|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, Vol. 94 No. 10 (November 15), 1999:
pp. 3567-3575
By
From the Département de Pathologie and EA 2348, the Service
d'Hématologie Clinique, AP-HP, Hôpital Henri Mondor,
Créteil, France; INSERM U 474, Créteil, France; the Service
d'Anatomie et de Cytologie Pathologiques, Hôpital Laennec,
Paris, France; the Centro de Biologia Molecular "Severo Ochoa,"
Universidad Autonoma de Madrid and Consejo Superior de Investigaciones
Cientificas, Cantoblanco, Madrid, Spain.
Primary mediastinal large B-cell lymphoma (PMBL) appears to be a
distinct clinicopathologic entity among diffuse large B-cell lymphomas
(DLBLs). To find molecular alterations associated with this disease, we
compared the mRNAs expressed in 3 PMBLs and 3 peripheral DLBLs by
differential display-reverse transcription (DDRT) and identified a mRNA
specifically expressed in PMBLs. Sequence analysis showed that this
mRNA is encoded by the MAL gene, the expression of which
was shown to be restricted to the T-cell lineage during hematopoiesis.
MAL gene expression was demonstrated by Northern blot and reverse
transcription-polymerase chain reaction (RT-PCR) in 8 of
12 PMBLs. However, there was little or no MAL gene expression in 8 peripheral DLBLs. Immunohistochemical analysis evidenced expression of
MAL protein in tumoral B cells restricted to the PMBL subtype. Finally,
Southern blot studies did not demonstrate rearrangement of the MAL
gene. Altogether, our results indicate that MAL expression is recurrent
in PMBLs, providing further evidence that PMBL represents a distinct
entity among DLBLs. Because MAL protein is located in
detergent-insoluble glycolipid-enriched membrane (GEM) domains involved
in lymphocyte signal transduction, abnormal expression of MAL protein
in the B-lymphoid lineage may have significant implications in PMBL lymphomagenesis.
DIFFUSE LARGE B-CELL lymphomas (DLBLs)
account for 30% to 40% of adult non-Hodgkin's lymphomas and
constitute a heterogeneous group of lymphoid neoplasms with a wide
spectrum of morphological and clinical features, treatment response,
and prognosis.1 The genetic basis of this heterogeneity
remains poorly understood, and identification of new molecular markers
has been the focus of numerous studies in the past few years. In the
Revised European-American classification of Lymphoid neoplasms (REAL
classification), DLBLs encompass 3 major histological subtypes, namely
centroblastic, immunoblastic, and anaplastic large B-cell
lymphomas.1 This morphological subclassification may help
in prognosis stratification, but its usefulness is limited by a poor
interobserver reproducibility.2 At the molecular level,
several genes have been implicated in the pathogenesis of these
lymphomas. The most frequent genetic lesions (30% to 40%) are
rearrangements of the LAZ3/Bcl6 gene, which encodes a zinc finger
transcription factor that participates in B-cell
differentiation.3,4 Besides these frequent genomic alterations, approximately 20% of DLBLs harbor a t(14;18) involving the Bcl2 gene, 20% of cases have mutations of the p53 gene, and a
small percentage of DLBLs display rearrangements and/or mutations of
the c-myc gene.5-7 Recently, a comparative genomic
hybridization analysis associated with a candidate gene approach
evidenced amplification of rel, myc, Bcl2, gl1, cdk4, and
mdm2 genes, providing additional genetic information on
DLBLs.8
Among DLBLs, primary mediastinal large B-cell lymphoma (PMBL) was
individualized as a distinct subtype in the REAL
classification.1 These lymphomas may be distinguished
from peripheral DLBLs on clinical, morphological, and immunophenotypic
features. Clinically, they are characterized by a female predominance
and a median age at diagnosis in the fourth decade. Patients present
with a prominent mediastinal tumoral mass, commonly associated with
symptoms of airway compromise and superior vena cava syndrome. The
tumor mass is usually bulky (>10 cm) and extension remains most
frequently localized to the adjacent intrathoracic structures.
Morphologically, the tumors consist of clear large cells and exhibit a
diffuse growth pattern associated with a variable degree of sclerosis. Thymic remnants may be found within the tumor. These lymphomas display
a particular immunophenotype
CD19+CD20+CD79a+CD10 Specific genetic alterations involved in the pathogenesis of PMBLs are
presently unknown. Alterations of the c-myc gene consisting of
major rearrangements, and mutations or small rearrangements in the
5' noncoding region were reported in a substantial proportion of
cases in 2 studies (3 of 6 and 3 of 16 cases,
respectively).15,16 Other reported molecular alterations
include rearrangement of the Bcl6 gene (1 of 16 cases) and missense
point mutations of the p53 gene (3 of 16 cases).16 A
comparative genomic hybridization approach performed in a series of 26 PMBLs demonstrated frequent gains of chromosomal material involving
chromosomes 2p, 9p, 12q, and Xq and amplification of the proto-oncogene
rel in 2 cases.17 Hence, in addition to distinct
clinicopathologic features, PMBLs generally lack the molecular
alterations involved in peripheral DLBLs.
To identify molecular alterations associated with this disease, we
compared the mRNAs expressed in PMBLs and peripheral DLBLs by
differential display-reverse transcription (DDRT). We identified MAL
mRNA as being differentially expressed between these 2 entities and
further confirmed by immunohistochemistry the specific expression of
MAL protein in PMBL neoplastic cells.
Tissue specimens and cell lines.
Tumor samples from 12 patients with PMBL and 8 patients with peripheral
DLBL were collected from the archives of 2 departments of Pathology
(Hôpital Henri Mondor [Créteil, France] and Hôpital Laennec [Paris, France]). The clinical and pathologic features of all
cases are summarized in Table 1. All
patients with PMBL presented with an initial prominent bulky
mediastinal mass. Representative tumor samples from PMBLs were
obtained at mediastinoscopy for 9 cases and from supraclavicular and
axillary lymph nodes for 3 cases. Biopsy specimens of peripheral DLBLs
consisted of peripheral lymph nodes in all cases. Disseminated B-cell
lymphomas with bulky mediastinal involvement were excluded. The
morphologic features were assessed on hematoxylin-eosin-stained
sections of Bouin's or formalin-fixed, paraffin-embedded tissue.
Expression of B- and T-cell-associated differentiation antigens were
evaluated on deparaffinized tissue sections using the
alkaline-phosphatase/anti-alkaline-phosphatase (APAAP) procedure with
the CD3
DDRT-polymerase chain reaction (DDRT-PCR).
DDRT was performed as described.20 Total RNAs were
extracted from frozen tumor samples of 3 patients presenting with
peripheral DLBL and 3 patients presenting with PMBL using the TRIZOL
reagent (GIBCO-BRL Life Technologies, Cergy-Pontoise, France). After
poly(A) enrichment on oligod(T) cellulose, 50 ng mRNAs were
reverse-transcribed with 200 U Superscript II reverse transcriptase
(GIBCO-BRL) in the presence of 50 pmol anchored T12MN primers (in which
M represents A, C, or G and N is T, A, C, or G) in 20 µL RT buffer
(50 mmol/L Tris, pH 8.3, 75 mmol/L KCl, 3 mmol/L MgCl2, 10 mmol/L dithiothreitol [DTT]) containing 20 µmol/L dNTP
for 50 minutes at 37°C. After heat inactivation of the RT at
95°C for 5 minutes, subsequent PCR amplification was performed
using 1 µL of the cDNA with 50 pmol of the appropriate T12NM primer
and 10 pmol of arbitrary decamer. The PCR reaction was performed with 2 U Taq DNA polymerase (Perkin Elmer Applied Biosystems, Courtaboeuf,
France) and 0.075 µL [ DNA sequencing.
Plasmid DNA and PCR products were Taq cycle sequenced using the Applied
Biosystems PRISM ready reaction Dye-dideoxy Terminator and Dye-Primer
sequencing kits, and samples were run on an ABI 373A DNA sequencer
(Applied Biosystems, Foster City, CA).
Northern blot analysis.
Total RNAs were extracted using TRIZOL (GIBCO-BRL) according to the
manufacturer's instructions. RNAs extracted from lymphomas or cell
lines (15 µg) were denatured for 10 minutes at 68°C and run in
1% agarose gel containing 2 mol/L formaldehyde in 10 mmol/L phosphate
buffer, pH 7. RNAs were transferred on Hybond-N+ membranes (Amersham
Pharmacia Biotech, Orsay, France) and cross-linked by UV irradiation.
Prehybridization and hybridization were performed in Church buffer (140 mmol/L NaH2PO4, 360 mmol/L
Na2HPO4, pH 7, 7% sodium dodecyl sulfate
[SDS], and 1 mmol/L EDTA) with random-primed, RT-PCR analysis.
One microgram of total RNA was reverse transcribed to cDNA using 200 U
Superscript Plus (GIBCO-BRL) and 300 ng random primers in 20 µL RT
buffer containing 0.5 mmol/L dNTP. MAL cDNA was amplified together with
an internal standard, consisting of S14 ribosomal protein cDNA, in 1 tube. The PCR reactions were performed in 2 steps: the first step
consisted of the amplification of MAL cDNA with 5 pmol of sense primer
(5'CTTGCCCGACTTGCTCTTCA3') and antisense primer
(5'GGGGGGGTGGTTGTTTTCTT3') and 0.5 U Taq Gold DNA
polymerase (Perkin Elmer) in 20 µL PCR buffer containing 0.2 mmol/L
dNTP. Thermocycling was performed as follows: 12 minutes at 95°C
and 8 cycles of 95°C for 30 seconds, 60°C for 30 seconds, and
72°C for 1 minute +2 seconds per cycle. The second
step consisted of the addition of 10 µL PCR buffer containing 0.2 mmol/L dNTP, 2.5 pmol MAL sense and antisense primers, 5 pmol of S14
ribosomal protein sense primer (5'GGCAGACCGAGATGAATCCTCA3')
and antisense primer (5'CAGGTCCAGGGGTCTTGGTCC3'), and 0.5 U
Taq Gold DNA polymerase (Perkin Elmer). The second thermocycling was
performed as follows: 12 minutes at 95°C and 26 cycles of 95°C
for 30 seconds, 60°C for 30 seconds, and 72°C for 1 minute +2
seconds per cycle. Ten microliters of the PCR products
was run on a 2% agarose gel in 1× TBE buffer (100 mmol/L Tris,
90 mmol/L Boric acid, and 1 mmol/L EDTA, pH 8.3). Samples containing
distilled water and Jurkat cDNA were used as negative and positive
controls, respectively.
DNA extraction and Southern blot analysis.
DNA from tumor samples of 6 PMBLs and 3 peripheral DLBLs was extracted
by proteinase K digestion, phenol/chloroform extraction, and ethanol
precipitation.22 After digestion with EcoRI, DNA fragments were electrophoresed on 0.8% agarose gels in 1× TAE buffer (40 mmol/L Tris-acetate, 1 mmol/L EDTA, pH 8.3) and transferred onto nylon N+ membrane (Amersham). Prehybridization and hybridization were performed in Quick Express Hyb Solution (Clontech, Palo Alto, CA) with Immunohistochemistry.
Immunohistochemistry was performed on paraffin sections using the APAAP
method and an anti-MAL monoclonal antibody directed against amino acids
114-123 of the human MAL protein.18,24 Rabbit antimouse Igs
and APAAP complexes were obtained from Dako. Paraffin sections from
normal kidney were used as positive control.
Identification of MAL mRNA through differential screening of lymphomas
mRNAs.
We compared the mRNAs expressed in tumor samples of 3 PMBL patients
(patients no. 9, 10, and 12) with the mRNAs expressed in tumor samples
of 3 other patients with peripheral DLBL (patients no. 19, 13, and 20).
Total RNAs extracted from frozen tissue samples were reverse
transcribed using T12GC anchor primer. Subsequent PCR amplification of
the cDNAs were performed using T12GC anchor primer and OPA 18 arbitrary
decamer (5'AGGTGACCGT3'). Comparative analysis of the PCR
products identified a band that was present in 3 of 3 PMBLs but not in
the 3 peripheral DLBLs (Fig 1). This band
was eluted from the gel, reamplified by PCR with the set of primers
used in the corresponding DDRT experiment, and sequenced. This sequence
was compared with the nucleotide databases and proved to correspond to
the 3' end of MAL mRNA.
Northern blot analysis of MAL expression.
To confirm that the differential product observed corresponded to a
differential mRNA, we studied MAL gene expression in tumor samples of
patients with PMBL or peripheral DLBL by Northern blot analysis. As
shown in Fig 2A, hybridization with MAL
cDNA showed high expression of MAL 1.1-kb transcripts in 2 PMBLs (cases
no. 11 and 12) and very low or undetectable expression in 4 peripheral DLBLs (cases no. 15, 17, 18, and 16). In addition, we tested MAL expression in a panel of human hematopoietic cell lines, including B-cell lines at various stages of differentiation. MAL mRNAs were detected in the Jurkat T-cell line, but were absent in the B-cell lines
(Raji, RL, 697, RS 4:11, and Ramos), erythroleukemic cell lines (HEL
and K562), and epithelial cell line (Hela) studied (Fig 2B). These
results showed that MAL is not expressed in B-cell lines and thus
confirmed that MAL expression is restricted to the T-cell lineage
during hematopoiesis.
Analysis of MAL expression by RT-PCR.
The small quantity of biopsy material obtained at mediastinocopy did
not yield enough RNA to perform Northern blot analysis in a large
series of lymphomas. Therefore, we studied MAL expression in 12 PMBLs
and 8 peripheral DLBLs by RT-PCR analysis. As shown in
Fig 3, a specific MAL PCR product of 520 bp
was detected in 8 of 12 PMBLs (cases no. 2, 3, 5, 6, 7, 10, 11, and 12)
and in only 2 of 8 peripheral DLBLs (cases no. 15 and 20). In these 2 cases, the level of MAL expression appeared lower than that observed in
PMBLs. Efficient amplification of the S14 internal control was detected
in all cases. This analysis confirmed the differential expression of
MAL mRNA in PMBLs compared with peripheral DLBLs.
MAL protein expression in PMBLs and peripheral DLBLs.
To examine whether MAL protein was expressed in tumoral B cells and to
rule out the possibility that MAL mRNA expression observed in PMBLs was
due to intratumoral reactive T cells, we analyzed the expression of MAL
protein by immunohistochemistry on paraffin sections of tumor samples.
The results are shown in Table 2. MAL
protein was detected in neoplastic cells in 7 of 12 PMBLs (cases no. 2, 5, 6, 7, 10, 11, and 12). Two cases were negative, although internal
positive controls, represented by small lymphoid cells, consistent with
reactive T cells, were present. Three cases were not interpretable
because of the absence of internal positive control. The staining
pattern was associated with the surface membrane and there was granular
cytoplasmic positivity, with accentuation in the Golgi area in most
neoplastic cells (Fig 4B and D). The majority of positive PMBLs (5/7) displayed more than 50% positive neoplastic cells. Two PMBLs (cases no. 5 and 11) demonstrated only 10%
to 20% positive neoplastic cells; however, the possibility of partial
antigenic denaturation due to Bouin's fixative cannot be ruled out in
these 2 cases. In comparison, all peripheral DLBLs tested were
negative, although internal positive control were present in all cases
(Fig 4F).
Southern blot analysis.
To study if MAL gene expression in tumoral B cells was due to genomic
rearrangements, DNAs extracted from tumor samples of PMBLs and
peripheral DLBLs were digested with EcoRI and subjected to
Southern blot analysis. The blot was first hybridized with a 1.5-kb
EcoRI-HindIII fragment located 3.5 kb upstream of MAL first exon, showing the same 17-kb DNA fragment in all lymphomas tested
(Fig 5B). The blot was stripped and
subsequently hybridized with a second probe obtained by PCR
amplification of a fragment of MAL cDNA spanning exons 2, 3, and 4 and
thus exploring the 3' part of the MAL gene. In peripheral DLBLs
as well as in PMBLs, this probe hybridized with the expected 5- and
2.6-kb DNA fragments (Fig 5C). These experiments did not demonstrate
any rearrangement of the MAL gene in PMBLs. Furthermore, quantitative
analysis of the signals correlated with the amount of DNA loaded in
each lane (data not shown), thereby ruling out the possibility of an
overexpression related to gain of chromosomal material.
Using a differential screening method, we identified a transcript
expressed in PMBLs, which proved upon sequencing to correspond to the
3' end of MAL mRNA. We demonstrated by Northern blot and RT-PCR
the recurrent and differential expression of the MAL gene in PMBLs
among DLBLs and identified the MAL protein at the surface membrane and
in the Golgi area of PMBL neoplastic B cells.
The authors thank Marie-Laure Boulland, Nadine Martin, and Marie-Claude
Labastie for their technical assistance.
Submitted March 31, 1999; accepted July 16, 1999.
Supported by the Institut National de la Santé et de la Recherche
Médicale (INSERM), the Fondation de France, and the Association pour la Recherche contre le Cancer (ARC).
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Karen Leroy, MD, PhD, INSERM U
474, Hôpital Henri Mondor, 51 av du Mal de Lattre de
Tassigny, 94010 Créteil, France.
1.
Harris NL, Jaffe ES, Stein H, Banks PM, Chan JKC, Clearly ML, Delsol G, De Wolf-Peeters C, Falini B, Gatter KC, Grogan TM, Isaacson PG, Knowles DM, Mason DY, Müller-Hermelink HK, Pileri SA, Piris MA, Ralfkiaer E, Warnke RA:
A revised European-American classification of lymphoid neoplasms: A proposal from the International Lymphoma Study Group.
Blood
84:1361, 1994
2.
Engelhard M, Brittinger G, Huhn D, Gerhartz HH, Meusers P, Siegert W, Thiel E, Wilmanns W, Aydemir U, Bierwolf S, Griesser H, Tiemann, Lennert K:
Subclassification of diffuse large B-cell lymphomas according to the Kiel classification: Distinction of centroblastic and immunoblastic lymphomas is a significant prognostic risk factor.
Blood
89:2291, 1997
3.
Bastard C, Deweindt C, Kerckaert JP, Lenormand B, Rossi A, Pezzella F, Fruchart C, Duval C, Monconduit M, Tilly H:
LAZ3 rearrangements in non-Hodgkin's lymphoma: Correlation with histology, immunophenotype, karyotype and clinical outcome in 217 patients.
Blood
83:2423, 1994
4.
Fukuda T, Yoshida T, Okada S, Hatano M, Miki T, Ishibashi K, Okabe S, Koseki H, Hirosawa S, Taniguchi M, Miyasaka N, Tokuhisa T:
Disruption of the Bcl6 gene results in an impaired germinal center formation.
J Exp Med
186:439, 1997
5.
Jacobson J, Wilkes B, Kwaiatkowski D, Medeiros L, Aisenberg A, Harris N:
Bcl-2 rearrangements in de novo diffuse large cell lymphoma. Association with distinctive clinical features.
Cancer
72:231, 1993[Medline]
[Order article via Infotrieve]
6.
Ichikawa A, Kinoshita T, Watanabe T, Kato H, Nagai H, Tsushita K, Saito H, Hotta T:
Mutations of the P53 gene as a prognosis factor in agressive B-cell lymphoma.
N Engl J Med
337:529, 1997
7.
Ladanyi M, Offit K, Jhanwar SC, Filippa DA, Chaganti RSK:
MYC rearrangement and translocations involving band 8q24 in diffuse large cell lymphomas.
Blood
77:1057, 1991
8.
Rao PH, Houldsworth J, Dyomina K, Parsa NZ, Cigudosa JC, Louie DC, Popplewell L, Offit K, Jhanwar SC, Chaganti RSK:
Chromosomal and gene amplification in diffuse large B-cell lymphoma.
Blood
92:234, 1998
9.
Lamarre L, Jacobson JO, Aisenberg AC, Harris NL:
Primary large cell lymphoma of the mediastinum: A histologic and immunophenotypic study of 29 cases.
Am J Surg Pathol
13:730, 1989[Medline]
[Order article via Infotrieve]
10.
Al-Sharabati M, Chittal S, Duga-Neulat I, Laurent G, Mazerolles C, Al-Saati T, Brousset P, Delsol G:
Primary mediastinal B-cell lymphoma: A clinicopathologic and immunohistochemical study of 16 cases.
Cancer
67:2579, 1991[Medline]
[Order article via Infotrieve]
11.
Kanavaros P, Gaulard P, Charlotte F, Martin N, Ducos C, Lebezu M, Mason DY:
Discordant expression of immunoglobulin and its associated molecule mb-1/CD79a is frequently found in mediastinal large B cell lymphomas.
Am J Pathol
146:735, 1995[Abstract]
12.
Cazals-Hatem D, Lepage E, Brice P, Ferrant A, d'Agay MF, Baumelou E, Brière J, Blanc M, Gaulard P, Biron P, Schlaifer D, Diebold J, Audouin J:
Primary mediastinal large B-cell lymphoma. A clinicopathologic study of 141 cases compared with 916 nonmediastinal large B-cell lymphomas, a GELA study.
Am J Surg Pathol
20:877, 1996[Medline]
[Order article via Infotrieve]
13.
Isaacson PG, Norton AJ, Addis BJ:
The human thymus contains a novel population of B lymphocytes.
Lancet
26:1488, 1987
14.
Möller P, Moldenhauer G, Momburg F, Lämmler B, Eberlein-Gonska M, Kiesel S, Dörken B:
Mediastinal lymphoma of clear cell type is a tumor corresponding to terminal steps of B cell differentiation.
Blood
69:1087, 1987
15.
Scarpa A, Borgato L, Chilosi M, Capelli P, Menestrina F, Bonetti F, Zamboni G, Pizzolo G, Hirohashi S, Fiore-Donati L:
Evidence of c-myc gene abnormalities in mediastinal large B-cell lymphoma of young adult age.
Blood
78:780, 1991
16.
Tsang P, Cesarman E, Chadburn A, Liu YF, Knowles DM:
Molecular characterization of primary mediastinal B cell lymphoma.
Am J Pathol
148:2017, 1996[Abstract]
17.
Joos S, Otano-Joos MI, Ziegler S, Brüderlein S, du Manoir S, Bentz M, Möller P, Lichter P:
Primary mediastinal (thymic) B-cell lymphoma is characterized by gains of chromosomal material including 9p and amplification of the REL gene.
Blood
87:1571, 1996
18.
Cordell JL, Falini B, Erber W, Ghosh AK, Abdulaziz Z, MacDonald S, Pulford KAF, Stein H, Mason DY:
Immunoenzymatic labeling of monoclonal antibodies using immune complexes of alkaline phosphatase and monoclonal anti-alkaline phosphatase (APAAP complexes).
J Histochem Cytochem
32:219, 1984[Abstract]
19.
Stansfeld AG, Diebold J, Noel H, Kapanci Y, Rilke F, Kelenyi G, Sundstrom C, Lennert K, Van Unnik J, Mioduszewska O, Wright D:
Updated Kiel classification for lymphomas.
Lancet
1:292, 1988[Medline]
[Order article via Infotrieve]
20.
Liang P, Pardee AB:
Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction.
Science
257:967, 1992
21.
Alonso MA, Weissman SM:
cDNA cloning and sequence of MAL, a hydrophobic protein associated with human T-cell differentiation.
Proc Natl Acad Sci USA
84:1997, 1987
22.
Sambrook J, Fritsh EF, Maniatis T:
Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1989, p 9.14
23.
Rancano C, Rubio T, Correas I, Alonso MA:
Genomic structure and subcellular localization of MAL, a human T-cell-specific proteolipid protein.
J Biol Chem
269:8159, 1994
24.
Martin-Belmonte F, Kremer L, Albar JP, Marzuela M, Alonso M:
Expression of the MAL gene in the thyroid: The MAL proteolipid, a component of glycolipid-enriched membranes, is apically distributed in thyroid follicles.
Endocrinology
139:2077, 1998
25.
Rancano C, Rubio T, Alonso MA:
Alternative splicing of human T-cell specific MAL mRNA and its correlation with the exon/intron organization of the gene.
Genomics
21:447, 1994[Medline]
[Order article via Infotrieve]
26.
Wakeman JA, Heath PR, Pearson RC, Andrews PW:
MAL mRNA is induced during the differentiation of human embryonal carcinoma cells into neurons and is also localised within specific regions of the human brain.
Differentiation
62:97, 1998
27.
Alonso MA, Barton DE, Francke U:
Assignment of the T-cell differentiation gene MAL to human chromosome 2, region cen-q13.
Immunogenetics
27:91, 1988[Medline]
[Order article via Infotrieve]
28.
Zacchetti D, Peränen J, Murata M, Fiedler K, Simons K:
VIP/MAL, a proteolipid in apical transport vesicles.
FEBS Lett
377:465, 1995[Medline]
[Order article via Infotrieve]
29.
Millan J, Puertollano R, Fan Li, Rancano C, Alonso MA:
The Mal proteolipid is a component of the detergent-insoluble membrane subdomains of human T-lymphocytes.
Biochem J
321:247, 1997
30.
Simons K, Ikonen E:
Functional rafts in cell membranes.
Nature
387:569, 1997[Medline]
[Order article via Infotrieve]
31.
Xavier R, Brennan T, Li Q, McCormack C, Seed B:
Membrane compartmentation is required for efficient T cell activation.
Immunity
8:723, 1998[Medline]
[Order article via Infotrieve]
32.
Viola A, Schroeder S, Sakakibara Y, Lanzavecchia A:
T lymphocyte costimulation mediated by reorganization of membrane microdomains.
Science
283:680S, 1999
33.
Iiangumaran S, Briol A, Hoessli DC:
CD44 selectively associates with active Src family protein tyrosine kinases Lck and Fyn in glycosphingolipid-rich plasma membrane domains of human peripheral blood lymphocytes.
Blood
91:3901, 1998
34.
Parolini I, Sargiacomo M, Lisanti MP, Peschle C:
Signal transduction and glycophosphatidylinositol-linked proteins (LYN, LCK, CD4, CD45, G proteins, and CD55) selectively localize in triton-insoluble plasma membrane domains of human leukemic cell lines and normal granulocytes.
Blood
87:3783, 1996
35.
Puertollano R, Li S, Lisanti MP, Alonso MA:
Recombinant expression of the MAL proteolipid, a component of glycolipid-enriched membrane microdomains, induces the formation of vesicular structures in insect cells.
J Biol Chem
272:18311, 1997
36.
Puertollano R, Martin-Belmonte F, Millan J, del Carmen de Marco M, Albar JP, Kremer L, Alonso MA:
The MAL proteolipid is necessary for normal apical transport and accurate sorting of the influenza virus hemagglutinin in Madin-Darby canine kidney cells.
J Cell Biol
145:141, 1999
37.
Millan J, Alonso MA:
MAL, a novel integral membrane protein of human T lymphocytes, associates with glycosylphosphatidylinositol-anchored proteins and Src-like tyrosine kinases.
Eur J Immunol
28:3675, 1998[Medline]
[Order article via Infotrieve]
38.
Koleske AJ, Baltimore D, Lisanti MP:
Reduction of caveolin and caveolae in oncogenically transformed cells.
Proc Natl Acad Sci USA
92:1381, 1995
39.
Engelman JA, Wykoff CC, Yasuhara S, Song KS, Okamoto T, Lisanti MP:
Recombinant expression of caveolin-1 in oncogenically transformed cells abrogates anchorage-independent growth.
J Biol Chem
26:16374, 1997
40.
Nasu Y, Timme TL, Yang G, Bangma CH, Li L, Ren C, Hee Park S, Deleon M, Wang J, Thompson TC:
Suppression of caveolin expression induces androgen sensitivity in metastatic androgen-insensitive mouse prostate cancer cells.
Nat Med
4:1062, 1998[Medline]
[Order article via Infotrieve]
41.
Lee SW, Reimer CL, Oh P, Campbell DB, Schnitzer JE:
Tumor cell growth inhibition by caveolin re-expression in human breast cancer cells.
Oncogene
16:1391, 1998[Medline]
[Order article via Infotrieve]
42.
Galbiati F, Volonté D, Engelman JA, Watanabe G, Burk R, Pestell RG, Lisanti MP:
Targeted downregulation of caveolin-1 is sufficient to drive cell transformation and hyperactivate the p42/44 MAP kinase cascade.
EMBO J
17:6633, 1998[Medline]
[Order article via Infotrieve]
43.
Wary KK, Mariotti A, Zurzolo C, Giancotti FG:
A requirement for caveolin-1 and associated kinase Fyn in integrin signaling and anchorage-dependent cell growth.
Cell
94:625, 1998[Medline]
[Order article via Infotrieve]
This article has been cited by other articles:
| ||||||||||
TOP
ABSTRACT
INTRODUCTION
CD21
, L26/CD20, and Ber-H2/CD30 antibodies (Dako SA, Glostrup,
Denmark).
-33P]dATP (1,000 Ci/mmol) in 20 µL PCR buffer (10 mmol/L Tris, pH 8.3, 50 mmol/L KCl,
1.25 mmol/L MgCl2) containing 2 µmol/L dNTP. The cycling
parameters were as follows: 94°C for 4 minutes, and then 40 cycles
of denaturation (94°C for 15 seconds), annealing (42°C for 1 minute), and elongation (72°C for 30 seconds), followed by an
elongation step at 72°C for 7 minutes. The amplified cDNAs were
separated on a 6% polyacrylamide sequencing gel, which was then dried
and exposed to a Kodak X-OMAT AR film (Eastman Kodak, Rochester,
NY) overnight. Differential bands were excised from the
dried sequencing gel, boiled in 100 µL H2O for 15 minutes, precipitated with ethanol, and suspended in 10 µL of water.
One fourth of the recovered cDNA was used for reamplification in a 40 µL reaction volume using the same primer set and PCR conditions as
used in the mRNA display, except a higher concentration of dNTP (20 µmol/L). Reamplified cDNA fragments were subcloned into pBS SK plasmid.
) are included.
