|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 10 (November 15), 1999:
pp. 3456-3467
Cloning and Expression of a Short Fas Ligand: A New Alternatively
Spliced Product of the Mouse Fas Ligand Gene
By
Emira Ayroldi,
Francesca D'Adamio,
Ornella Zollo,
Massimiliano Agostini,
Rosalba Moraca,
Lorenza Cannarile,
Graziella Migliorati,
Domenico V. Delfino, and
Carlo Riccardi
From the Department of Clinical and Experimental Medicine, Section of
Pharmacology, Perugia University Medical School, Perugia, Italy.
 |
ABSTRACT |
The Fas/FasL system mediates apoptosis in several different cell
types, including T lymphocytes. Fas ligand (FasL), a 40-kD type II
membrane protein also expressed in activated T cells, belongs to the
tumor necrosis factor ligand family. We describe a new alternative
splicing of mouse FasL, named FasL short (FasLs), cloned by reverse
transcriptase-polymerase chain reaction. FasLs is encoded by part of
exon 1 and part of exon 4 of FasL gene. The protein encoded by FasLs
mRNA has a putative initiation code at position 756 and preserves the
same reading frame as FasL, resulting in a short molecule lacking the
intracellular, the transmembrane, and part of the extracellular
domains. RNase protection and immunoprecipitation analysis showed that
FasLs is expressed in nonactivated normal spleen cells and in hybridoma
T cells and that it is upregulated upon activation by anti-CD3
monoclonal antibody (MoAb). Moreover, FasLs-transfected cells expressed
soluble FasLs in the supernatant and became resistant to apoptosis
induced by agonist anti-Fas MoAb. Thus, FasLs, a new alternative
splicing of FasL, is involved in the regulation of Fas/FasL-mediated
cell death.
© 1999 by The American Society of Hematology.
 |
INTRODUCTION |
APOPTOSIS (PROGRAMMED cell death)
plays a crucial role in the deletion of unwanted T cells in 2 different
phases during the ontogeny of the immune response.1-5 In
the thymus, apoptosis participates in T-cell repertoire development.
The encounter of self-antigen leads to T-cell deletion characterized by
apoptotic cell death (negative selection). In the periphery,
chronically stimulated mature T cells undergo apoptosis upon engagement
of TCR/CD3 by antigen-presenting cells (APCs) presenting antigenic peptide.6-10 This process, termed activation-induced cell
death (AICD),11 appears to be mediated by the Fas/FasL
system.12-18
Fas/APO-1 (CD95), a protein expressed on the surface of a variety of
cells, including transformed cell lines and chronically stimulated T
cells, mediates apoptosis after binding with FasL or with anti-Fas
monoclonal antibody (MoAb).13,16,18 FasL, a 40-kD type II
membrane protein, is normally expressed in the spleen and at low levels
in the thymus. Human FasL is proteolytically released from the cell
membrane in a soluble form that binds Fas and induces
apoptosis.19-22
Fas/FasL-mediated apoptosis is regulated by a balance of
receptor/ligand interactions.23 For example, TCR engagement
induces FasL and upregulates Fas, and their interaction induces cell
death.14,16,18 Moreover, Fas-mediated apoptosis is
modulated by soluble proteins derived from alternative splicing of the
Fas gene that inhibits anti-Fas-induced apoptosis.24-26
Although it is clear that soluble forms of Fas derived from
alternatively spliced transcripts exist and some have a decoy function,
a similar mechanism has not been described for FasL. We investigated
whether alternative spliced transcripts, coding for different forms of
FasL, are produced.
We used the T-cell line hybridomas 3DO, which has been previously used
in studies on apoptosis. It also undergoes apoptosis by means of
TCR/CD3 cross-linking in which the Fas/FasL interaction plays a
dominant role in mediating AICD.27-29 We identified and characterized a new mRNA FasL variant. It is also expressed in normal
spleen cells and encodes a protein corresponding to a short form of
FasL (FasLs) that inhibits Fas-mediated cell death.
 |
MATERIALS AND METHODS |
Cell line and animals.
A spontaneously dividing CD3+, CD4+,
CD2+, CD44+ subline of the ova-specific
hybridoma T-cell line 3DO,30 obtained by recloning the
original line in our laboratory, was used for the experiments. Cells
were maintained in logarithmic growth in RPMI 1640 supplemented with
10% fetal calf serum (FCS), 10 µmol/L HEPES, and antibiotics. Spleen
T cells were obtained from 4- to 6-week-old C3H/HeN mice (Charles
River, Calco, Milan, Italy) and enriched by passing cells twice through
nylon columns.
Antibody cross-linking and flow cytometry analysis.
Hamster antimouse CD3 (clone145-2C11; Pharmingen, San Diego, CA) MoAb
at 1 µg/mL was allowed to adhere to flat-bottomed, high-binding, 96-well plates (Costar, Cambridge, MA) at 4°C in 100 µL
phosphate-buffered saline (PBS). After 20 hours, plates coated with
MoAb were washed, incubated at 37°C for 2 hours with PBS
supplemented with 10% FCS, and washed again, and spleen and hybridoma
T cells were then plated at 1 × 105 cells/well and
incubated at 37°C for 15 hours. Cells were then used to perform
fluorescence-activated cell sorting (FACS) analysis or to extract RNA.
For FasL membrane detection, cells were stained with hamster antimouse
MoAb (clone MFL4; Pharmingen) or isotype-matched MoAb and with
antihamster IgG fluorescein isothiocyanate (FITC) conjugate (Pharmingen) as a second-step reagent.
The percentage of FasL+ cells was calculated using Lysis II
research software (Becton Dickinson, Mountain View, CA).
To evaluate Fas-mediated killing, cells (1 × 106)
were incubated at room temperature for 30 minutes with 10 µg/mL of
the anti-Fas MoAb (hamster antimouse, clone Jo2; Pharmingen) and then
washed and plated in wells coated with Ab to hamster IgG (5 µg/mL;
Pharmingen) for the cross-linking of the anti-Fas MoAb.27
RNA extraction and reverse transcriptase reaction.
RNA was isolated by using the TRIzol LS reagent (GIBCO-BRL, Life
Technologies, Paisley, Scotland) following the manufacturer's instructions.
The reverse transcriptase reaction was conducted in 20 µL reverse
transcriptase buffer (GIBCO-BRL), 10 mmol/L dithiothreitol, 0.5 U/µL
RNase inhibitor, 100 µmol/L dNTP, 1 µmol/L oligo(dT) primer
(T15), and 0.1 µg DNA-free RNA. After 10 minutes of
incubation at 65°C and then at 37°C, 1 µL Moloney murine
leukemia virus (M-MLV) reverse transcriptase (GIBCO-BRL)
was added. The reaction was performed for a further 50 minutes and the
enzyme was inactivated by heating for 5 minutes at 95°C. The
reaction quality was checked by polymerase chain reaction (PCR) with
specific primers for -actin mRNA amplification.
PCR.
PCR was conducted in 20 µL of PCR buffer (Perkin Elmer Corp, Norwalk,
CT), 25 µmol/L dNTP, 0.5 µmol/L of each specific primer, 1 mmol/L
MgCl2, and 2 µL cDNA from the reverse transcriptase
reaction or 0.04 µL DNA from a previous PCR reaction (when a nested
PCR was performed). After 5 minutes of incubation at 96°C (hot
start) and 2 minutes at the chosen annealing temperature (68°C),
0.2 µL AmpliTaq (Perkin Elmer) was added. Denaturation was performed at 95°C for 30 seconds and extension was performed at 72°C. The DNA Thermal Cycler 480 (Perkin Elmer) was used. DNA oligonucleotide primers were synthesized in an Oligo-1000 DNA synthesizer (Beckman, Fullerton, CA).
Cloning and sequencing.
PCR products were cloned into the pCR II vector using the TA Cloning
kit (Invitrogen, San Diego, CA). Sequencing was performed with the
Sequenase kit (USB, Cleveland, OH).
RNase protection analysis.
Using reverse transcriptase-PCR (RT-PCR), a probe for RNase protection
was constructed with primers 1 and 4 (shown in Fig 4) to clone the
207-bp probe. After cloning, the products were sequenced to exclude
point mutation. Plasmide DNA was linearized with BamHI (New
England Biolabs, Beverly, MA) and transcribed with T7 RNA polymerase
(GIBCO-BRL) in the presence of 50 µmol/L [ -32P] UTP.
After gel purification, the 2 × 105 cpm probe was
hybridized to total RNA (20 µg) overnight at 60°C.
RNase digestion was performed by using an RNase A (40 µg/mL;
Boehringer Mannheim, Mannheim, Germany) and RNase T1 (1.5 U/µL; GIBCO-BRL) solution at 37°C for 15 minutes. The undigested products were treated with phenol-chloroform, precipitated with ethanol, and
loaded on a denaturing polyacrylamide sequencing gel. Autoradiographic exposure was performed for 2 days.
Transfection and evaluation of the transfected clones.
The FasLs sequence (406 bp) was cloned into pcDNA3 plasmid (Invitrogen)
for expression in mammalian cells. 3DO cells were transfected by
electroporation (300 mA, 960 µF) with 15 µg of linearized pcDNA3
vector (control clones) or 15 µg of linearized pcDNA3 vector
expressing the FasLs cDNA. Thirty-six hours after transfection, cells
were cultured in medium containing G418 0.8 mg/mg active-form/mL
(GIBCO-BRL) and 100 µL/mL of cell suspension were plated in 96-well
plates (4 for each transfection). Fifteen to 20 days later, no more
than 15% of the wells contained living, growing cells.
These cells were considered clones and were analyzed in RT-PCR for
exogenous FasLs expression.28 As primer forward, we used
the T7 eukaryotic modified (TCGAAATTAATACGACTCACTATAGGG), and as primer
reverse, we used the n. 3 located on FasLs cDNA (see Fig 2)
or the Sp6 eukaryotic (GCTCTAGCATTTAGGTGACACTATAG). Each RT-PCR
reaction was controlled using the respective RNA without the addition
of reverse transcriptase to the RT reaction.
Immunoprecipitation.
Antibodies used for immunoprecipitation were 2 different
affinity-purified rabbit polyclonal antibodies raised against a peptide corresponding to amino acids 2-19 mapping at the amino terminus of rat
origin FasL (FasL-NH2) and an antibody raised against a peptide
corresponding to amino acids 260-279 mapping at the carboxy terminus of
human FasL (FasL-COOH). Those antibodies were purchased by Santa Cruz
Biotechnology (Santa Cruz, CA).
Cells (5 × 106/sample) lysed in a 1%
NP-40-containing buffer (250 mmol/L NaCl, 0.5% deoxycholic acid
(DOC), 0.1% sodium dodecyl sulfate [SDS], 50 mmol/L
Tris, pH 8) and supernatants from transfected clones were preadsorbed
with normal rabbit IgG. After removing the protein A-Sepharose by
centrifugation, 10 µg of purified anti-FasL-COOH or anti-FasL-NH2
Abs or preimmune antiserum (Jackson Immuno Research Laboratories, West
Grove, PA) was added to the supernatants. After incubation for 60 minutes on ice, protein A-Sepharose was added and the mixture was
incubated at 4°C overnight. The immunoprecipitates were washed 3 times with cold lysis buffer, boiled for 3 minutes, and then analyzed
by electrophoresis in 10% SDS-polyacrylamide gel electrophoresis
(SDS-PAGE) gel followed by transfer to nitrocellulose (Bioblot-NC;
Costar) for 5 hours at 250 mA, 4°C in 25 mmol/L Tris/glycine, pH
8.3, and 20% vol/vol methanol. After immunoprecipitation, proteins were analyzed by Western blotting using the anti-FasL-COOH or anti-FasL-NH2 Abs.
To control the specificity of anti FasL-COOH Ab, Western blotting
experiments were performed using FasL-GST and GST fusion proteins. In
particular, 10 µg of fusion proteins was resolved by electrophoresis
at room temperature on a 12% gradient polyacrylamide gel. After
electrophoresis, proteins were analyzed by Western blotting using the
anti-FasL-COOH Ab or the antimouse-FasL MoAb, clone MFL4.
The proteins were detected using the enhanced chemiluminescence (ECL)
system (Amersham Life Science, Buckinghamshire, UK) after staining with
streptavidin-conjugated horseradish peroxidase (Amersham). For
metabolic labeling, cells were maintained in leucine-free minimal
essential medium (Sigma, St Louis, MO) supplemented with glutamine,
gentamicin, 0.02 mmol/L 2-mercaptoethanol, and 2% dialyzed fetal
bovine serum (FBS). [3H] leucine (L-4,5-3H
leucine; Amersham) was then added to anti-CD3-treated and untreated cells at 1 mCi per 2 × 107 cells. After 15 hours of
incubation, 3H-labeled supernatants and cell lysate
proteins were analyzed as described above. Blocking peptide
corresponding to amino acids 260-279 mapping at the carboxy terminus of
FasL of human origin was used for competition studies following the
manufacturer's instructions (Santa Cruz).
Cytotoxicity assay.
The lysis of P815 Fas+ tumor cell line was used as an
indicator of FasL expression. This tumor cell line was grown in RPMI 1640 and 10% FCS and subcultured 2 to 3 times per week. Different concentrations of FasLs- or empty vector-transfected 3DO cells were
cultured for 20 hours on plates coated with anti-CD3 (1 µg/well) or
control medium. The 51Cr labeling and assay were as
previously described.18 Spontaneous release or release in
the presence of anti-CD3 with no effector cells was less than 15% of
the total release. The percentage of specific lysis at various E:T
ratios was calculated as follows: % cytotoxicity = (test cpm spontaneous release cpm)/(total release cpm) × 100, where test
cpm is the mean cpm released in the presence of effector cells;
spontaneous release is the mean cpm released from targets cultured in
medium alone; and total release cpm is the mean cpm obtained by lysing
target with 0.5% Triton X-100. To demonstrate that the cytotoxic
effect was dependent on FasL expression, the blocking antimouse FasL
MoAb (5 µg/mL, clone MFL4) was added to some empty vector-transfected
clones activated by anti-CD3 MoAb.
Apoptosis evaluation by propidium iodide (PI) solution.
Apoptosis was measured by flow cytometry as described
elsewhere.31 After culturing, cells were centrifuged and
the pellets gently resuspended in 1.5 mL hypotonic PI solution (50 µg/mL in 0.1% sodium citrate plus 0.1% Triton X-100; Sigma). Test
tubes were stored overnight at 4°C in the dark. The PI-fluorescence of individual nuclei was measured by flow cytometry using standard FACScan equipment (Becton Dickinson). The nuclei traversed a 488 nm
argon laser light beam. A 560 nm dichroid mirror (DM 570) and a 600 nm
band pass filter (band width, 35 nm) were used to collect the red
fluorescence due to PI DNA staining, and the data were recorded in
logarithmic scale in a Hewlett Packard (HP 9000, model 310; Hewlett
Packard, Palo Alto, CA) computer. The percentage of apoptotic cell
nuclei (subdiploid DNA peak in the DNA fluorescence histogram) was
calculated with specific FACScan research software (Lysis II).
Preparation of FITC-labeled fusion protein.
A fusion protein containing the full FasLs amino acid sequence fused to
glutathione S-transferase (GST; Pharmacia, Uppsala, Sweden) was
prepared. GST-fusion protein was expressed in Escherichia coli,
induced with 1 mmol/L isopropyl- -D-thiogalactopyranoside, and
purified with glutathione-agarose beads as previously
described.28 The FasLs and GST fusion proteins were
conjugated with biotin (Pharmacia) according to standard procedures.
Serial dilution of biotinylated proteins was used to evaluate the
binding to a Fas+ cell line. Streptavidin-FITC (Pharmingen)
was used as a second-step reagent. To control the specificity of the
staining, antimouse Fas MoAb (clone Jo2) was used to inhibit GST-FasL
binding to activated 3DO cells. In particular, cells were
incubated with the MoAb 30 minutes at 4°C, washed, and then
incubated for a further 30 minutes with the biotinylated GST-FasL
fusion protein.
Samples were analyzed on a FACScan flow cytometer.
Statistical analysis.
Each experiment was performed at least 3 times. Representative
experiments are shown, unless otherwise indicated in the figure legends. Results are expressed as the mean ± SD of 3 different experiments. Because of the nonnormal distribution of the data, nonparametric tests (Kruskal-Wallis' analysis of variance) were adopted for statistical evaluation.
 |
RESULTS |
Isolation and characterization of FasLs cDNA.
3DO cells expressed FasL on the cell membrane upon activation with
cross-linked anti-CD3 MoAb (Fig 1A). To
investigate whether other potential products of the FasL gene are
expressed in activated 3DO cells, mRNA transcripts from both untreated
cells or cells treated with cross-linked anti-CD3 MoAb were analyzed by
RT-PCR. Using the primers 1 and 2 shown in
Fig 2A (specific for mouse FasL cDNA), we
obtained 2 products (Fig 1B). As expected, 1 of these products, which
was 1,067 bp long, corresponded to the full-length FasL cDNA.
Unexpectedly, a second product, which was 406 bp long, was also
detected on both anti-CD3-treated (line 2) and, although less evident,
resting cells (line 1, Fig 1B).

View larger version (46K):
[in this window]
[in a new window]
| Fig 1.
(A) FasL expression in 3DO cells. Cells were incubated
for 15 hours in 96-well plates with medium alone (control) or coated
with anti-CD3 MoAb (1 µg/mL). T cells were stained with an antimouse
FasL MoAb and an antihamster-FITC. The number shows the percentage of
positive cells calculated by Lysis II. Fluorescence intensity versus
cell number. (B) RT-PCR analysis of the mouse FasL mRNA transcripts.
First-strand cDNA prepared from untreated (line 1) or anti-CD3-treated
(line 2) 3DO cells were subjected to PCR with the primers 1 and 2 shown
in Fig 2A. A negative control, without cDNA template, was also
performed (line 3). The PCR products were separated by electrophoresis
on 1.5% agarose gel and stained with ethidium bromide. Marker VI was
run for comparison (left line). (C) PCR products obtained using as
template the PCR product (0.04 µL) of the experiment shown in (B).
Line 1, forward, primer 1, reverse, primer 3; line 2, forward, primer
1, reverse, primer 2; line 3, negative control. The primers are shown
in Fig 2A. Marker VI was run for comparison (left line).
|
|

View larger version (44K):
[in this window]
[in a new window]
| Fig 2.
(A) FasL and FasLs nucleotide sequences and predicted
amino acid sequence of mouse FasLs. The deleted sequence is shown in
small letters. The asterisks indicate possible glycosylation sites. (B)
Schematic representation of FasL and FasLs cDNA. (C) Schematic
representation of FasL and FasLs protein. Arrows indicate the primers
used to clone FasLs and to clone the probe used for RNase protection.
|
|
To investigate the shorter RT-PCR product (406 bp), a series of PCR
reactions using different specific primers was performed. Figure 1C
shows the results of a representative experiment in which the PCR
products of the experiment reported in Fig 1B were reamplified using
the same primers (line 2) or the primer 1 and the primer 3 (shown in
Fig 2A) nested with respect to primer 2 (line 1). As
expected, the products obtained using the nested primer were smaller
than those obtained using primers 1 and 2, indicating that the short
406-bp band might be the amplification of a spliced FasL mRNA.
The short FasL cDNA, which was obtained from either anti-CD3-activated
3DO cells or from anti-CD3-treated spleen cells, was cloned and the
nucleotide sequence was determined. The sequence data concurred with
the size of the amplified products and with the published mouse FasL
cDNA sequence, except for the deletion of part of it (Fig 2). We named
this short FasL alternative splicing, FasLs. FasLs was characterized by
a deletion of 661 bp starting at nucleotide position 87 and ending at
position 748 of the full-length FasL cDNA. The starting codon (ATG) of
full-length FasL cDNA is also deleted. However, the FasLs starting
codon gives an equal reading frame to FasL, with the same termination
codon. This resulted in a cDNA encoding for a putative FasL protein
lacking the intracellular, the transmembrane, and part of the
extracellular domains but retaining the extracellular domain of FasL
with 2 glycosylation sites (Fig 2A). The molecular mass of the
predicted mature FasLs protein, before further posttranslation
modification, is 8,040 Daltons.
FasLs mRNA is upregulated by anti-CD3 activation.
RNase protection analysis was performed to evaluate the expression of
FasLs. The probe was obtained by amplifying a smaller fragment of FasLs
cDNA in RT-PCR using primers 1 and 4 shown in Fig 2A. This probe
protects fragments of 207 bp (FasLs), 171 bp (FasL), and 36 bp (FasL).
As shown in Fig 3, the 2 higher fragments (207 and 171 bp, respectively) were detected, whereas the smaller expected fragment of 36 bp (FasL) was not observed in the gel. The 2 observed fragments were equally evident after hybridization of the
labeled probe, with RNA from anti-CD3-treated 3DO cells (Fig 3, line
4) but not with RNA from nonactivated 3DO cells that express FasLs
only, although at lesser amount (Fig 3, line 3). No fragments were
observed with tRNA used as negative control (Fig 3, line 2). These data
indicate that FasLs but no FasL mRNA are expressed in untreated 3DO
cells and that anti-CD3 activation upregulates the expression of both
FasL and FasLs.

View larger version (25K):
[in this window]
[in a new window]
| Fig 3.
Expression of FasLs and FasL mRNA in 3DO cells. RNase
protection analysis was performed as described in Materials and
Methods. Probe includes a portion of exon 1 and a portion of exon 4. On
the left, the fragment that the antisense probe would protect upon
single-strand specific RNase digestion is shown schematically. Line 1, undigested probe; line 2, probe digested after hybridization with 30 µg tRNA; line 3, probe digested after hybridization with 30 µg RNA
from 3DO cells; line 4, probe digested after hybridization with 30 µg
RNA from anti-CD3-stimulated 3DO cells. The basepair length reported
on the right was derived from a sequencing reaction.
|
|
FasLs: RNA and protein expression in transfected cells.
It is well known that triggering of the TCR/CD3 complex results in
upregulation of Fas and induction of FasL expression and that the
Fas/FasL interaction mediates the TCR/CD3-induced
apoptosis.17 To test the effects of FasLs expression on
apoptosis mediated by TCR triggering, we transfected 3DO cells with an
expression vector pcDNA3 in which FasLs cDNA is expressed under the
control of the CMV promoter (clones 1 through 6). As a control, we also transfected the empty vector (clones 7 through 10). After selection with G418 antibiotic, cell clones were screened for FasLs expression by
RT-PCR, using a specific primer for pcDNA3 vector (forward) and a
specific primer for FasLs (reverse) or primers that bind Sp6 and T7 of pcDNA3.
Results of a representative experiment (reported in
Fig 4) show that FasLs-transfected clones
(clones 1 through 6) express the 517-bp mRNA band, whereas empty
vector-transfected clones (clones 7 through 10) do not (Fig 4A). A
bigger band was obtained with the primers binding Sp6 and T7 of pcDNA3
(Fig 4B). Each RT-PCR reaction was controlled using the respective RNA
without the addition of reverse transcription to the RT reactions (Fig
4B). Both FasLs-transfected (clones 1 through 6) or empty
vector-transfected (clones 7 through 10) clones were tested for FasLs
protein expression using an antibody recognizing the COOH terminal
portion of the molecule. Figure 4C shows that a protein of molecular
weight (Mr) of approximately 16,000 Daltons,
which is compatible with the Mr of FasLs' predicted protein after potential posttranslation modification, was found in
FasLs-transfected, but not in empty vector-transfected clones. Moreover, the same protein was found in the supernatants obtained from
FasLs-transfected clones, but not in the supernatants from empty
vector-transfected clones (Fig 4D).

View larger version (39K):
[in this window]
[in a new window]
| Fig 4.
Expression of exogenous FasLs in transfected 3DO cells.
The FasLs transfection was controlled by RT-PCR using as primer forward
the T7 eukaryotic and as primer reverse the n. 3 shown in Fig 2A or
using as primer forward the T7 eukaryotic and as primer reverse the SP6
eukaryotic. Each RT-PCR reaction (+) was controlled by using the
respective RNA without the addition of reverse transcriptase ( ) (B).
The FasLs transfection was also controlled by immunoprecipitation with
anti-FasL-COOH Ab of cell lysates (C) and supernatants (D). Western
blotting of the GST-FasLs fusion protein. Ten micrograms of GST-FasLs
(lines 1 and 3) or GST (lines 2 and 4) was resolved by electrophoresis
in a 12% gradient polyacrylamide gel (E). Proteins were analyzed by
Western blotting using the anti-FasL-COOH Ab (lines 1 and 2) or the
anti-FasL MoAb (clone MTL4, lines 3 and 4) as described in Materials
and Methods.
|
|
The Mr of the protein immunoprecipitated by the
anti-FasL-(COOH) antibody (Mr ~16,000) is larger than
the Mr of FasLs as calculated from its amino acid sequence
(Mr 8,040). A similar difference between predicted and
actual Mr has been previously reported for FasL
protein19 and is probably due to glycosylation of the
glycosylation sites that are also present in the FasLs sequence (Fig
2A). The specificity of anti-FasL-COOH Ab was tested by using the
FasLs-GST and GST fusion proteins in Western blotting. As can be seen
in Fig 4E, anti-FasL-COOH recognized the FasLs-GST fusion protein but
not the GST fusion protein (Fig 4E, lines 1 and 2). In contrast, antimouse-FasL, clone MFL4, did not recognize FasLs or GST fusion proteins (Fig 4E, lines 3 and 4).
As a further control, we also used an antibody that recognizes the
NH2-terminal portion of the FasL. As expected, no bands of
Mr 16,000 were detected in the cell pellet or supernatants of FasLs-transfected clones (not shown).
FasLs expression protects T cells from anti-Fas- and
anti-CD3-activated apoptosis.
To explore the FasLs functional activity, the cytotoxic activity of
activated and resting FasLs-transfected 3DO clones was examined using
the Fas+ P815 cell line as target.18,27 As
shown in Table 1, upon activation with
anti-CD3 MoAb, clones transfected with empty vector, as well as
untransfected clones,27 induced cytolysis of P815 cell line
(clones 7 through 10), whereas FasLs-transfected clones exhibited
reduced or no cytotoxic activity (clones 1 through 6). The cytotoxic
effect was truly FasL-dependent, because the blocking anti-FasL MoAb
MFL4 reduced the cytotoxic levels of activated empty vector-transfected
clones (Table 1). We also tested whether FasLs-transfected clones were
susceptible to anti-Fas MoAb-induced cell death. Table 1 shows that,
unlike empty vector-transfected clones, FasLs-transfected clones were
resistant to apoptosis induced by anti-Fas MoAb, suggesting that FasLs
can inhibit FasL-induced apoptosis. To analyze this inhibiting
activity, we used the supernatant of transfected clones containing
FasLs. Results indicate the supernatants from FasLs-transfected, but
not those from empty vector-transfected clones, inhibited
anti-Fas-induced cell death (Table 1).
To exclude an aspecific effect due to transfection, all clones were
also tested for Fas (not shown) and FasL expression by FACS analysis.
No differences were found between FasLs-transfected clones, empty
vector-transfected clones, and normal 3DO cells (Table 1). Moreover,
FasLs activity present in the culture supernatant of clone 6 was
evaluated by different dilutions using 3DO as effector and P815 as
target cells. The results, which are shown in
Fig 5, indicate that FasLs-transfected
clone 6 supernatant inhibited anti-CD3-activated 3DO cytotoxic
activity in a dose-dependent manner.

View larger version (10K):
[in this window]
[in a new window]
| Fig 5.
Cytotoxic activity of 3DO cells cultured in the presence
of different concentration of culture supernatant from a
FasLs-transfected clone. Results are the average of 3 experiments, each
performed in triplicate. The standard errors (<10%) are omitted for
clarity. E:T ratio, 25:1.
|
|
These data indicate that FasLs prevents apoptosis induced by Fas/FasL interaction.
FasLs binds to Fas+ activated T cells.
These results indicate that FasLs expression, like FasL, is induced by
T-cell activation and also indicate that FasLs, which lack the
transmembrane domain, can be detected in the supernatant of activated
cells. Moreover, results indicate that FasLs can prevent
Fas/FasL-induced death. We performed experiments to evaluate the
possible binding of FasLs to Fas using resting and activated T cells as
target.18 In particular, the percentage of positive T cells
after treatment with in vitro synthesized biotinylated FasLs
(GST-FasLs) was evaluated by flow cytometry analysis. For that purpose
resting and anti-CD3 activated T lymphocytes were treated with
different concentration of biotin-GST-FasLs
(Fig 6) and then with streptavidin-FITC. As
shown in Fig 6, T-cell activation, which upregulates Fas
expression,11 resulted in a significant increase of the
percentage of fluorescent cells (a measure of fluorescent FasLs
binding, Fig 6D) as compared with untreated T cells (Fig 6C). Moreover,
the percentage of positive cells increased with the augmentation of
biotinylated-protein concentrations used in the assay and decreased in
the presence of anti-Fas MoAb whose binding to Fas receptor prevents
the interaction Fas receptor/GST-FasLs fusion protein (Fig 6E). GST
alone gave a percentage of FITC+ cells near to
that of streptavidin-FITC alone (Fig 6A and B).

View larger version (28K):
[in this window]
[in a new window]
| Fig 6.
GST-FasLs fusion protein binding to untreated (A and C)
and anti-CD3-treated (B and D) 3DO cells. GST fusion protein was
prepared and biotinylated as described in Materials and Methods. Serial
dilutions of GST (A and B) or GST-FasLs (C and D) and
streptavidin-FICT 1:50 were used to stain 3DO cells.
Inhibition of GST-FasLs biotin (25 µg/µL) binding with anti-Fas
MoAb (5 µg/µL) (E). The numbers above the marker represent the
percentage of FITC+ cells of a representative experiment
as calculated by Lysis II. The doses of GST and GST-FasLs fusion
proteins are shown on the top of the figure.
|
|
FasL and FasLs expression in normal lymphocytes.
The results given above indicate that 3DO cell activation by anti-CD3
treatment induces the expression of FasL that is not detectable in
nonactivated cells and upregulates FasLs that is also detectable in
nonactivated cells (Figs 1 and 3). In the attempt to further analyze
the expression of FasL and FasLs in normal lymphocytes, we performed
experiments using thymus and spleen cells. In particular, mRNA
transcripts from both spleen cells untreated and treated with
cross-linked anti-CD3 MoAb were analyzed by RT-PCR and RNase protection
(Fig 7A and B). Results indicate that, in
untreated lymphocytes, FasLs mRNA is expressed and that it is augmented
by anti-CD3 treatment. FasL mRNA is only detectable after anti-CD3
treatment. These results suggest that FasL gene transcription is active
in resting lymphocytes, although at a lesser extent in comparison to
anti-CD3 treated, and also indicate that FasLs splicing is the only
splicing product in nonactivated cells.

View larger version (39K):
[in this window]
[in a new window]
| Fig 7.
(A) PCR products obtained using as template cDNA prepared
from untreated or anti-CD3-treated mouse spleen cells. Line 1, untreated spleen cells; line 2, spleen cells incubated overnight
with anti-CD3 MoAb (1 µg/mL); line 3, negative control.
The primers 1 (forward) and 2 (reverse) are shown in Fig 2B. RNase
protection analysis of FasL and FasLs mRNA expression from nonactivated
and anti-CD3-activated spleen cells. Each line was loaded with 30 µg
of total RNA. Line 1, undigested probe; line 2, tRNA; line 3, nonactivated spleen cells; line 4, activated spleen cells.
|
|
FasLs protein products are upregulated by anti-CD3 MoAb: detection in
cell lysate and supernatant.
The activation of mature T cells induces the expression of membrane
FasL.15,16,18 To evaluate the ratio between Fas and FasLs
proteins, experiments with 3H-leucine metabolic labeling
were performed. Untreated and anti-CD3-treated 3DO cells were labeled
with 3H-leucine. The supernatants and the cell lysates were
immunoprecipitated by an anti-FasL-(COOH) antibody. As shown in
Fig 8A, a band at Mr of
approximately 16 kD was detected in cell lysates and in the
supernatants of activated, but not resting, 3DO cells. This band may
correspond to FasLs. In fact, the detection of the band was inhibited
by the addition of a specific peptide (Fig 8A, line 3). A band of
Mr 40 kD corresponding to FasL was detected in the cell
lysate but not in the supernatant of anti-CD3-activated cells (Fig 8A,
line 2), and it was also inhibited by the specific peptide (Fig 8A,
line 3).

View larger version (41K):
[in this window]
[in a new window]
| Fig 8.
(A) Immunoprecipitation of supernatant and cell lysate
proteins from resting (left and right panels, line 1) and
anti-CD3-activated (left and right panels, line 2) 3DO
cells. Line 3, inhibition of cell lysate immunoprecipitation by
antagonist peptide. (B) Immunoprecipitation of supernatant and cell
lysate from resting (line 1) and anti-CD3-activated (line 2) spleen
cells. Resting and activated (anti-CD3, 1 µg/mL) cells were labeled
with [3H] leucine. The immunoprecipitation was performed
with anti-FasL-COOH antibody.
|
|
Contrary to FasL, FasLs mRNA was slightly evident in unstimulated 3DO
cells (Fig 3), and FasLs protein was also slightly detectable under our
experimental conditions in resting 3DO cells (Fig 8A, line 1).
The results reported above indicate that FasLs expression, like FasL,
is induced in activated T cells and also that FasLs could be expressed
in resting T cells.
To further analyze this point, we compared the FasLs expression in
untreated and anti-CD3-treated spleen T cells. Results in Fig 8B
indicate that FasLs, but not FasL, is detectable in resting spleen
cells and is upregulated in anti-CD3-activated cells when FasL is also
induced. Similar results were obtained with thymus cells (not shown).
 |
DISCUSSION |
These data describe the isolation of a new short FasL alternative
splicing (FasLs) that inhibits T-lymphocyte apoptosis.
Proteolytic cleavage of membrane-associated tumor necro- sis factor
(TNF), CD40L, or human FasL produces soluble products with less
functional activity than membrane-bound molecules, suggesting that the
purpose of ligand shedding is to attenuate the signal triggered by
receptor-ligand interaction.32 Furthermore, soluble forms of membrane receptors are produced either through the
proteolytic cleavage of membrane bound receptors (eg, the interleukin-2
[IL-2] and the human TNF receptors), translation products of
alternatively spliced mRNA (eg, the mouse IL-1, IL-4, or human Fas
receptors).24-26,33-35 These soluble forms are
truncated products of the membrane-bound receptors that prevent the
receptor-ligand interaction.33
The Fas/Fas-L system is involved in TCR/CD3-triggered apoptosis of
chronically stimulated T-cell clones or peripheral activated T cells.
In these models, TCR/CD3-induced apoptosis involves expression of the
FasL, which binds to the Fas receptor and triggers the death of
activated T cells.12,13,15-18 A similar mechanism has been
proposed for the activation induced cell death of murine T-cell
hybridomas, including the 3DO cell line, responding to immobilized
anti-CD3 MoAb.18,27,36 Furthermore, it has been shown that
soluble forms of Fas receptor derived from alternative splicing
products of Fas gene inhibit the Fas/FasL interaction and prevent
anti-Fas MoAb-induced apoptosis,24-26 suggesting that the
ratio between soluble and membrane-bound receptors may be critical in
the regulation of cell death.
The aim of our work was to determine whether alternative splicing
products of FasL might also control Fas/FasL-induced apoptosis. We
isolated an alternatively spliced product of the mouse FasL gene coding
for part of the extracellular domain of FasL protein. By analogy with
the soluble form of Fas receptor,24-26 this short form of
FasL (FasLs) may have an antagonist function, changing Fas/FasL
interaction and modulating cell death.
Because of the splicing, the cDNA encoding for FasLs lacks exons 2, 3, and part of exons 1 and 4. Short conserved sequences, at the end of the
introns, are found in 99% of pre-mRNA splice sites. The constant
presence of these sequences defines the splicing rule: an intron starts
with the GT and ends with AG dinucleotides.37,38 The
junction exon/intron of FasLs is characterized at the left of the
5' site by AG-GC, where GC is the dinucleotide
localized at the end of spliced intron, and at the right 3' site,
by AG-GT, where AG is once again the dinucleotide at the end of spliced intron. FasLs splicing conforms to the GT-AG rule, except for a C
instead of a T in the second position of 5' intron end. However, apparent exceptions, proving the splicing rule, include in fact 5' splice sites with C at the second position and an otherwise excellent match to consensus.37 Because of the splicing,
the ATG of full-length FasL cDNA was deleted. Nevertheless, the
possible translational initiation site of FasLs lacks the Kozak
consensus sequence.
The predicted FasLs mRNA encoded protein lacks the transmembrane, the
intracellular, and part of extracellular domain, resulting in a small
soluble form of FasL. A Mr protein of approximately 16 kD
recognized by anti-FasL-(COOH), but not anti-FasL-(NH2) antibody, was
detected in the cell lysates and in the supernatants of transfected
clones and anti-CD3-activated T cells (Figs 4 and 8), suggesting that
TCR-triggering upregulates FasLs and results in soluble protein
secretion, an effect that is not shared by FasL. Tanaka et
al21 detected cytotoxic activity against Fas-expressing cells in the supernatant of COS cells transfected with human, but not
murine, FasL cDNA. The active human agonist protein inducing apoptosis
was a smaller (27 kD) form of FasL.21 More recently, it has
been shown that a FasL soluble form can also inhibit cytotoxic activity
of membrane-bound FasL.39-41
Our functional studies demonstrate that FasLs does not induce
apoptosis. In fact, FasLs-transfected clones used as effectors in a
cytotoxic assay against a Fas+ target exhibited reduced
cytotoxicity. Furthermore, the supernatant of FasLs expressing cells
inhibited anti-Fas MoAb-induced apoptosis (Table 1), suggesting that
FasLs, like the soluble form of the Fas receptor, may have an
inhibitory function.
The cytotoxic soluble form of human FasL exists as a trimer, and
consideration of the structure of membrane-bound FasL suggests that it
has the potential to form a trimeric structure, which is the
prerequisite for receptor stimulation.39 In general, these
trimeric structures, which are common to most ligands in the TNF ligand
superfamily, induce receptor multimerization at the cell surface, which
is necessary for signal transduction.39 We could
hypothesize that FasLs that lacks part of the FasL molecule, including
the intracellular, the transmembrane, and part of the extracellular
portion, is unable to trimerize and consequently to activate the
apoptosis signal when bound to the receptor. On the other hand, FasLs
binding to Fas receptor (Fig 6) may cause the inhibition of
anti-Fas-mediated apoptosis (Table 1). Therefore, FasLs may have an
antagonistic activity and may be involved in the modulation of the
Fas/FasL-activated apoptosis.
In this respect, the observation that FasLs, but not FasL, is expressed
in resting T lymphocytes suggest that this short ligand is normally
produced, although at lower levels as compared with activated T cells
(Fig 8). It has been previously reported by many laboratories that
resting T cells, although not expressing FasL, do express Fas receptor,
although at a lower level as compared with activated
lymphocytes.11-19 Anti-CD3-mediated activation induces FasL and upregulates Fas expression.17 Based on these
observations, resting T cells can also be induced in apoptosis when
FasL from different activated T cells triggers the receptor. The
preferential splicing coding for the antagonist noncytotoxic FasLs
could contribute to protect resting T lymphocytes from the attack by
other FasL+ activated cells. When the resting lymphocyte is
activated, it also expresses the mRNA coding for the cytotoxic FasL and
overexpresses the pre-existing Fas. Fas/FasL interaction induces T-cell
death and then limits the activated T-lymphocyte expansion and
contributes to end the immune response.17
Moreover, the identification of a new FasL form with inhibiting
activity opens up further potential therapeutic approaches. As an
example, FasLs could be expressed in T lymphocytes to protect them
against the attack from FasL+ tumor cells or
in those tissues (eg, liver) that also can be destroyed via the
Fas/FasL system. However, although the present results
show that FasLs is expressed in normal lymphocytes, the possible in
vivo role in the regulation of Fas/FasL-mediated apoptosis remains a
matter of debate.
 |
FOOTNOTES |
Submitted February 3, 1999; accepted July 11, 1999.
Supported by Associazione Italiana Ricerca sul Cancro (AIRC) Milan,
MURST, and PF Biotecnologie, CNR, Rome, Italy.
The nucleotide FasLs sequence appears in the EMBL, GenBank, and DDBJ
Nucleotide Sequence Databases under the accession no. AF119335.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Carlo Riccardi, MD, PhD, Dept. Clin. Exp.
Med., University of Perugia, Via del Giochetto, 06100 Perugia, Italy;
e-mail: riccardi{at}unipg.it.
 |
REFERENCES |
1.
Wyllie AH, Kerr JFR, Currie AR:
Cell death: The significance of apoptosis.
Int Rev Cytol
68:251, 1980[Medline]
[Order article via Infotrieve]
2.
Golstein P, Ojcius DM, Young JD:
Cell death mechanisms and the immune system.
Immunol Rev
121:29, 1991[Medline]
[Order article via Infotrieve]
3.
Cohen JJ:
Apoptosis.
Immunol Today
14:126, 1993[Medline]
[Order article via Infotrieve]
4.
Osborne BA, Smith SW, Liu ZG, McLaughlin KA, Grimm L, Schwartz LM:
Identification of genes induced during apoptosis in T lymphocytes.
Immunol Rev
142:301, 1994[Medline]
[Order article via Infotrieve]
5.
Steller H:
Mechanisms and genes of cellular suicide.
Science
267:1445, 1995[Abstract/Free Full Text]
6.
Smith CA, Williams GT, Kingston R, Jenkinson EJ, Owen JJ:
Antibodies to CD3/T-cell receptor complex induce death by apoptosis in immature T cells in thymic cultures.
Nature
337:181, 1989[Medline]
[Order article via Infotrieve]
7.
Dent AL, Matis LA, Hooshmand F, Widacki SM, Bluestone JA, Hedrick SM:
Self-reactive gamma delta T cells are eliminated in the thymus.
Nature
343:642, 1990[Medline]
[Order article via Infotrieve]
8.
McDonald HR, Lees RK:
Programmed death of autoreactive thymocytes.
Nature
343:642, 1990
9.
Webb S, Morris C, Sprent J:
Extrathymic tolerance of mature T cells: Clonal elimination as a consequence of immunity.
Cell
63:1249, 1990[Medline]
[Order article via Infotrieve]
10.
Kawabe Y, Ochi A:
Programmed cell death and extrathymic reduction of Vbeta 8+ CD4+ T cells in mice tolerant to Staphylococcus aureus enterotoxin B.
Nature
349:245, 1991[Medline]
[Order article via Infotrieve]
11.
Kabelitz D, Pohl T, Pechhold K:
Activation-induced cell death (apoptosis) of mature peripheral T lymphocytes.
Immunol Today
14:338, 1993[Medline]
[Order article via Infotrieve]
12.
Yonehara S, Ishii A, Yonehara M:
A cell-killing monoclonal antibody (anti-Fas) to a cell surface antigen co-downregulated with the receptor of tumor necrosis factor.
J Exp Med
169:1747, 1989[Abstract/Free Full Text]
13.
Itoh N, Yonehara S, Ishii A, Yonehara M, Mizushima S, Sameshima M, Hase A, Seto Y, Nagata S:
The polypeptide encoded by the cDNA for human cell surface antigen Fas can mediate apoptosis.
Cell
66:233, 1991[Medline]
[Order article via Infotrieve]
14.
Rouvier E, Luciani MF, Golstein P:
Fas involvement in Ca(2+)-independent T cell-mediated cytotoxicity.
J Exp Med
177:195, 1993[Abstract/Free Full Text]
15.
Alderson MR, Tough TW, Davis-Smith T, Braddy S, Falk B, Schooley KA, Goodwin RG, Smith CA, Ramsdell F, Lynch DH:
Fas ligand mediates activation-induced cell death in human T lymphocytes.
J Exp Med
181:71, 1995[Abstract/Free Full Text]
16.
Dhein J, Walczak H, Bäumler C, Debatin KM, Krammer PH:
Autocrine T-cell suicide mediated by APO-1/(Fas/CD95).
Nature
373:438, 1995[Medline]
[Order article via Infotrieve]
17.
Lynch DH, Ramsdell F, Alderson MR:
Fas and FasL in the homeostatic regulation of immune responses.
Immunol Today
16:569, 1995[Medline]
[Order article via Infotrieve]
18.
Ju ST, Panka DJ, Cui H, Ettinger R, el-Khatib M, Sherr DH, Stanger BZ, Marshak-Rothstein A:
Fas(CD95)/FasL interactions required for programmed cell death after T-cell activation.
Nature
373:444, 1995[Medline]
[Order article via Infotrieve]
19.
Suda T, Takahashi T, Golstein P, Nagata S:
Molecular cloning and expression of the Fas ligand, a novel member of the tumor necrosis factor family.
Cell
75:1169, 1993[Medline]
[Order article via Infotrieve]
20.
Kayagaki N, Kawasaki A, Ebata T, Ohmoto H, Ikeda S, Inoue S, Yoshino K, Okumura K, Yagita H:
Metalloproteinase-mediated release of human Fas ligand.
J Exp Med
182:1777, 1995[Abstract/Free Full Text]
21.
Tanaka M, Suda T, Takahashi T, Nagata S:
Expression of the functional soluble form of human Fas ligand in activated lymphocytes.
EMBO J
14:1129, 1995[Medline]
[Order article via Infotrieve]
22.
Tanaka M, Suda T, Yatomi T, Nakamura N, Nagata S:
Lethal effect of recombinant human Fas ligand in mice pretreated with Propionibacterium acnes.
J Immunol
158:2303, 1997[Abstract]
23.
Douglas RG, Ware CF:
Fas-ligand: Privilege and peril.
Proc Natl Acad Sci USA
94:5986, 1997[Free Full Text]
24.
Cheng J, Zhou T, Liu C, Shapiro JP, Brauer MJ, Kiefer MC, Barr PJ, Mountz JD:
Protection from Fas-mediated apoptosis by a soluble form of the Fas molecule.
Science
263:1759, 1994[Abstract/Free Full Text]
25.
Cascino I, Fiucci G, Papoff G, Ruberti G:
Three functional soluble forms of the human apoptosis-inducing Fas molecule are produced by alternative splicing.
J Immunol
154:2706, 1995[Abstract]
26.
Hughes DP, Crispe IN:
A naturally occurring soluble isoform of murine Fas generated by alternative splicing.
J Exp Med
182:1395, 1995[Abstract/Free Full Text]
27.
Ayroldi E, Migliorati G, Cannarile L, Moraca R, Delfino DV, Riccardi C:
CD2 rescues T cell from T-cell receptor/CD3 apoptosis: A role for the Fas/Fas-L system.
Blood
89:3717, 1997[Abstract/Free Full Text]
28.
D'Adamio F, Zollo O, Moraca R, Ayroldi E, Bruscoli S, Bartoli A, Cannarile L, Migliorati G, Riccardi C:
A new dexamethasone-induced gene of the leucine zipper family protects T lymphocytes from TCR/CD3-activated cell death.
Immunity
7:803, 1997[Medline]
[Order article via Infotrieve]
29.
Nocentini G, Giunchi L, Ronchetti S, Krausz LT, Bartoli A, Moraca R, Migliorati G, Riccardi C:
A new member of the tumor necrosis factor/nerve growth factor receptor family inhibits T cell receptor-induced apoptosis.
Proc Natl Acad Sci USA
94:6216, 1997[Abstract/Free Full Text]
30.
Shimonkevitz R, Kappler J, Marrack P, Grey H:
Antigen recognition by H-2-restricted T cells. I. Cell-free antigen processing.
J Exp Med
158:303, 1983[Abstract/Free Full Text]
31.
Migliorati G, Nicoletti I, Pagliacci MC, D'Adamio L, Riccardi C:
Interleukin-4 protects double-negative and CD4 single-positive thymocytes from dexamethasone-induced apoptosis.
Blood
81:1352, 1993[Abstract/Free Full Text]
32.
Gruss HJ, Dower SK:
Tumor necrosis factor ligand superfamily: Involvement in the pathology of malignant lymphomas.
Blood
85:3378, 1995[Abstract/Free Full Text]
33.
Fernandez-Botran R:
Soluble cytokine receptors: Their role in immunoregulation.
FASEB J
5:2567, 1991[Abstract]
34.
Colotta F, Re F, Muzio M, Bertini R, Polentarutti N, Sironi M, Giri JG, Dower SK, Sims JE, Mantovani A:
Interleukin-1 type II receptor: A decoy target for IL-1 that is regulated by IL-4.
Science
261:472, 1993[Abstract/Free Full Text]
35.
Bjornberg F, Lantz M, Gullberg U:
Metalloproteases and serineproteases are involved in the cleavage of two tumor necrosis factor (TNF) receptors to soluble forms in the myeloid cell lines U-937 and THP-1.
Scand J Immunol
42:418, 1995[Medline]
[Order article via Infotrieve]
36.
Yang Y, Mercep M, Ware CF, Ashwell JD:
Fas and activation-induced Fas ligand mediate apoptosis of T cell hybridomas: Inhibition of Fas ligand expression by retinoic acid and glucocorticoids.
J Exp Med
181:1673, 1995[Abstract/Free Full Text]
37.
Jackson IJ:
A reappraisal of non-consensus mRNA splice sites.
Nucleic Acids Res
19:3595, 1991
38.
Mount SM:
AT-AC introns: An ATtACk on dogma.
Science
271:1690, 1996[Medline]
[Order article via Infotrieve]
39.
Nagata S:
Apoptosis by death factor.
Cell
88:355, 1997[Medline]
[Order article via Infotrieve]
40.
Suda T, Hashimoto H, Tanaka M, Ochi T, Nagata S:
Membrane Fas ligand kills human peripheral blood T lymphocytes, and soluble Fas ligand blocks the killing.
J Exp Med
186:2045, 1997[Abstract/Free Full Text]
41.
Tanaka M, Itai T, Adachi M, Nagata S:
Downregulation of Fas ligand by shedding.
Nat Med
4:31, 1998[Medline]
[Order article via Infotrieve]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
T. Revil, J. Toutant, L. Shkreta, D. Garneau, P. Cloutier, and B. Chabot
Protein Kinase C-Dependent Control of Bcl-x Alternative Splicing
Mol. Cell. Biol.,
December 15, 2007;
27(24):
8431 - 8441.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Brunlid, J. Pruszak, B. Holmes, O. Isacson, and K.-C. Sonntag
Immature and Neurally Differentiated Mouse Embryonic Stem Cells Do Not Express a Functional Fas/Fas Ligand System
Stem Cells,
October 1, 2007;
25(10):
2551 - 2558.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Castellano, B. Vire, M. Pion, V. Quivy, D. Olive, I. Hirsch, C. Van Lint, and Y. Collette
Active Transcription of the Human FASL/CD95L/TNFSF6 Promoter Region in T Lymphocytes Involves Chromatin Remodeling: ROLE OF DNA METHYLATION AND PROTEIN ACETYLATION SUGGEST DISTINCT MECHANISMS OF TRANSCRIPTIONAL REPRESSION
J. Biol. Chem.,
May 26, 2006;
281(21):
14719 - 14728.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Li, Y.-H. Song, J. Mohler, and P. Delafontaine
ANG II induces apoptosis of human vascular smooth muscle via extrinsic pathway involving inhibition of Akt phosphorylation and increased FasL expression
Am J Physiol Heart Circ Physiol,
May 1, 2006;
290(5):
H2116 - H2123.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. L Gavin, D. Ait-Azzouzene, C. F. Ware, and D. Nemazee
{Delta}BAFF, an Alternate Splice Isoform That Regulates Receptor Binding and Biopresentation of the B Cell Survival Cytokine, BAFF
J. Biol. Chem.,
October 3, 2003;
278(40):
38220 - 38228.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|