial cells in physiology and in the pathophysiology of vascular disorders.
Blood
91:3527, 1998[Free Full Text]
4.
Sadler JE:
von Willebrand factor.
J Biol Chem
266:22777, 1991[Free Full Text]
5.
Ruggeri ZM, Ware J:
von Willebrand factor.
FASEB J
7:308, 1993[Abstract]
6.
Wu QY, Drouet L, Carrier JL, Rothschild C, Berard M, Rouault C, Caen JP, Meyer D:
Differential distribution of von Willebrand factor in endothelial cells. Comparison between normal pigs and pigs with von Willebrand disease.
Arteriosclerosis
7:47, 1987[Abstract]
7.
Rand JH, Badimon L, Gordon RE, Uson RR, Fuster V:
Distribution of von Willebrand factor in porcine intima varies with blood vessel type and location.
Arteriosclerosis
7:287, 1987[Abstract/Free Full Text]
8.
Bahnak BR, Wu QY, Coulombel L, Assouline Z, Kerbiriou-Nabias D, Pietu G, Drouet L, Caen JP, Meyer D:
Expression of von Willebrand factor in porcine vessels: Heterogeneity at the level of von Willebrand factor mRNA.
J Cell Physiol
138:305, 1989[Medline]
[Order article via Infotrieve]
9.
Page C, Rose M, Yacoub M, Pigott R:
Antigenic heterogeneity of vascular endothelium.
Am J Pathol
141:673, 1992
10.
Yamamoto K, de Waard V, Fearns C, Loskutoff DJ:
Tissue distribution and regulation of murine von Willebrand factor gene expression in vivo.
Blood
92:2791, 1998[Abstract/Free Full Text]
11.
Aird WC, Jahroudi N, Weiler-Guettler H, Rayburn HB, Rosenberg RD:
Human von Willebrand factor gene sequences target expression to a subpopulation of endothelial cells in transgenic mice.
Proc Natl Acad Sci USA
92:4567, 1995[Abstract/Free Full Text]
12.
Aird WC, Edelberg JM, Weiler-Guettler H, Simmons WW, Smith TW, Rosenberg RD:
Vascular bed-specific expression of an endothelial cell gene is programmed by the tissue microenvironment.
J Cell Biol
138:1117, 1997[Abstract/Free Full Text]
13.
Edelberg JM, Aird WC, Wu W, Rayburn H, Mamuya WS, Mercola M, Rosenberg RD:
PDGF mediates cardiac microvascular communication.
J Clin Invest
102:837, 1998[Medline]
[Order article via Infotrieve]
14.
Dubois NA, Kolpack LC, Wang R, Azizkhan RG, Bautch VL:
Isolation and characterization of an established endothelial cell line from transgenic mouse hemangiomas.
Exp Cell Res
196:302, 1991[Medline]
[Order article via Infotrieve]
15.
Mancuso DJ, Tuley EA, Westfield LA, Worrall NK, Shelton-Inloes BB, Sorace JM, Alevy YG, Sadler JE:
Structure of the gene for human von Willebrand factor.
J Biol Chem
264:19514, 1989[Abstract/Free Full Text]
16.
Janel N, Schwachtgen J-L, Bakhshi MR, Barek L, Meyer D, Kerbiriou-Nabias D:
Comparison of the 5'-flanking sequences of the human and bovine von Willebrand factor-encoding genes reveals alternation of highly homologous domains with species-specific Alu-type repeats.
Gene
167:291, 1995[Medline]
[Order article via Infotrieve]
17.
Schlaeger TM, Bartunkova S, Lawitts JA, Teichmann G, Risau W, Deutsch U, Sato TN:
Uniform vascular-endothelial cell-specific gene expression in both embryonic and adult transgenic mice.
Proc Natl Acad Sci USA
94:3058, 1997[Abstract/Free Full Text]
18.
Leitman DC, Ribeiro RC, Mackow ER, Baxter JD, West BL:
Identification of a tumor necrosis factor-responsive element in the tumor necrosis factor alpha gene.
J Biol Chem
266:9343, 1991[Abstract/Free Full Text]
19.
Jahroudi N, Ardekani AM, Greenberger JS:
An NF1-like protein functions as a repressor of the von Willebrand factor promoter.
J Biol Chem
271:21413, 1996[Abstract/Free Full Text]
20.
Jahroudi N, Lynch DC:
Endothelial-cell-specific regulation of von Willebrand factor gene expression.
Mol Cell Biol
14:999, 1994[Abstract/Free Full Text]
21.
Schwachtgen JL, Remacle JE, Janel N, Brys R, Huylebroeck D, Meyer D, Kerbiriou-Nabias D:
Oct-1 is involved in the transcriptional repression of the von Willebrand factor gene promoter.
Blood
92:1247, 1998[Abstract/Free Full Text]
22.
Zhang R, Min W, Sessa WC:
Functional analysis of the human endothelial nitric oxide synthase promoter. Sp1 and GATA factors are necessary for basal transcription in endothelial cells.
J Biol Chem
270:15320, 1995[Abstract/Free Full Text]
23.
Collins T, Read MA, Neish AS, Whitley MZ, Thanos D, Maniatis T:
Transcriptional regulation of endothelial cell adhesion molecules: NF-kappa B and cytokine-inducible enhancers.
FASEB J
9:899, 1995[Abstract]
24.
Wakiya K, Begue A, Stehelin D, Shibuya M:
A cAMP response element and an Ets motif are involved in the transcriptional regulation of flt-1 tyrosine kinase (vascular endothelial growth factor receptor 1) gene.
J Biol Chem
271:30823, 1996[Abstract/Free Full Text]
25.
Schwachtgen JL, Janel N, Barek L, Duterque-Coquillaud M, Ghysdael J, Meyer D, Kerbiriou-Nabias D:
Ets transcription factors bind and transactivate the core promoter of the von Willebrand factor gene.
Oncogene
15:3091, 1997[Medline]
[Order article via Infotrieve]
26.
Weiler-Guettler H, Aird WC, Husain M, Rayburn H, Rosenberg RD:
Targeting of transgene expression to the vascular endothelium of mice through homologous recombination at the thrombmodulin locus.
Circ Res
78:180, 1996[Abstract/Free Full Text]
27.
Schlaeger TM, Qin Y, Fujiwara Y, Magram J, Sato TN:
Vascular endothelial cell lineage-specific promoter in transgenic mice.
Development
121:1089, 1995[Abstract]
28.
Harats D, Kurihara H, Belloni P, Oakley H, Ziober A, Ackley D, Cain G, Kurihara Y, Lawn R, Sigal E:
Targeting gene expression to the vascular wall in transgenic mice using the murine preproendothelin-1 promoter.
J Clin Invest
95:1335, 1995
29.
Guillot P-V, Guan J, Kuivenhoven JA, Rosenberg RD, Sessa WC, Aird WC:
A vascular bed-specific pathway regulates cardiac expression of endothelial nitric oxide synthase.
J Clin Invest
103:799, 1999[Medline]
[Order article via Infotrieve]
30.
Liska DJ, Reed MJ, Sage EH, Bornstein P:
Cell-specific expression of alpha 1(I) collagen-hGH minigenes in transgenic mice.
J Cell Biol
125:695, 1994[Abstract/Free Full Text]
31.
Hanna Z, Simard C, Laperriere A, Jolicoeur P:
Specific expression of the human CD4 gene in mature CD4+ CD8 and immature CD4+ CD8+ T cells and in macrophages of transgenic mice.
Mol Cell Biol
14:1084, 1994[Abstract/Free Full Text]
32.
Li L, Miano JM, Mercer B, Olson EN:
Expression of the SM22a promoter in transgenic mice provides evidence for distinct transcriptional regulatory programs in vascular and smooth muscle cells.
J Cell Biol
132:849, 1996[Abstract/Free Full Text]
33.
Kelly R, Alonso S, Tajbakhsh S, Cossu G, Buckingham M:
Myosin light chain 3F regulatory sequences confer regionalized cardiac and skeletal muscle expression in transgenic mice.
J Cell Biol
129:383, 1995[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
R. G. Picciani, A. Diaz, R. K. Lee, and S. K. Bhattacharya
Potential for Transcriptional Upregulation of Cochlin in Glaucomatous Trabecular Meshwork: A Combinatorial Bioinformatic and Biochemical Analytical Approach
Invest. Ophthalmol. Vis. Sci.,
July 1, 2009;
50(7):
3106 - 3111.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. L. Lemmerhirt, J. A. Shavit, G. G. Levy, S. M. Cole, J. C. Long, and D. Ginsburg
Enhanced VWF biosynthesis and elevated plasma VWF due to a natural variant in the murine Vwf gene
Blood,
November 1, 2006;
108(9):
3061 - 3067.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. A. Bernat, G. E. Crawford, A. Y. Ogurtsov, F. S. Collins, D. Ginsburg, and A. S. Kondrashov
Distant conserved sequences flanking endothelial-specific promoters contain tissue-specific DNase-hypersensitive sites and over-represented motifs
Hum. Mol. Genet.,
July 1, 2006;
15(13):
2098 - 2105.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Hough, C. D. Cuthbert, C. Notley, C. Brown, C. Hegadorn, E. Berber, and D. Lillicrap
Cell type-specific regulation of von Willebrand factor expression by the E4BP4 transcriptional repressor
Blood,
February 15, 2005;
105(4):
1531 - 1539.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
X. Wang, Y. Peng, Y. Ma, and N. Jahroudi
Histone H1-like protein participates in endothelial cell-specific activation of the von Willebrand factor promoter
Blood,
September 15, 2004;
104(6):
1725 - 1732.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Ishida, R. K. Kundu, E. Yang, K.-i. Hirata, Y.-D. Ho, and T. Quertermous
Targeted Disruption of Endothelial Cell-selective Adhesion Molecule Inhibits Angiogenic Processes in Vitro and in Vivo
J. Biol. Chem.,
September 5, 2003;
278(36):
34598 - 34604.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. H. N. Olsen, A. S. McCain, E. P. Merricks, T. H. Fischer, I. M. Dillon, R. A. Raymer, D. A. Bellinger, S. A. Fahs, R. R. Montgomery, J. C. Keith Jr, et al.
Comparative response of plasma VWF in dogs to up-regulation of VWF mRNA by interleukin-11 versus Weibel-Palade body release by desmopressin (DDAVP)
Blood,
July 15, 2003;
102(2):
436 - 441.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Minami, D. J. Donovan, J. C. Tsai, R. D. Rosenberg, and W. C. Aird
Differential regulation of the von Willebrand factor and Flt-1 promoters in the endothelium of hypoxanthine phosphoribosyltransferase-targeted mice
Blood,
December 1, 2002;
100(12):
4019 - 4025.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. I. Teng, M. R. Dichiara, L. G. Komuves, K. Abe, T. Quertermous, and J. N. Topper
Inducible and selective transgene expression in murine vascular endothelium
Physiol Genomics,
October 29, 2002;
11(2):
99 - 107.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Peng and N. Jahroudi
The NFY transcription factor functions as a repressor and activator of the von Willebrand factor promoter
Blood,
April 1, 2002;
99(7):
2408 - 2417.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. ILJIN, M. J. KARKKAINEN, E. C. LAWRENCE, M. A. KIMAK, M. UUTELA, J. TAIPALE KATRI PAJUSOLA LEENA ALHONEN, M. HALMEKYTO, D. N. FINEGOLD, R. E. FERRELL, and K. ALITALO
VEGFR3 gene structure, regulatory region, and sequence polymorphisms
FASEB J,
April 1, 2001;
15(6):
1028 - 1036.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION