|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 10 (November 15), 1999:
pp. 3516-3522
Analysis of the B-Cell Receptor B29 (CD79b) Gene in Familial
Chronic Lymphocytic Leukemia
By
Béatrice Payelle-Brogard,
Christian Magnac,
Francesca R. Mauro,
Franco Mandelli, and
Guillaume Dighiero
From the Unité d'Immunohématologie et
d'Immunopathologie, Institut Pasteur, Paris, France; and the
Dipartimento di Biotecnologie Cellulari ed Ematologia, Università
di Roma "La Sapienza", Rome, Italy.
 |
ABSTRACT |
The B-cell antigen receptor (BCR) comprises membrane Igs (mIgs) and
a heterodimer of Ig (CD79a) and Ig (CD79b) transmembrane proteins, encoded by the mb-1 and B29 genes, respectively. These accessory proteins are required for surface expression of mIg and BCR
signaling. B cells from chronic lymphocytic leukemia (B-CLL) frequently
express low to undetectable surface Ig, as well as CD79b protein.
Recent work described genetic aberrations affecting B29 expression
and/or function in B-CLL. Because the prevalence of CLL is increased
among first degree relatives, we analyzed the B29 gene in 10 families
including 2 affected members each. A few silent or replacement
mutations were observed at the genomic level, which never lead to
truncated CD79b protein. Both members of the same family did not harbor
the same mutations. However, a single silent base change in the B29
extracellular domain, corresponding to a polymorphism, was detected on
1 allele of most patients. These results indicate that the few
mutations observed in the B29 gene in these patients do not induce
structural abnormalities of the CD79b protein and thus do not account
for its low surface expression in B-CLL. Furthermore, genetic factors
were not implicated, because identical mutations were not observed
among 2 members of the same family.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
B-CELL CHRONIC LYMPHOCYTIC leukemia
(B-CLL), the leukemia with highest incidence in western countries, is a
neoplastic disease characterized by a progressive accumulation of
functionally incompetent, long-lived, small, mature lymphocytes in the
blood, bone marrow, and lymphoid tissues.1,2
B-CLL lymphocyte is characterized by (1) expression of CD5
antigen3; (2) constant expression of low amounts of surface
Ig (sIg)4,5 and CD79b6,7; (3) inability to
adequately respond when stimulated through the B-cell receptor (BCR)
pathway8,9; (4) resistance to infection by the Epstein-Barr
Virus (EBV), in contrast with normal CD5+ B cells, despite
expressing the CD21 molecule10; (5) autoreactive binding
specificities10,11; (6) a prolonged G0 phase; and (7) overexpression of the bcl-2 protein.12
In B-CLL, B lymphocytes express low amounts of sIg. sIg on B cells bind
noncovalently with a heterodimer Ig (CD79a)/Ig (CD79b) to
constitute the B-cell antigen receptor (BCR).13,14 CD79a and CD79b are encoded by the mb-1 and B29 genes, respectively. Both
proteins contain an extracellular Ig-like domain, a transmembrane segment, and a cytoplasmic tail, which contains a motif sequence including 2 tyrosine residues. Phosphorylation of these tyrosine residues upon Ag receptor stimulation initiates signal transduction cascades.15 In addition, association of Ig with CD79a and
CD79b is essential for intracellular transport and subsequent surface expression of this BCR16,17 and plays a major role in
antigen internalization and induction of apoptosis through the BCR
pathway.18
Defects in the BCR may account for functional impairment in BCR
signaling. In addition to low expression of sIg, it was also reported
that the vast majority of B-CLL patients also express low to
undetectable amounts of CD79b extracellular domain.6,7
A study of mRNA in B-CLL by Thompson et al7 has recently
shown that, whereas B29 mRNA was undetectable in half of their B-CLL
samples, it was detected in the other samples at a level identical to
that of normal B cells. However, B-CLL cells with a normal level of B29
mRNA had point mutations, insertions, or deletions in the B29
transmembrane and cytoplasmic domains, which could account for the low
CD79b surface expression.
The possibility that genetic or familial factors may predispose to CLL
is suggested by reports of multiple instances of the disease in some
families, indicating a 2- to 7-fold excess risk in first degree
relatives.19,20 In addition, the low incidence of CLL among
individuals of Japanese origin, including those having migrated to
Hawaii, suggests that genetic influences may play a stronger role than
environmental factors in the pathogenesis of the disease.21
However, the nature of the genetic predisposition remains unknown.
It is presently unclear whether the BCR could play a major role in the
pathogenesis of the disease and whether the above-mentioned genetic
defects observed in CD79b gene could constitute a primary event in
B-CLL leukemogenesis. The study of familial cases should help address
this question. We report a study at the genomic level of the B29 gene
in 10 families, each with 2 siblings manifesting typical CLL. We found
only a few mutations leading to amino acid replacement, none of which
would be predicted to result in structural alterations of the CD79b
protein. Because identical mutations of the B29 gene were not found in
both affected siblings in the same family, genetics factors involving
CD79b may not play a major role in CLL pathogenesis.
| |
MATERIALS AND METHODS |
Patients.
Total blood samples from 10 different Italian families, including 2 members affected with CLL, were stored at  20°C in the Clinica de la Sapienza (Rome, Italy). Families 1 through 8 have been
studied for the VH gene expression of their Ig.21a Families 13 and 14 have been added in this study. All of the patients studied demonstrated typical CD5+ B-CLL. They comprised 9 men and
11 women aged from 35 to 95 years who were staged at diagnosis
following Binet' staging22 (stage A, 14 patients; stage B,
4; stage C, 1; in 1 case, stage could not be determined). Two patients
progressed to stage B during evolution. At the time of the study, 5 patients had received previous treatment, whereas 15 patients did not
receive any previous treatment.
DNA extraction.
Total DNA was purified from up to 10 mL of whole citrated blood with
the QIAamp Blood Maxi kit (QIAGEN, Hilden, Germany). The purified DNA
ranged in size up to 50 kb, with fragments of approximately 30 kb
predominating. DNA yields ranged from 15 to 600 µg according to the
cell densities.
Polymerase chain reaction (PCR) amplification.
PCR amplification was performed with genomic DNA using Taq DNA
polymerase (GIBCO-BRL, Bethesda, MD) and 2 sets of oligonucleotides for
the B29 gene. The first one, designed to amplify the Ig domain and the
transmembrane region, consisted of the forward primer 5'GTAGTGCTTGTTCGCGGATC3' (corresponding to nucleotides
2006-2025 in the DNA sequence23) and the reverse primer
5'CTTGTCCAGCAGCAGGAAGA3' (corresponding to nucleotides
2824-2805). The second one, designed to amplify the intracytoplasmic
domain, consisted of the forward primer
5'GATGACAGCAAGGCTGGCAT3' (nucleotides 3122-3141) and the reverse primer 5'CTCCTGGCCTGGGTGCTCA3' (3368-3350).
Thirty cycles of amplification were performed under the following
conditions: 95°C for 30 seconds, 60°C for 30 seconds (for Ig
domain and transmembrane segment) or 65°C for 30 seconds (for intracytoplasmic domain), and 72°C for 1 minute.
Amplification of VH Ig genes was performed from genomic DNA
using 5' primers designed to anneal to the leader sequence
(LH) of VH1 to VH6 families,
and a consensus JH 3' primer. The LH
primers consisted of the following: LH1:
5'CCATGGACTGGACCTGG3'; LH2:
5'ATGGACACACTTTGCTMCAC3'; LH3:
5'CCATGGAGTTTGGGCTGAGC3'; LH4:
5'ATGAAACACCTGTGGTTCTTCC3'; LH5:
5'ATGGGGTCAACCGCCATCC3'; and LH6:
5'ATGTCTGTCTCCTTCCTCATC3'. The consensus JH
primer consisted of 5'ACCTGAGGAGACGGTGACCAGGGT3'. In all
cases, 30 cycles of amplification (95°C for 30 seconds, 65°C
for 30 seconds, and 72°C for 1 minute) were performed.
Cloning and sequencing of B29 and VH Ig genes.
PCR products were gel purified and subcloned into a TA cloning vector,
followed by transformation into INVF' cells (Invitrogen, San
Diego, CA). Recombinant plasmids were purified and sequence analysis
was performed.
Nucleotide sequence data of VH Ig genes were analyzed and
compared with the GenBank database (Bethesda, MD). The
complete sequences have been contributed to GenBank for families 1 to 8 (accessions nos. AF087415-AF087430) .
| |
RESULTS |
Clinical and biological data in 10 families affected with CLL.
Ten families, each with 2 members affected with CLL, were studied.
Clinical and biological data concerning these patients are reported in
Table 1. Except for 2 patients (1A and
14B), they all had lymphocytosis, whether treated or not. It can be observed in the 6 families with vertical transmission of the disease that the mean age of the parental generation was 81 years as compared with a mean of 50 years for the second generation. This earlier appearance of CLL in the second generation suggested that genetic factors could influence the development of the disease.
Analysis of mutations in B29 DNA from B-CLL cells.
DNA from 20 patients corresponding to the 10 families described above
had the B29 gene sequenced. For each B-CLL sample analyzed, 2 classes
of B29 DNA clones were identified in the PCR-generated clones
corresponding to both B29 alleles. Mutations identified on the B29 DNA
sequence are described in Tables 2 and
3. In all patients (except
patient 3B), 1 allele had the silent mutation TGT TGC at amino
acid position 122 (Cys) in the Ig domain (Table 2), corresponding to a
polymorphism of the B29 sequence. In the Ig domain, only 1 other silent
mutation was observed (patient 1A), whereas 7 replacement mutations
producing an amino acid change were noted in 7 patients: patient 1A at
position 56 (Lys Arg), 13A at position 56 (Lys Glu), 2A at position 61 (Val Ala), 4B at position 66 (Tyr
His), 5B at position 72 (Gly Ser), 3B at position
99 (Ser Phe), and 2B at position 102 (Glu Gly). These mutations do not affect known important sites of this domain, namely the 5 extracellular cysteine residues allowing for intrachain and interchain (with Ig) S-S bonds or the 4 glycosylation sites on
the Asn residues. Concerning the transmembrane portion, 1 silent mutation was observed in patient 4A at amino acid position 145, whereas
4 replacement mutations at positions 145 (Phe Ser), 167 (Leu
Pro), 169 (Ile Leu), and 169 (Ile Thr)
were noted in patients 4B, 14A, 5B, and 7B, respectively. Mutations in
the intracytoplasmic domain were detected in only 4 patients (Table 3):
2 silent mutations at amino acid position 192 in patient 6A and 193 in
patient 14B and 2 replacement mutations at amino acid position 202 (Asp
Asn) and 223 (Gly Ser) in patients 2A and 5A,
respectively. The Tyr residues, substrates for phosphorylation, were
not affected by the mutations. All of the replacement mutations of the
B29 gene are described in Fig 1.
View larger version (23K):
[in this window]
[in a new window]
| Fig 1.
Replacement mutations in B29 genes. Among 20 patients
affected with CLL, 10 express replacement mutations in 1 allele of
their B29 gene; 1 patient, 5B, expresses replacement mutation on both
alleles (1) and (2). Ig domain, Ig-like domain; TM, transmembrane
segment; intracytoplasmic, intracytoplasmic domain. Underlined amino
acids correspond to the replacement mutations.
|
|
The only identical mutation observed between 2 members of the same
family was the silent TGT TGC (amino acid position 122) in
the Ig domain. We never observed another identical silent or replacement mutation between both members from the 10 different families.
As we used whole blood for DNA extraction because blood samples were
stored as pellets at 20°C and fresh cells were not
available, the possibility exists that the amplified B29 gene could be
derived from nontumoral cells such as T cells, neutrophils, and
monocytes. However, the majority of patients included in this study
displayed high numbers of monoclonal B cells. In these conditions, most patients had a remarkable excess of neoplastic DNA used for the PCR
amplification and sequencing; thus, any important deletion or insertion
affecting the B29 gene should not escape detection.
VH gene usage.
The composition of the H chain variable domain sequences obtained from
the 20 patients with familial clustering of CLL is summarized in
Table 4. The VH distribution
(VH1, 10%; VH2, 0%; VH3, 4%;
VH4, 30%; VH5, 10%; and VH6, 5%)
is close to that corresponding to the normal complexity of the system
(VH1, 22%; VH2, 6%; VH3, 43%;
VH4, 22%; VH5, 6%; and VH6, 2%),
except for VH2, which is not represented in our familial
cases. Among the 18 patients whose VH genes have been
sequenced, 14 cases expressed less than 98% similarity with the
germinal counterpart, and 11 of 18 had less than 95% similarity. Among
these 11 cases, 8 presented a CDR/FR rate of mutation greater than 0.3, which could suggest, at least for some cases, the existence of an
antigen-driven selection process.21a
| |
DISCUSSION |
The B-CLL lymphocyte differs from the normal
CD5+ B cell by constant expression of low amounts of
surface Ig and CD79b4,5; resistance to infection by the EBV
virus, despite expressing the CD21 molecule10; inability to
adequately respond when stimulated through the BCR
pathway8,9; and overexpression of the bcl-2 protein.12 It remains unknown whether some of the
particular characteristics of the B-CLL lymphocyte could be
malignancy-related.
Because genetic or familial factors have been suggested in the etiology
of CLL19,20 and genetic aberrations were reported to exist
at the level of the B29 gene,7 we were interested in
studying the B29 gene in several families who had 2 affected members
each. The excess risk of CLL for individuals with affected first degree
relatives suggests that familial CLL might constitute a useful model to
study the pathogenesis of this disease, as has been the case in other
neoplastic disorders. However, previous studies in familial CLL cases
failed to show the presence of consistent chromosomal or proto-oncogene
abnormalities.24,25 We could not perform such karyotypic
studies on our patients, because the material we studied here consisted
of blood samples frozen at 20°C. Furthermore,
the number of cases reporting common HLA phenotypes among affected CLL
siblings is small.19,26,27 The study of family histories or
family trees from our series shows evidence favoring a vertical
transmission, which may be consistent with the expression of an
autosomal dominant gene. Anticipation as defined by worsening severity
or earlier age at onset with each generation for an inherited disease
has been reported to occur in familial cases of CLL. In a recent series
of 9 parent-child pairs with CLL,28 8 showed younger ages
at onset in the child and showed a mean decline in age at onset of 21 years, with very similar results found in a British
study.29 This suggests that dynamic mutation of unstable
DNA sequence repeats could be a common mechanism of inherited
hematopoietic malignancy, with implications for the role of somatic
mutation in the more frequent sporadic cases. In the 6 families from
our series in which a vertical transmission was observed, the mean age
of the parental generation was 81 years as compared with a mean age of
50 years for the second generation, which is lower than the mean age of
64 years found in French series.30 Because sampling bias is
unlikely to explain these findings, these results could point to the
existence among familial CLL patients of another genetic mechanism for
developing disease.
In B cells, the CD79b protein is supposed to be essential in the
transport of sIg to the membrane,16,17 initiation of signal transduction through the BCR,15 and
apoptosis.18 Thus, a defect in expression of this protein
may play a major role in the pathophysiology of the disease. Recent
work indicating the presence of genetic aberrations leading to affected
expression and/or function in B-CLL patients suggests that these
alterations could have a genetic origin.7 To better define
whether these aberrations could play a primary role in CLL
leukemogenesis, we have sequenced the B29 gene at the genomic level in
10 different families including 2 affected members each.
Our results demonstrated that some mutations were present either in the
Ig, transmembrane, or cytoplasmic domains of the CD79b protein, but we
never observed any insertion or deletion in the B29 gene leading to a
truncated protein. Indeed, we have not screened normal genomic DNA for
mutations in B29 gene, but the few published sequences derived from
normal subjects showed the presence of some polymorphism such as the
TGT or TGC in AA position 12231 that we frequently found in
our series. Thus, because the few mutations described in the present
work have not been reported before in normal B29 gene sequence, it is
difficult to conclude whether they correspond to new polymorphisms or
whether they are CLL related. However, they are not genetically
determined, because they never occured at the same position among 2 members of the same family.
Our results are in accordance with those reported by Rassenti et
al,32 who studied unrelated patients affected with CLL and
also failed to observe deletion or insertion in Ig, transmembrane, or
cytoplasmic domains, but only base substitutions. Thus, our familial
CLL did not differ from these common CLL cases. However, both our
series and that from Rassenti et al32 differ with the results reported by Thompson et al,7 who demonstrated by
sequencing cDNA clones generated from B-CLL cell B29 mRNA, that point
mutations, insertions, or deletions, largely located in the B29
transmembrane and cytoplasmic domains, affected B29 expression and/or
function. This discrepancy with our data could result from a different
origin of the 10 families studied here, but the present findings
exclude, at least in our ethnic group, the presence of causal
mutations. Both alleles were sequenced and genetic alterations were not
detected in paternal and maternal alleles. The few mutations observed
here did not induce structural abnormalities of the protein, which could explain its low expression in CLL; furthermore, these mutations are not coding for amino acids involved in the intrachain or interchain bonds between the CD79b and CD79a proteins, namely the Cys of the Ig
domain, glycosylation sites, or intracytoplasmic sites for
phosphorylation. Thus, the function of the CD79b protein would not be
predicted to be affected by these mutations.
Analysis of the VH gene usage among these 10 families
affected with CLL showed a higher level of mutation than that described in previous studies concerning unrelated patients,33,34 and the vast majority of the CLL variable domains contained a high degree
of somatic mutation and exhibited an excess of replacement mutations in
the CDR intervals. These findings suggest that familial CLL cases may
preferentially derive from B-cell progenitors that have responded to
antigen.21a
Because our results appear to exclude the possibility that a genetic
defect could account for the low expression of the CD79b molecule in
B-CLL, it would be interesting to study the possibility that the low
expression of the CD79b protein on the B-CLL could result from a
mechanism of alternative splicing. This event could result in
overexpression of a truncated CD79 transcript form, which lacks exon 3, encoding for the extracellular domain of this molecule, and low if any
expression of the complete CD79b transcript. Previous work has shown
that both transcripts exist in B cells in normal
conditions,35 although activated B cells inverse relative expression of the truncated form.36 Thus, the possibility
exists that low expression of CD79b in CLL could result from
preferential transcription of the truncated CD79b form. Although this
possibility needs to be tested, results from Thompson el
al7 indicate that transcripts coding for the complete
protein are found in consistent amounts in at least half of the CLL
patients they have studied. Most of these patients were expressing low
to undetectable amounts of the CD79b membrane protein, indicating that
CD79b expression may not be exclusively explained by the absence of
complete transcripts.
In these conditions, the possibility that a defect at the
posttranscriptional level accounting for the discrepancy between the
presence of adequate transcripts and very low expression of CD79b and
sIg needs to be considered. This defect could occur at the level of
intracellular synthesis, could consist of accelerated proteolysis of
CD79b and sIg proteins, or in inadequate transport of the BCR to the
cell membrane as described on tolerant B lymphocytes.37
| |
FOOTNOTES |
Submitted November 4, 1998; accepted July 7, 1999.
Supported by Grant No. 98003512 from the Fondation contre la
Leucémie and Grant No. 9734 from the Association pour la
Recherche sur le Cancer.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Béatrice Payelle-Brogard,
PhD, Unité d'Immunohématologie et
d'Immunopathologie, Institut Pasteur, 25 rue du Dr Roux, 75724 Paris
Cedex 15, France.
| |
REFERENCES |
1.
Dameshek W:
Chronic lymphocytic leukemia an accumulative disease of immunologically incompetent lymphocytes.
Blood
29:566, 1967[Abstract/Free Full Text]
2.
Dighiero G, Travade P, Chevret S, Fenaux P, Chastang C, Binet JL:
B-cell chronic lymphocytic leukemia. Present status and future directions.
Blood
78:1901, 1991[Free Full Text]
3.
Boumsell L, Bernard A, Lepage V:
Some chronic lymphocytic leukemia cells bearing surface immunoglobulins share determinants with T cells.
Eur J Immunol
8:900, 1978[Medline]
[Order article via Infotrieve]
4.
Dighiero G, Bodega E, Mayzner R, Binet JL:
Individual cell-by-cell quantitation of lymphocyte surface membrane Ig in normal and CLL lymphocytes and during ontogeny of mouse B lymphocytes by immunoperoxydase assay.
Blood
55:93, 1980[Abstract/Free Full Text]
5.
Ternynck T, Dighiero G, Follezou JY, Binet JL:
Comparison of normal and CLL lymphocyte surface Ig determinants using peroxidase-labeled antibodies. I. Detection and quantitation of light chain determinants.
Blood
43:789, 1974[Abstract/Free Full Text]
6.
Zomas AP, Matutes E, Morilla R, Owusu-Ankomah K, Seon BK, Catovsky D:
Expression of the immunoglobulin-associated protein B29 in B cell disorders with the monoclonal antibody SN8 (CD79b).
Leukemia
10:1966, 1996[Medline]
[Order article via Infotrieve]
7.
Thompson AA, Talley JA, Do HN, Kagan HL, Kunbel L, Berenson J, Cooper MD, Saxon A, Wall R:
Aberrations of the B-cell receptor B29 (CD79b) gene in chronic lymphocytic leukemia.
Blood
90:1387, 1997[Abstract/Free Full Text]
8.
Karray S, Merle-Beral H, Vazquez A, Gérard JP, Debré P, Galanaud P:
Functional heterogeneity of B-CLL lymphocytes: Dissociated responsiveness to growth factors and distinct requirements for a first activation signal.
Blood
70:1105, 1987[Abstract/Free Full Text]
9.
Michel F, Merle-Beral H, Legac E, Michel A, Debré P, Bismuth G:
Defective calcium response in B-chronic lymphocytic leukemia cells. Alteration of early protein tyrosine phosphorylation and of the mechanism responsible for cell calcium influx.
J Immunol
150:3627, 1993
10.
Borche L, Lim A, Binet JL, Dighiero G:
Evidence that chronic lymphocytic leukemia B lymphocytes are frequently committed to production of natural autoantibodies.
Blood
76:562, 1990[Abstract/Free Full Text]
11.
Bröker BM, Klajman A, Youinou P, Jouquan J, Worman CP, Murphy J, Mackenzie L, Quartey-Papafio R, Blaschek M, Collins P, Lal S, Lydyard PM:
Chronic lymphocytic leukemic (CLL) cells secrete multispecific autoantibodies.
J Autoimmun
1:469, 1988[Medline]
[Order article via Infotrieve]
12.
Schena M, Larsson LG, Gottardi D, Gaidano G, Carlsson M, Nilsson K, Caligaris-Cappio F:
Growth- and differentiation-associated expression of bcl-2 in B-chronic lymphocytic leukemia cells.
Blood
79:2981, 1992[Abstract/Free Full Text]
13.
Reth M:
Antigen receptors on B lymphocytes.
Annu Rev Immunol
10:97, 1992[Medline]
[Order article via Infotrieve]
14.
van Noesel CI, van Lier RA:
Architecture of the human B-cell antigen receptors.
Blood
82:363, 1993[Free Full Text]
15.
Sanchez M, Misulovin Z, Burkhardt AL, Mahajan S, Costa T, Franke R, Bolen JB, Nussenzweig M:
Signal transduction by immunoglobulin is mediated through Ig alpha and Ig beta.
J Exp Med
178:1049, 1993[Abstract/Free Full Text]
16.
Venkitaraman AR, Williams GT, Dariavach P, Neuberger MS:
The B-cell antigen receptor of the five immunoglobulin classes.
Nature
352:777, 1991[Medline]
[Order article via Infotrieve]
17.
Sitia R, Neuberger MS, Milstein C:
Regulation of membrane IgMexpression in secretory B cells: Translational and post-translational events.
EMBO J
6:3969, 1987[Medline]
[Order article via Infotrieve]
18.
Tseng J, Eisfelder BJ, Clark MR:
B-cell antigen receptor-induced apoptosis requires both Ig and Ig.
Blood
89:1513, 1997[Abstract/Free Full Text]
19.
Conley CL, Misiti J, Laster AJ:
Genetic factors predisposing to chronic lymphocytic leukemia and to autoimmune disease.
Medicine
59:323, 1980[Medline]
[Order article via Infotrieve]
20.
Linet MS, Van Natta ML, Brookmeyer R, Khoury MJ, McCaffrey LD, Humphrey RL, Szklo M:
Famillial cancer history and chronic lyphocytic leukemia. A case-control study.
Am J Epidemiol
130:655, 1989[Abstract/Free Full Text]
21.
Finch SC, Linet MS:
Chronic leukemias.
Baillieres Clin Hematol
5:27, 1992[Medline]
[Order article via Infotrieve]
21a. Pritsch O, Troussard X, Magnac C, Mauro F, Davi F,
Payelle-Brogard B, Macro M, Dumas G, Pulik M, Clerget F, Mandelli F,
Chiorazzi N, Schroeder HW Jr, Leporrier M, Dighiero G: VH gene usage by
family members affected with chronic lymphocytic leukemia. Br J
Haematol (in press)
22.
Binet JL, Auquier A, Dighiero G, Chastang C, Piguet H, Goasguen J, Vaugier G, Potron G, Colona P, Oberling F, Thomas M, Tchernia G, Jacquillat C, Boivin P, Lesty C, Duault MT, Monconduit M, Belabbes S, Gremy F:
A new prognostic classification of chronic lymphocytic leukemia derived from a multivariate survival analysis.
Cancer
48:198, 1981[Medline]
[Order article via Infotrieve]
23.
Hashimoto S, Chiorazzi N, Gregersen PK:
The complete sequence of the human CD79b (Ig/B29) gene: Identification of a conserved exon/intron organization, immunoglobulin-like regulatory regions, and allelic polymorphism.
Immunogenetics
40:145, 1994[Medline]
[Order article via Infotrieve]
24.
Dighiero G, Travade P, Chevret S, Fenaux P, Chastang C, Binet JL:
B-cell chronic lymphocytic leukemia. Present status and future directions. French Cooperative Group on CLL.
Blood
78:1901, 1991
25.
Linet MS, Blattner WA:
The epidemiology of chronic lymphocytic leukemia, in
Polliack A,
Catovsky D
(eds):
Chronic Lymphocytic Leukemia. Chur, Switzerland, Harwood Academic, 1988, p 11
26.
Schweitzer M, Melief CJM, Ploem JE:
Chronic lymphocytic leukaemia in 5 siblings.
Scand J Haematol
11:97, 1973[Medline]
[Order article via Infotrieve]
27.
Linet MS, Bias WB, Dorgan JF, McCaffrey LD, Humphrey RL:
HLA antigens in chronic lymphocytic leukemia.
Tissue Antigens
31:71, 1988[Medline]
[Order article via Infotrieve]
28.
Horwitz M, Goode EL, Jarvik GP:
Anticipation in familial leukemia.
Am J Hum Genet
59:990, 1996[Medline]
[Order article via Infotrieve]
29.
Catovsky D:
The search for genetic clues in chronic lymphocytic leukemia.
Hematol Cell Ther
39:S5, 1997
30.
Dighiero G, Maloum K, Desablens B, Cazin B, Navarro M, Leblay R, Leporrier M, Jaubert J, Lepeu G, Dreufus B, Binet JL, Travade P:
Chlorambucil in indolent chronic lymphocytic leukemia.
N Engl J Med
338:1506, 1998[Abstract/Free Full Text]
31.
Hashimoto S, Gregersen PK, Chiorazzi N:
The human Ig- cDNA sequence, a homologue of murine B29, is identical in B cell and plasma cell lines producing all the human Ig isotypes.
J Immunol
150:491, 1993[Abstract]
32.
Rassenti LZ, Padmanabha S, Kipps TJ:
Expression of the B-cell receptor Ig beta (CD79b) in chronic lymphocytic leukemia.
Blood
90:454a, 1997 (abstr, suppl 1)
33.
Schroeder HW, Dighiero G:
The pathogenesis of chronic lymphocytic leukemia: Analysis of the antibody repertoire.
Immunol Today
15:288, 1994[Medline]
[Order article via Infotrieve]
34.
Fais F, Ghiotto F, Hashimoto S, Sellars B, Allen SL, Schulman P, Vinciguerra VP, Rai K, Rassenti L, Kipps TJ, Dighiero G, Schroeder HW, Ferrarini M, Chiorazzi N:
Chronic lymphocytic leukemia B cells express restricted sets of mutated and unmutated antigen receptors.
J Clin Invest
102:1515, 1998[Medline]
[Order article via Infotrieve]
35.
Hashimoto S, Chiorazzi N, Gregersen PK:
Alternative splicing of CD79a (Ig-alpha/mb-1) and CD79b (Ig-beta/B29) RNA transcripts in human B cells.
Mol Immunol
32:651, 1995[Medline]
[Order article via Infotrieve]
36.
Koyama M, Nakamura T, Higashihara M, Herren B, Kuwata S, Shibata Y, Okumura K, Kurokawa K:
The novel variants of mb-1 and B29 transcripts generated by alternative mRNA splicing.
Immunol Lett
47:151, 1995[Medline]
[Order article via Infotrieve]
37.
Bell SE, Goodnow CC:
A selective defect in IgM antigen receptor synthesis and transport causes loss of cell surface IgM expression on tolerant B lymphocytes.
EMBO J
13:816, 1994[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. L. Duquette, M. D. Huber, and N. Maizels
G-Rich Proto-Oncogenes Are Targeted for Genomic Instability in B-Cell Lymphomas
Cancer Res.,
March 15, 2007;
67(6):
2586 - 2594.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. R. Weiler and J. L. Bankers-Fulbright
Common Variable Immunodeficiency: Test Indications and Interpretations
Mayo Clin. Proc.,
September 1, 2005;
80(9):
1187 - 1200.
[Abstract]
[PDF]
|
|
|
|
|
|
|
F. Vuillier, G. Dumas, C. Magnac, M.-C. Prevost, A. I. Lalanne, P. Oppezzo, E. Melanitou, G. Dighiero, and B. Payelle-Brogard
Lower levels of surface B-cell-receptor expression in chronic lymphocytic leukemia are associated with glycosylation and folding defects of the {micro} and CD79a chains
Blood,
April 1, 2005;
105(7):
2933 - 2940.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. K. Stevenson and F. Caligaris-Cappio
Chronic lymphocytic leukemia: revelations from the B-cell receptor
Blood,
June 15, 2004;
103(12):
4389 - 4395.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. S. Gordon, C. M. Kanegai, J. R. Doerr, and R. Wall
Somatic hypermutation of the B cell receptor genes B29 (Igbeta , CD79b) and mb1 (Igalpha , CD79a)
PNAS,
April 1, 2003;
100(7):
4126 - 4131.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. S. Cragg, H. T. C. Chan, M. D. Fox, A. Tutt, A. Smith, D. G. Oscier, T. J. Hamblin, and M. J. Glennie
The alternative transcript of CD79b is overexpressed in B-CLL and inhibits signaling for apoptosis
Blood,
October 16, 2002;
100(9):
3068 - 3076.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B.-S. Lee, X. Alvarez, S. Ishido, A. A. Lackner, and J. U. Jung
Inhibition of Intracellular Transport of B Cell Antigen Receptor Complexes by Kaposi's Sarcoma-Associated Herpesvirus K1
J. Exp. Med.,
July 3, 2000;
192(1):
11 - 22.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION
