|
|
Next Article 
Blood, Vol. 94 No. 11 (December 1), 1999:
pp. 3621-3632
BSAP/Pax5A Expression Blocks Survival and Expansion of Early Myeloid
Cells Implicating Its Involvement in Maintaining Commitment to the
B-Lymphocyte Lineage
By
Mark Y. Chiang and
John G. Monroe
From the Department of Pathology and Laboratory Medicine, University
of Pennsylvania School of Medicine, Philadelphia, PA.
 |
ABSTRACT |
Early B lymphopoiesis is marked by plasticity between the myeloid
and B lineages. An attractive model for B-lineage development is that
commitment to this lineage is partly determined by the ordered
expression of genes that prohibit switching to the myeloid lineage. In
this regard, whereas the role of the B-cell-specific transcription
factor BSAP/Pax5A in regulating B-lymphoid-restricted gene expression
has been well-established, its role in maintaining B-lineage commitment
is unclear. Thus, BSAP/Pax5A was constitutively expressed in the
multipotent EML cell line, which can be directed toward the myeloid
lineage by culture with interleukin-3 (IL-3) and retinoic acid. EML
cells expressing BSAP/Pax5A successfully acquired the myeloid lineage
markers CD11b and F4/80 in response to IL-3 and retinoic acid,
indicating differentiation to the myeloid lineage. However, these early
myeloid cells failed to expand in culture with granulocyte-macrophage
colony-stimulating factor and were directed instead toward an apoptotic
pathway. In parallel, primary bone marrow stem cells transduced with
retrovirus constitutively expressing BSAP/Pax5A began myeloid cell
differentiation, but like the transformed EML model failed to expand in
response to myeloid growth factors. These studies identify a role for
BSAP/Pax5A in suppressing the response to myeloid growth factors, which
may be a component of the regulatory processes that limit plasticity of
early B-lymphoid progenitors.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
A FUNDAMENTAL QUESTION in hematopoiesis
is how cells once directed to a particular lineage stay committed to
that lineage. Lineage-determinant genes such as mafB/ets-1, GATA-1,
E2A, and PU.1 are thought to play a role in these
processes.1-5 These genes encode transcriptional regulators
that direct or enhance expression of lineage-specific genes. In
addition, these transcriptional regulators also repress expression of
genes associated with closely related lineages. For example, whereas
ectopic PU.1 expression in a chicken thromboblast progenitor was shown
to activate genes associated with the myeloid lineage, enabling these
cells to respond to myeloid growth factors, PU.1 also repressed
expression of GATA-1, which is a determinant gene for
erythroblast, thromboblast, and eosinophil commitment.1,2
This question of how cells maintain lineage commitment is particularly
important to the B-cell lineage as many transformed pre-B cell lines
spontaneously differentiate or can be induced to differentiate into
myeloid cells.6-14 These observations suggest that the
B-cell determinant protein that limit lineage divergence are weak or
can be disrupted by transformation. To be effective in initiating
B-lineage commitment, these B-cell-determinant genes must be expressed
and functional early in B-cell development. In this regard, evidence
for commitment to the B lineage is found within the earliest
identifiable B cells.15 This stage (fraction A1
according to the Hardy nomenclature16,17) is defined by the
coexpression of B220, CD43, and low levels of CD4.16,17 B
cells at this stage begin to express low levels of the transcription factor E2A, the earliest appearing gene that is thought to be responsible for commitment to the B-cell lineage.17
Recent work implicates E12, a product of the E2A gene, as a
B-lineage-determinant protein, because it upregulates B-cell-specific genes and represses myeloid-associated genes.5 In these
studies, ectopic expression of E12 in the macrophage cell line 70Z/3
caused a loss of macrophage morphology, downregulation of the myeloid cell genes CD11b and c-fms, inability to adhere to
plastic, activation of the  light chain in response to
lipopolysaccharide (LPS), and upregulation of the B-cell genes
IL-7R , RAG-1,  5, BSAP/Pax5A, and
EBF.5 Thus, E12 stripped a cell of its myeloid
characteristics and reprogrammed it with B-cell characteristics, which
led to the hypothesis that the endogenous expression of E12 in B cells normally prohibits them from switching to the myeloid lineage in
vivo.5
Target genes for E12 include the genes that encode the
B-cell-restricted transcription factors EBF and
BSAP/Pax5A.5,18 The role of these molecules in B-lineage
determination is only partially defined. Ectopic expression of EBF in
the 70Z/3 macrophage cell line resulted in a limited expression of
B-cell-associated genes, including upregulation of BSAP/Pax5A and 5
expression and the activation of chain expression in response to
LPS.5 However, the expression of the
myeloid-lineage-associated genes covered in this study was unaffected
by ectopic EBF expression.5 Thus, only a subset of the
E12-linked processes that determine B-cell gene expression and none of
the E12-linked myeloid-suppressing processes can be attributed to EBF
or BSAP/Pax5A by extension, because it was upregulated by
EBF.5 These data do not necessarily exclude a role for EBF
or BSAP/Pax5A in the suppression of myeloid gene expression, because
this study did not cover several myeloid genes.
BSAP/Pax5A is the major alternatively spliced isoform of Pax5, a member
of the Pax family of transcription factors.19,20 Pax5 is
expressed in B cells developing neural tissue and testis and is
abnormally expressed in certain B-cell lymphomas and
medulloblastoma.21,22 Within the B-lineage,
BSAP/Pax5A is first expressed immediately after commitment to the
B-lineage in the bone marrow17,23 and continues to be
expressed throughout B-cell development, except in plasma
cells.17 Besides its regulation by E12 and EBF, other evidence suggests that BSAP/Pax5A may have B-cell-determinant properties. Similar to E2A / mice,
Pax5/ mice completely lack B220+
cells in the fetal liver, suggesting that BSAP/Pax5A is required for
B-cell commitment.24,25 However, in the bone marrow,
Pax5/ mice display a complete block later in
B-cell development.26 In this case B-cell development is
blocked at the pro-B-cell stage after immunoglobulin D to J
rearrangement, but before immunoglobulin V to DJ rearrangement of the
heavy chain locus.24 Like E12, BSAP/Pax5A is also thought
to upregulate several B-cell-specific genes that are first expressed
during the early pro-B stage. These genes, which include
VpreB1, blk, mb-1 (Ig), and
CD19, encode both markers of early B-lineage commitment as well
as proteins that are necessary for the transition through the initial
stages of B-cell development in both the bone marrow and the fetal
liver.27-31
The combined evidence that BSAP/Pax5A plays a role in B-cell
commitment, developmental progression, and B-cell marker expression throughout most of B-cell development strongly suggests that
BSAP/Pax5A, like E12, may have its own B-cell-determinant properties.
To test this possibility, BSAP/Pax5A was ectopically expressed in bone marrow stem cells. Because EBF/BSAP-expressing 70Z/3 cells failed to
suppress the myeloid phenotype,5 it was expected that the B-cell-determinant properties of BSAP/Pax5A would be limited to upregulation of B-cell gene expression. Surprisingly, contrary to these
expectations, whereas BSAP/Pax5A lacked the ability to alone mediate
B-lineage differentiation, it nonetheless was found to limit
myeloid-lineage potential by suppressing expansion and survival of
early myeloid cells. By doing so, these results argue that one of the
functions of BSAP/Pax5A in B-lymphoid commitment is to limit the
ability of lineage-divergent cells to proceed through development.
| |
MATERIALS AND METHODS |
Plasmid construction.
pGEM7(KJ1)SalI contains the neomycin resistance gene downstream of the
phosphoglycerokinase (PGK-1) gene.32 The PGK-1 promoter was
removed from pGEM7(KJ1)SalI after digestion with Xba I and Pst I and was ligated into pBluescript II SK (Stratagene, La
Jolla, CA) digested with Xba I and Pst
I to form pBSPGK. The BSAP/Pax5A cDNA and SV40 poly A signal was
removed from pmBSAP-233 (a kind gift from Dr Meinrad
Busslinger, Research Institute of Molecular Pathology, Vienna, Austria)
after digestion with Cla I and Apa I and was ligated
into pBSPGK digested with Cla I and Apa I to form
pPGKPax5A. The Mig R1 plasmid, when transiently transfected into the
Bosc23 packaging cell line, produces the MIGR retrovirus that expresses
the green fluorescence protein (GFP) marker at an internal ribosomal
entry site.34 BSAP/Pax5A cDNA was removed from pmBSAP-2
with Cla I and HindIII, blunt-ended at the
HindIII site, and ligated into the Cla I and
EcoRV sites of pBluescriptII SK to form pBSBSAP. BSAP/Pax5A
cDNA was then removed from pBSBSAP with EcoRI digestion and
then ligated into the EcoRI site of Mig R1 to produce Mig R1BSAP.
Hematopoietic growth factors.
Conditioned supernatant from the J558-IL-7 cell line (a kind gift from
Dr Fritz Melchers, Basel Institute for Immunology, Basel, Switzerland)
was used as a source of murine interleukin-7 (IL-7). Human flt3L and
murine granulocyte-macrophage colony-stimulating factor (GM-CSF) was
purchased from Genzyme Diagnostics (Cambridge, MA). Conditioned
supernatant from the WEHI-3B cell line was used as a source of IL-3.
Erythropoietin was obtained from Amgen (Thousand Oaks, CA). Murine
IL-6, stem cell factor (SCF), and IL-3 were purchased
from R&D Systems (Minneapolis, MN).
Antibodies.
To identify primitive stem cells, monoclonal antibodies RA3-6B2 (B220),
RM4-5 (CD4), 53-6.7 (CD8a), RB6-8C5 (gr-1), M1/70 (CD11b/Mac-1), and
Ter119 (erythroid lineage marker) were used coupled to phycoerythrin
(PE) as lineage markers. Stem cell markers include 2B8 (c-kit) coupled
to allophycocyanin (APC) and E13-161.7 coupled to
biotin (sca-1) and streptavidin red-670 as a secondary reagent. These
antibodies were handled according to the instructions of the supplier
(Pharmingen, San Diego, CA). The PE-coupled F4/80 antibody was handled
according to the instructions of the supplier (Caltag, Burlingame, CA).
Polyclonal antibodies directed against the paired domain of Pax5A were
a kind gift from Dr Meinrad Busslinger, who generated them as
previously described.33 All flow cytometry was performed
using a Becton Dickinson (Franklin Lakes, NJ) FACScan at the University of Pennsylvania Flow Cytometry Facility
(Philadelphia, PA) and Cellquest software.
Cell lines.
EML cells35 (a kind gift from Dr Schickwann Tsai, Mount
Sinai School of Medicine, New York, NY) were maintained in Iscove's Modified Dulbecco's Media (IMDM), supplemented with 20%
heat-inactivated horse serum, and 12% to 15% BHK/MKL (a kind gift
from Dr Schickwann Tsai, Mount Sinai School of Medicine, New York, NY)
conditioned media. OP9 cells36 (a kind gift from Dr Tasuko
Honjo, Kyoto University Yoshida, Kyoto, Japan) were maintained in
minimum essential medium medium supplemented with 20% fetal calf serum.
Electromobility shift analysis (EMSA).
Nuclear extracts were prepared as described elsewhere.37
The CD19Ains probe33,38 consisted of the following 2 oligonucleotides that were annealed to form a double-stranded
oligonucleotide: 5'CTGGAGAATGGGGCACTGAGGCGTGACCACCGCCT3'
and 5'AGGCGGTGGTCACGCCTCAGTGCCCCATTCTCCAG3' (Nucleic Acid
Facility, University of Pennsylvania Cancer Center). Fifty nanograms of
probe was end-labeled with 10 µCi [ 32P]ATP using T4
kinase and purified over a G-25 spin column. Binding reactions
consisted of 20,000 DPM probe, 2 µg poly dI-dC, 10 mmol/L HEPES, pH
7.9, 100 mmol/L NaCl, 10% glycerol, 0.5 mmol/L MgCl2, and
1 mmol/L dithiothreitol for 15 minutes at room temperature. Nuclear
extracts were then added to the probe mixture for an additional 15 minutes at room temperature. The reaction was then subjected to
electrophoresis on a native 4% polyacrylamide gel in 1×
Tris-borate/EDTA (TBE) buffer to separate protein-DNA complexes.
Quantitation was performed with a Personal Densitometer (Molecular
Dynamics, Sunnyvale, CA).
In vitro generation of myeloid precursors from EML cells.
EML cells were induced to form myeloid cells, as previously
described.35 After 3 days of induction in media A (IMDM
supplemented with 10% WEHI-3B conditioned supernatant, 10 µmol/L
all-trans retinoic acid (ATRA), and 20% heat-inactivated horse
serum), the cells were harvested, washed, and replated at 1.5 × 105 cells per 3.5-cm bacterial plate in media B (IMDM
supplemented with 250 U/mL murine GM-CSF [muGM-CSF]
and 20% heat-inactivated horse serum) and 1.0% methylcellulose.
Colonies were counted after 7 days of growth. The entire plate of cells
was harvested after 9 days, and the number of
CD11b+/Gr-1+ cells was determined by flow cytometry.
EML proliferation assays.
Two hundred microliters of undifferentiated EML cells at 2.5 × 105 cells/mL were plated in triplicate in 96 flat well
plates. Twenty-four hours later, 0.5 µCi of [3H]TdR was
added to each well, and 17 hours later, the cells were harvested. EML
cells that were induced for 3 days in media A to generate
colony-forming units-granulocyte-macrophage (CFU-GM) were then plated in 200 µL at 5 × 105 cells/mL in
triplicate in 96 flat well plates in media B. Forty-eight hours later,
0.5 µCi of [3H]TdR was added to each well, and 12 hours
later, the cells were harvested. Cells were harvested using a PHD cell
harvester (Cambridge Technology, Inc, Watertown, MA) on glass fiber
discs. Incorporated 3H radioactivity was measured in a
scintillation counter (1209 Rackbeta; EG&G Wallace, Gaithersburg, MD).
EML apoptosis assays.
EML cells induced to differentiate in media A as described above were
replated at 5 × 105 cells/mL in 400 µL media
containing 250 U/mL muGM-CSF. Two days later, the cells were washed
with fluorescence-activated cell sorting (FACS) buffer (1×
phosphate-buffered saline [PBS], 0.2% bovine serum albumin [BSA],
and 0.01% sodium azide) and incubated with ice-cold 70% ethanol for
several hours. Cells were then washed with FACS buffer and then stained
with 1× PBS/50 µg/mL RNAase/10 µg/mL propidium iodide/0.01%
sodium azide overnight at 4°C. The percentage of cells with a
subdiploid DNA content was determined using flow cytometry.
Retroviral transduction of bone marrow stem cells.
Retroviral supernatants were prepared by transiently transfecting the
Mig R1 or Mig R1BSAP plasmids into the Bosc23 packaging cell
line.34,39,40 For infection of stem cells, 8- to
12-week-old female BALB/C mice were injected with 200 µL of 25 mg/mL
5-fluorouracil. Four days later, bone marrow was harvested and then
cultured at 2.5 × 106 cells/mL in 1 mL Dulbecco's
modified Eagle's medium (DMEM) in the presence of 15%
heat-inactivated fetal calf serum, 5% WEHI-3B conditioned supernatant,
40 ng/mL flt3 ligand, 200 ng/mL SCF, 12 ng/mL IL-3, and 20 ng/mL IL-6.
Forty-eight hours later, the cells were transduced with 1 mL of MIGR or
MIGRPax5A retroviral supernatant as described.34,39,40
Twenty-four hours later, the cells were plated on -irradiated OP9
stromal cells in IMDM plus 10% heat-inactivated fetal calf serum and
50 µmol/L  -mercaptoethanol. Five days later, the cells were washed
and recultured in media A. Three days later, the cells were washed and
recultured in media B. Three days later, the cells were harvested by
gentle pipetting and then analyzed by flow cytometry.
| |
RESULTS |
Establishment of EML cells that ectopically express BSAP/Pax5A.
To test whether BSAP/Pax5A affects the differentiation of stem cells to
myeloid cells, murine BSAP/Pax5A under the control of the constitutive
PGK promoter (pPGKPax5A) was stably transfected into the EML cell line,
a bone marrow-derived multipotent progenitor that expresses some
markers associated with the B-lymphoid lineage as well as a
dominant-negative retinoic acid receptor that blocks spontaneous
differentiation to the myeloid lineage at low levels of
ATRA.35 In the presence of IL-3 and high levels of ATRA, these cells undergo myeloid lineage differentiation, which can be
followed by the de novo acquisition of the myeloid-restricted markers
CD11b and F4/80 (previous studies41-44 and M. Chiang and J. Monroe, unpublished observations). The addition of
GM-CSF causes further maturation to
CD11b+/Gr-1+ granulocytes (M. Chiang and J. Monroe, unpublished observations). Three EML cell
clones (EML/Pax5A-2, EML/Pax5A-3, and EML/Pax5A-5) were subcloned and
shown to express BSAP/Pax5A by EMSA (Fig 1A and B). BSAP/Pax5A was observed as a single band in the stable transfectants but not in the parental EML cells. Furthermore, this
specific complex was disrupted by preincubation of the nuclear extracts
with an antibody directed against the paired domain of murine
BSAP/Pax5A33 and was expressed at approximately one fifth to one fourth the level in pre-B-cell lines (M. Chiang and J. Monroe,
unpublished observations). Parental EML cells and 4 EML cells stably transfected with only the hygromycin resistance
plasmid (EML/Hyg-1, EML/Hyg-2, EML/Hyg-3, and EML/Hyg-4) were used as negative controls to study the effects of BSAP/Pax5A on lineage potential and differentiation.
View larger version (34K):
[in this window]
[in a new window]
| Fig 1.
Establishment of BSAP/Pax5A-expressing EML cells.
Parental EML cells (EML) were stably transfected with pPGKHygro and
pPGKPax5A (the cDNA of Pax5A downstream of the PGK-1 promoter).
Hygromycin-resistant cells were subcloned by limiting dilution and 5 µg of nuclear extract of individual clones containing pPGKPax5A
detected by genomic PCR (M. Chiang and J. Monroe, unpublished
observations) were subjected to EMSA with a
32P-end-labeled probe containing the high-affinity
BSAP/Pax5A binding site isolated from the huCD19 promoter. (A) EML,
parental wild-type EML; EML/Pax5A-2, -3, and -5, BSAP/Pax5A-expressing
EML clones. (B) The intensity of the BSAP/Pax5A:probe complexes were
quantitated using a densitometer.
|
|
Enforced expression of BSAP/Pax5A does not suppress myeloid cell
differentiation of EML cells.
To test whether BSAP/Pax5A affects myeloid lineage potential,
BSAP/Pax5A-expressing EML cells were induced to differentiate to the
myeloid lineage with the addition of IL-3 and ATRA. Undifferentiated EML cells are B220+ and lack markers associated with
myeloid commitment such as CD11b and F4/80. Therefore, differentiation
to the myeloid lineage was followed by analyzing for the acquisition of
CD11b and F4/80. On day 3 after induction, in a typical experiment,
BSAP/Pax5A-expressing EML cells generated approximately the same
percentage of B220hi/CD11b+ cells compared with
controls (33% for EML/Pax5A v 30% for EML/Hyg; Fig 2A). These percentages reflect absolute
numbers of cells, because the average difference in total cell number
between the EML/Hyg and EML/Pax5A cultures over 6 independent
experiments was only 5.7% and ranged up to 20.3%. There was also no
difference in the kinetics of the accumulation of the percentage of
B220hi/CD11b+ cells by EML/Pax5A-3 and
EML/Pax5A-5 compared with EML/Hyg-1 and EML/Hyg-3 over the 3-day period
(Fig 2B).
View larger version (38K):
[in this window]
[in a new window]
| Fig 2.
BSAP/Pax5A-expressing EML cells successfully acquire the
myeloid lineage commitment marker CD11b. (A)
B220+/CD11b EML cells were placed in
culture at 3 × 105 cells/mL and then induced to
differentiate into B220hi/CD11b+ and
B220lo/CD11b+ cells with 10% WEHI-3B
conditioned supernatant (contains murine IL-3) and 10 µmol/L ATRA.
Flow cytometry was performed on days 0 and 3. Control EML clones
EML/Hyg-1 and EML/Hyg-3 and Pax5A/BSAP-expressing EML clones
EML/Pax5A-3 and EML/Pax5A-5 were induced to differentiate as described
in (A). On days 1, 2, and 3 of differentiation, a small sample of cells
was removed from the culture, and differentiation to
B220hi/CD11b+ (B) and
B220lo/CD11b+ (C) cells was determined by
flow cytometry.
|
|
In contrast, on day 3 after induction, EML/Pax5A cells generated a
lower percentage of B220lo/CD11b+ cells (1%
for EML/Pax5A v 11% for EML/Hyg), which represent a more
mature stage of myeloid development than the
B220hi/CD11b+ cells because nearly 100% of the
B220lo/CD11b+ cells express the mature myeloid
marker F4/80, in contrast to only 68% of the
B220hi/CD1lb+ cells (Fig 2A and M. Chiang and
J. Monroe, unpublished observations). The accumulation
of the percentage of B220lo/CD11b+ by
EML/Pax5A-3 and EML/Pax5A-5 compared with EML/Hyg-1 and EML/Hyg-3 was
suppressed over the 3-day period (Fig 2C).
Although CD11b is an early appearing myeloid-restricted marker, it has
been known to be expressed at a low level in other cell types, such as
the fetal liver stem cells,45 activated/memory CD8+ T cells,46 and B1 B cells.47
Thus, we repeated the experiments shown in Fig 2A with the F4/80
antigen, a marker that appears later in myeloid differentiation than
CD11b, but is more tightly restricted to the myeloid lineage
(Fig 3).41,42,44 In a typical experiment, the EML/Hyg cells generated approximately 23%
B220hi/F4/80+ cells and 11%
B220lo/F4/80+ cells, whereas EML/Pax5A cells
generated 15% B220hi/F4/80+ cells and 1%
B220lo/F4/80+ cells. These data using the F4/80
marker confirm the experiments using the CD11b marker in Fig 2 and
reinforce the point that BSAP/Pax5A does not prohibit myeloid
differentiation, as evidenced by the successful de novo acquisition of
the CD11b and F4/80 markers during differentiation of the EML/Pax5A
cells. However, the negative effect of BSAP/Pax5A on myeloid cell
maturation/expansion subsequent to the initiation of myeloid cell
differentiation, as reflected in the diminished generation of
B220lo/CD11b+ cells and
B220lo/F4/80+ cells, was of particular
interest.
View larger version (41K):
[in this window]
[in a new window]
| Fig 3.
BSAP/Pax5A-expressing EML cells successfully acquire the
myeloid lineage commitment marker F4/80.
B220+/F4/80 EML cells were placed in
culture at 3 × 105 cells/mL and then induced to
differentiate into B220hi/F4/80+ and
B220lo/F4/80+ cells with 10% WEHI-3B
conditioned supernatant (contains murine IL-3) and 10 µmol/L ATRA.
Flow cytometry was performed on days 0 and 3.
|
|
BSAP/Pax5A inhibits the expansion of EML-derived myeloid progenitors.
To test whether BSAP/Pax5A affected further maturation/expansion of the
EML cells subsequent to the initial stages of myeloid lineage
differentiation, BSAP/Pax5A-expressing EML cells were induced with IL-3
and ATRA, washed, and recultured in methylcellulose media containing
GM-CSF. GM-CSF supports the further maturation and expansion of myeloid
precursors from progenitors that are dependent on IL-3.35
The colonies derived from BSAP/Pax5A-expressing EML cells appeared to
be unusually small compared with those derived from EML/Hyg cells (M. Chiang and J. Monroe, unpublished observations). To
quantitate this observation, the colonies were counted, aspirated, and
analyzed by flow cytometry. BSAP/Pax5A-expressing colonies on average
contained 60% to 95% fewer Gr-1+/CD11b+ cells
than did the negative control colonies (Fig
4A). These data suggest that BSAP/Pax5A inhibits the ability of myeloid
cells to expand in response to myeloid growth factors.
View larger version (21K):
[in this window]
[in a new window]
| Fig 4.
BSAP/Pax5A-expressing EML cells fail to expand to myeloid
growth factors. (A) EML cells were induced to differentiate into
myeloid cells as described in Fig 2A and then replated in 1%
methylcellulose with 250 U/mL muGM-CSF at 1.5 × 105 cells
per 3.5-cm plate. On day 9, the colonies were aspirated and analyzed by
flow cytometry to determine the mean number of
CD11b+/Gr-1+ cells per colony. The average
among 3 control EML/Hyg clones and the average among 3 BSAP/Pax5A-expressing EML clones are shown and were found to be
significantly different from each other using the heteroscededastic
1-tailed t-test (P < .001). (B) EML cells induced to
differentiate as described in Fig 2A were replated in suspension
culture in the presence of 250 U/mL muGM-CSF. After 48 hours of
culture, the cells were pulsed with 0.5 µCi 3H-thymidine
for 12 hours. The average 3H-thymidine incorporation among
3 control EML/Hyg clones and the average 3H-thymidine
incorporation among 3 EML/Pax5A clones are shown and were found to be
significantly different from each other using the heteroscededastic
1-tailed t-test (P < .001). (C) Three EML/Pax5A
clones and 3 control EML/Hyg clones were split into SCF-containing
growth media at 2.5 × 105 cells/mL and pulsed with
3H-thymidine after 24 hours of culture for 17 hours. The
average 3H-thymidine incorporation among 3 control EML/Hyg
clones and the average 3H-thymidine incorporation among 3 EML/Pax5A clones are shown and were found to be significantly different
from each other using the homoscededastic 2-tailed t-test
(P < .004). (D) EML cells induced to differentiate as
described in Fig 2A were replated at 5 × 105 cells/mL in
400 µL media containing 250 U/mL muGM-CSF. Two days later, the cells
were stained with propidium iodide and then analyzed for apoptotic
cells by flow cytometry. The average percentage of 3 EML/Hyg clones
with subdiploid content of DNA and the average percentage of 3 EML/Pax5A clones with subdiploid content of DNA are shown and were
found to be significantly different from each other using the
homoscededastic 1-tailed t-test (P < .002).
|
|
To confirm that BSAP/Pax5A was suppressing myeloid cell expansion, the
BSAP/Pax5A-expressing EML cells were induced with IL-3 and ATRA,
washed, recultured in media containing GM-CSF, and then subjected to
proliferation and apoptosis assays. Proliferation of
BSAP/Pax5A-expressing EML cells in response to GM-CSF was markedly reduced relative to non-BSAP/Pax5-expressing controls (Fig 4B). This
failure to expand is unlikely to result from a nonspecific suppression
by BSAP/Pax5A on the expansion of EML cells, because undifferentiated
BSAP/Pax5A-expressing EML cells have a slightly but significantly
higher expansion rate than control cells in response to SCF (Fig 4C).
Instead of expanding in response to GM-CSF, the BSAP/Pax5A-expressing
EML cells underwent a 15-fold increase in the rate of apoptosis as
compared with controls (Fig 4D). In combination with the colony size
data, these data strongly suggest that BSAP/Pax5A inhibits the ability
of myeloid cells to expand specifically in response to myeloid growth
factors. This reduced proliferative capacity results in a marked
reduction in the generation of more mature myeloid cells, an effect
that is then exacerbated by the high apoptotic frequency in the
BSAP/Pax5A-expressing population.
BSAP/Pax5A was introduced retrovirally into primary bone marrow stem
cells to verify the BSAP/Pax5A-mediated suppression of myeloid cell
expansion in a nontransformed cell.
Stem cells transduced with BSAP/Pax5A-expressing retrovirus were tested
for the ability to differentiate to the myeloid lineage and expand
during 5 days of culture on OP9 stromal cells, followed by 3 days of
IL-3/ATRA and 3 days of GM-CSF (Fig 5A).
The last 6 days of culture were designed to replicate the conditions
used in the experiments described in Fig 4, which demonstrated that EML-derived myeloid precursors failed to expand in response to GM-CSF.
OP9 stromal cells were derived from the op/op mouse, which lacks functional macrophage colony-stimulating factor
(M-CSF).36 Because of this mutation,
hematopoietic cultures are not artificially skewed predominantly toward
macrophages, as has been seen with other stromal cell lines (M. Chiang
and J. Monroe, unpublished observations).36 Rather, normal bone
marrow hematopoiesis is more closely approximated, including the
efficient generation of early CFU-GM myeloid precursors, erythroid
cells, nonmacrophage lineage myeloid cells such as granulocytes, B
lymphocytes, and mature macrophages.36 Thus, the OP9 system
offers the unique advantage of a more physiologically relevant in vitro
bone marrow culture system and more efficient generation of GM-CSF/IL-3
responsive precursors and nonmacrophage myeloid cells.
View larger version (23K):
[in this window]
[in a new window]
| Fig 5.
Retroviral transduction of bone marrow stem cells with
MIGRPax5A. (A) Bone marrow stem cells from 5-fluorouracil-treated mice
were transduced with MIGRPax5A, a retrovirus that coexpresses
BSAP/Pax5A with the GFP marker as a bicistronic message, and then
analyzed by flow cytometry for GFP+ stem cells
(c-Kit+/Sca-1+/Lin). These
stem cells were then differentiated as indicated and on days 6, 8, and
14. A small sample of cells was then removed from the culture and the
numbers of myeloid cells were determined by flow cytometric analysis
for granulocytes (Gr-1+) and macrophages
(F4/80+). MIGR is the parental retrovirus of MIGRPax5A
and expresses only the GFP marker. (B) Bone marrow stem cells were
transduced with the MIGR retrovirus, cultured as described in (A), and
then analyzed for the percentage of
GFP+/Gr-1+ cells and
GFP+/F4/80+ cells on days 8 and 14 by flow
cytometry.
|
|
Retrovirus containing BSAP/Pax5A cDNA was called MIGRPax5A and was
derived from the parental retrovirus MIGR.34 To
differentiate transduced cells from nontransduced cells, these
retroviruses express the GFP marker from an internal ribosomal entry
site. Thus, cells that express GFP also coexpress BSAP/Pax5A as a
bicistronic message. To correct for differences in the retroviral
transduction efficiencies of hematopoietic stem cells from experiment
to experiment, the GFP+ myeloid cells were normalized to
the number of GFP+
c-Kit+/Sca-1+/Lin cells 72 hours after transduction (which allows time for GFP to be fully
expressed). The
c-Kit+/Sca-1+/Lin bone
marrow subset is highly enriched for the most primitive hematopoietic
stem cells, which have long-term multilineage reconstitution potential.48,49 Normalization to this population ensures
that any reduction in the number of GFP+ myeloid cells
generated is not due to a lower number of stem cells that were
successfully transduced but is rather due to the myelosuppressive
effect of BSAP/Pax5A.
In all experiments, the level of GFP expression in MIGRPax5A-transduced
hematopoietic stem cells (identified by
sca-1+/c-kit+/lin) was
generally lower than that in MIGR-transduced hematopoietic stem cells.
In a typical experiment, the mean fluorescence intensity of
GFP+ hematopoietic stem cells transduced with MIGRPax5A was
41.37 ± 3.83, whereas the mean fluorescence intensity of
GFP+ hematopoietic stem cells transduced with MIGR was
141.68 ± 0.02. This difference unlikely reflects uneven promoter
activity between the 2 populations, but rather is likely the result of
the integration of a large cDNA insert upstream of the GFP marker in
the MIGRPax5A retrovirus but not in the MIGR retrovirus (Chiang et al,
unpublished observations).
Because the expression levels of GFP were different in the control and
experimental cells, we determined the effect of GFP and retroviral
transduction on myeloid differentiation. MIGR-transduced stem cells
were cocultured with nontransduced stem cells and found to generate
approximately 50% of the Gr-1+ cells and 50% of the
F4/80+ cells present in the cultures on day 8 and on day 14 (Fig 5B). Thus, the frequency of transduced myeloid cells did not
change over time, verifying that neither expression of GFP nor
retroviral transduction had any measurable effects on myelopoiesis.
BSAP/Pax5A does not inhibit myeloid differentiation of primary stem
cells but does inhibit the expansion of myeloid progenitors.
Primary bone marrow stem cells were transduced with either MIGR or
MIGRPax5A retrovirus and then cultured in vitro according to the scheme
in Fig 5A to generate myeloid cells. When cultured without myeloid
growth factors during the first 8 days, MIGRPax5A-transduced stem cells
and control MIGR-transduced stem cells generated approximately equal
numbers of Gr-1+ and F4/80+ cells (days 6 and 8 of culture, Fig 6A and B). However, upon addition of IL-3 and ATRA for the next 3 days, followed by GM-CSF for
another 3 days, which simulated the experimental conditions used to
differentiate EML cells in Fig 4, MIGRPax5A-transduced stem cells
generated 60% to 85% fewer Gr-1+ cells (Fig 6A) and 60%
to 75% fewer F4/80+ cells (Fig 6B) than did
MIGR-transduced controls when analyzed on day 14 of culture. This
suppression of myeloid cell generation was not observed with stem cells
that were cultured without growth factors for the entire 2 weeks of
culture (Fig 6A and B and M. Chiang and J. Monroe, unpublished
observations), but rather was observed only when the
stem cells were cultured in the presence of myeloid growth factors.
These data suggest that BSAP/Pax5A does not completely suppress myeloid
cell differentiation, but does suppress myeloid cell expansion to
myeloid growth factors, which is consistent with our interpretation of
the EML studies.
View larger version (14K):
[in this window]
[in a new window]
| Fig 6.
MIGRPax5A-transduced bone marrow cells successfully
committed to the myeloid lineage but failed to expand to myeloid growth
factors. Bone marrow stem cells were transduced with MIGR or MIGRPax5A
and then cultured on OP9 stromal cells in 2 experiments according to
the protocol described in Fig 5A. The absolute number of
GFP+ gr-1+ cells (A) or
F4/80+ cells (B) was normalized to the absolute number of
Sca-1+/c-Kit+/Lin stem cells
on day 6 to estimate the number of granulocytes or macrophages produced
by a retrovirally transduced stem cell. Ten percent WEHI-3B conditioned
media and 10 µmol/L ATRA were added on day 8 and 250 U/mL of muGM-CSF
was added on day 11 to replicate the conditions of Fig 4 in which
EML/Pax5A cells generated myeloid precursors that failed to expand.
|
|
| |
DISCUSSION |
During hematopoiesis, developing cells increasingly become more
restricted with regard to their potential to develop along multiple
lineages. Lineage-determinant transcription factors are thought to
drive this commitment process by upregulating the genes of a specific
lineage and downregulating genes specific to other lineages. For
example, the transcription factor E12 is thought to prevent B cells
from acquiring myeloid characteristics, because ectopic expression of
E12 in a macrophage cell line upregulated B-cell genes such as
5, BSAP/Pax5A, EBF, and
IL-7R and downregulated myeloid-specific genes
CD11b and c-fms.5 Because BSAP/Pax5A is
upregulated by E12,5 is itself a transcription factor that is thought to upregulate B-cell-associated
genes,23,24,27-31,50-61 and is required for B-cell
commitment, as determined by gene deletion studies,24 it
was of particular interest to determine if BSAP/Pax5A like E12 had
B-cell-determinant properties.
To test whether BSAP/Pax5A had B-cell-determinant properties,
BSAP/Pax5A was constitutively expressed in the EML cell. Surprisingly, BSAP/Pax5A-expressing EML cells did not upregulate the B-cell-specific genes CD19 or mb-1 (M. Chiang and J. Monroe,
unpublished observations). This finding suggested that
BSAP/Pax5A, although required for the expression of CD19 and mb-1 in
pre-B cells, as demonstrated by loss of function
analysis,31 is not sufficient for their expression,
presumably because of the absence of requisite cofactors or presence of
suppressive factors in the EML cell line. This finding is consistent
with the E12 study discussed earlier, which found that, although
BSAP/Pax5A was upregulated in EBF-expressing 70Z/3 macrophages, only
one B-cell gene, 5, was also
upregulated.5 Furthermore, BSAP/Pax5A is unlikely to be
responsible for this 5 upregulation, because
gain-of-function/loss-of-function genetic studies have shown that
5 is a target gene of EBF, but not of BSAP/Pax5A.24,31,62 Therefore, in EML cells and 70Z/3
macrophages, BSAP/Pax5A is not sufficient to upregulate the B-cell
genes that were examined.
BSAP/Pax5A-expressing EML cells differentiated to the myeloid lineage
in response to IL-3 by successfully acquiring de novo the
myeloid-restricted markers CD11b and F4/80. However, these early
myeloid cells then failed to expand in response to GM-CSF. To confirm
these results in a nontransformed cell, BSAP/Pax5A was retrovirally
transduced into primary bone marrow stem cells. When cultured in vitro,
BSAP/Pax5A-transduced stem cells successfully differentiated to the
myeloid lineage. However, the addition of myeloid growth factors to
these cultures showed a defect in cell expansion. Taken together, the
EML cell studies and primary bone marrow studies share consistent
results and thus provide strong evidence that BSAP/Pax5A, although
unable to completely suppress myeloid lineage differentiation, does
suppress the expansion response to myeloid growth factors, a
characteristic myeloid trait acquired shortly after the initiation of
myeloid commitment.
In this study, BSAP/Pax5A was ectopically expressed in stem cells to
demonstrate that BSAP/Pax5A can suppress myeloid cell expansion.
However, in vivo, BSAP/Pax5A is not expressed in multipotential stem
cells, but later in the fraction A1 stage of B-cell
development after B-cell commitment has already
occurred.15,17,23 It is formally possible that BSAP/Pax5A
is expressed in rare multipotential progenitors at low levels
undetectable by reverse transcriptase-polymerase chain reaction
(RT-PCR) and that a higher level of BSAP/Pax5A expression in these cells would prevent them from responding to myeloid
growth factors. However, because this possibility seems remote due to
the high sensitivity of PCR, the finding of BSAP/Pax5A-mediated suppression of myeloid expansion from stem cells more likely supports a
role for BSAP/Pax5A in preventing B cells from responding to myeloid
growth factors. This effect may in part maintain commitment to the B
lineage as some myeloid growth factors, notably IL-3 and
GM-CSF,63 have been shown to convert certain pre-B cell lines to the myeloid lineage.
Although early B cells in vivo seem to acquire some myeloid traits,
such as low levels of CD11b,15 they are prevented from expanding in response to myeloid growth factors and further
maturation,15 perhaps in part due to BSAP/Pax5A expression.
Because BSAP/Pax5A is not sufficient to completely prevent maturation
down the myeloid lineage, especially in the absence of growth factors,
there probably exists additional lineage-determinant genes that act
singly or together with BSAP/Pax5A to suppress myeloid differentiation. These genes are likely to be target genes of E12 in view of previous studies already discussed in which ectopic expression of E12 in a
macrophage cell line completely suppressed all myeloid characteristics that were reported.5
Whether BSAP/Pax5A is sufficient to suppress myeloid expansion in vivo
is currently being studied by generating mice transgenic for
BSAP/Pax5A. This question is particularly interesting, because studies
involving myeloid growth factor-deficient mice have indicated the
existence of multiple redundant mechanisms that can drive myelopoiesis.64 These mice display either normal or reduced (but never abrogated) myelopoiesis. For example,
IL-3/GM-CSFR/IL-5R-deficient mice,65 IL-3-deficient
mice,65 and GM-CSF-deficient mice66 all
display normal steady-state myelopoiesis. Granulocyte
colony-stimulating factor (G-CSF)-deficient mice
display neutropenia,67 which is somewhat exacerbated when
the GM-CSF gene is additionally deleted.68 M-CSF-deficient
mice have fewer macrophages and osteoclasts, but these cells accumulate
to near normal levels in older mice.69-71 Thus, the number
of growth factor responses that can be suppressed by BSAP/Pax5A will
dictate the degree to which enforced expression of BSAP/Pax5A will
suppress myelopoiesis in vivo. We predict, based on our studies
reported here, that IL-3-mediated responses may remain largely
unaffected in the presence of BSAP/Pax5A expression.
How BSAP/Pax5A suppresses myelopoiesis has proven elusive in part
because the effect of BSAP/Pax5A on the function and expression of the
downstream mediators of myeloid growth factor signal transduction cascade is unknown. Because the paired domain of BSAP/Pax5A can bind
the transcription factor Ets-1, which is itself involved in the
regulation of many myeloid genes,72 it was postulated that
BSAP/Pax5A could suppress Ets-1-mediated transactivation. However,
transient transfection of BSAP/Pax5A failed to inhibit Ets-1-mediated
transactivation of the CD18 promoter (M. Chiang and J. Monroe,
unpublished observations). Because BSAP/Pax5A
suppresses the expression of c-Myc in pre-B cells,31 it was
also postulated that, in myeloid cells, BSAP/Pax5A would similarly
suppress c-Myc, which is upregulated during GM-CSF
stimulation.73-76 However, transcripts of c-Myc in
BSAP/Pax5A-expressing EML cells were comparable to that in controls
after induction with IL-3 followed by stimulation with GM-CSF (M. Chiang and J. Monroe, unpublished observations). Currently, the effect of BSAP/Pax5A on the expression of the various myeloid growth factor receptors, such as IL-3R, -common,
IL-3R, and GM-CSFR, is being studied.
These studies expand on the results of the earlier E12 study by using
cells that are growth-factor dependent, early in development, and
nontransformed. Using growth-factor-dependent cells instead of the
growth factor-independent macrophage cell line 70Z/35 has
shown that BSAP/Pax5A affects the growth response of cells to myeloid
growth factors. Using progenitor stem cells instead of mature
macrophages has shown that BSAP/Pax5A can act in a model of early
development to prevent the acquisition of the myeloid growth factor
response, one of the earliest appearing myeloid-specific characteristics after myeloid commitment. This aspect of our studies is
relevant, because anecdotal reports of lineage switching to myeloid
cells in vitro have almost always involved cells early in development
when plasticity is thought to be greatest.6-9 In this
regard, our studies provide additional evidence that suppressive factors, which prohibit the acquisition of lineage-specific traits, may
be integral to maintaining B-lineage commitment as developing cells
chose between the B-cell and myeloid fates.
| |
ACKNOWLEDGMENT |
The authors thank Dr M. Busslinger for providing the pmBSAP-2 plasmid
and the anti-paired domain antisera, Dr S. Tsai for providing the EML
and BHK/MKL cell lines, Dr F. Melchers and A. Groenewegen for providing
the J558-IL-7 cell line, Dr W. Pear for providing the Mig R1 plasmid
and Bosc23 cell line, P. Sandel and Dr M. Atchison for critical reading
of the manuscript, and Dr L. King and Dr L. Xu for assistance in
designing the experimental protocols.
| |
FOOTNOTES |
Submitted May 12, 1999; accepted July 19, 1999.
Supported in part by Grants No. AI23568, AI 32592, and AI43620 from the
National Institutes of Health and the Medical Scientist Training Program.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to John G. Monroe, PhD, Room 311, Biomedical
Research Bldg II/III, 421 Curie Blvd, Philadelphia, PA 19104-6142.
| |
REFERENCES |
1.
Kulessa H, Frampton J, Graf T:
GATA-1 reprograms avian myelomonocytic cell lines into eosinophils, thromboblasts, and erythroblasts.
Genes Dev
9:1250, 1995[Abstract/Free Full Text]
2.
Nerlov C, Graf T:
PU.1 induces myeloid lineage commitment in multipotent hematopoietic progenitors.
Genes Dev
12:2403, 1998[Abstract/Free Full Text]
3.
Sieweke MH, Tekotte H, Frampton J, Graf T:
MafB is an interaction partner and repressor of Ets-1 that inhibits erythroid differentiation.
Cell
85:49, 1996[Medline]
[Order article via Infotrieve]
4.
Sieweke MH, Tekotte H, Frampton J, Graf T:
MafB represses erythroid genes and differentiation through direct interaction with c-Ets-1.
Leukemia
11:486, 1997
5.
Kee BL, Murre C:
Induction of early B cell factor (EBF) and multiple B lineage genes by the basic helix-loop-helix transcription factor E12.
J Exp Med
188:699, 1998[Abstract/Free Full Text]
6.
Davidson WF, Pierce JH, Rudikoff S, Morse HCd:
Relationships between B cell and myeloid differentiation. Studies with a B lymphocyte progenitor line, HAFTL-1.
J Exp Med
168:389, 1988[Abstract/Free Full Text]
7.
Bauer SR, Holmes KL, Morse HCd, Potter M:
Clonal relationship of the lymphoblastic cell line P388 to the macrophage cell line P388D1 as evidenced by immunoglobulin gene rearrangements and expression of cell surface antigens.
J Immunol
136:4695, 1986[Abstract]
8.
Boyd AW, Schrader JW:
Derivation of macrophage-like lines from the pre-B lymphoma ABLS 8.1 using 5-azacytidine.
Nature
297:691, 1982[Medline]
[Order article via Infotrieve]
9.
Holmes KL, Pierce JH, Davidson WF, Morse HCd:
Murine hematopoietic cells with pre-B or pre-B/myeloid characteristics are generated by in vitro transformation with retroviruses containing fes, ras, abl, and src oncogenes.
J Exp Med
164:443, 1986[Abstract/Free Full Text]
10.
Hara H, Sam M, Maki RA, Wu GE, Paige CJ:
Characterization of a 70Z/3 pre-B cell derived macrophage clone. Differential expression of Hox family genes.
Int Immunol
2:691, 1990[Abstract/Free Full Text]
11.
Klinken SP, Alexander WS, Adams JM:
Hemopoietic lineage switch: v-raf oncogene converts Emu-myc transgenic B cells into macrophages.
Cell
53:857, 1988[Medline]
[Order article via Infotrieve]
12.
Borzillo GV, Sherr CJ:
Early pre-B-cell transformation induced by the v-fms oncogene in long-term mouse bone marrow cultures.
Mol Cell Biol
9:3973, 1989[Abstract/Free Full Text]
13.
Borzillo GV, Ashmun RA, Sherr CJ:
Macrophage lineage switching of murine early pre-B lymphoid cells expressing transduced fms genes.
Mol Cell Biol
10:2703, 1990[Abstract/Free Full Text]
14.
Borrello MA, Phipps RP:
The B/macrophage cell: An elusive link between CD5+ B lymphocytes and macrophages.
Immunol Today
17:471, 1996[Medline]
[Order article via Infotrieve]
15.
Allman D, Li J, Hardy RR:
Commitment to the B lymphoid lineage occurs before DH-JH recombination.
J Exp Med
189:735, 1999[Abstract/Free Full Text]
16.
Hardy RR, Carmack CE, Shinton SA, Kemp JD, Hayakawa K:
Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse bone marrow.
J Exp Med
173:1213, 1991[Abstract/Free Full Text]
17.
Li YS, Wasserman R, Hayakawa K, Hardy RR:
Identification of the earliest B lineage stage in mouse bone marrow.
Immunity
5:527, 1996[Medline]
[Order article via Infotrieve]
18.
Mahmoud MS, Kawano MM:
Cloning and analysis of the human Pax-5 gene promoter.
Biochem Biophys Res Commun
228:159, 1996[Medline]
[Order article via Infotrieve]
19.
Walther C, Guenet JL, Simon D, Deutsch U, Jostes B, Goulding MD, Plachov D, Balling R, Gruss P:
Pax: A murine multigene family of paired box-containing genes.
Genomics
11:424, 1991[Medline]
[Order article via Infotrieve]
20.
Zwollo P, Arrieta H, Ede K, Molinder K, Desiderio S, Pollock R:
The Pax-5 gene is alternatively spliced during B-cell development.
J Biol Chem
272:10160, 1997[Abstract/Free Full Text]
21.
Busslinger M, Klix N, Pfeffer P, Graninger PG, Kozmik Z:
Deregulation of PAX-5 by translocation of the Emu enhancer of the IgH locus adjacent to two alternative PAX-5 promoters in a diffuse large-cell lymphoma.
Proc Natl Acad Sci USA
93:6129, 1996[Abstract/Free Full Text]
22.
Kozmik Z, Sure U, Ruedi D, Busslinger M, Aguzzi A:
Deregulated expression of PAX5 in medulloblastoma.
Proc Natl Acad Sci USA
92:5709, 1995[Abstract/Free Full Text]
23.
Reimold AM, Ponath PD, Li YS, Hardy RR, David CS, Strominger JL, Glimcher LH:
Transcription factor B cell lineage-specific activator protein regulates the gene for human X-box binding protein 1.
J Exp Med
183:393, 1996[Abstract/Free Full Text]
24.
Nutt SL, Urbanek P, Rolink A, Busslinger M:
Essential functions of Pax5 (BSAP) in pro-B cell development: Difference between fetal and adult B lymphopoiesis and reduced V-to-DJ recombination at the IgH locus.
Genes Dev
11:476, 1997[Abstract/Free Full Text]
25.
Bain G, Maandag EC, Izon DJ, Amsen D, Kruisbeek AM, Weintraub BC, Krop I, Schlissel MS, Feeney AJ, van Roon M, van der Valk M, te Riele HPJ, Berns A, Murre C:
E2A proteins are required for proper B cell development and initiation of immunoglobulin gene rearrangements.
Cell
79:885, 1994[Medline]
[Order article via Infotrieve]
26.
Urbanek P, Wang ZQ, Fetka I, Wagner EF, Busslinger M:
Complete block of early B cell differentiation and altered patterning of the posterior midbrain in mice lacking Pax5/BSAP.
Cell
79:901, 1994[Medline]
[Order article via Infotrieve]
27.
Okabe T, Watanabe T, Kudo A:
A pre-B- and B cell-specific DNA-binding protein, EBB-1, which binds to the promoter of the VpreB1 gene.
Eur J Immunol
22:37, 1992[Medline]
[Order article via Infotrieve]
28.
Zwollo P, Desiderio S:
Specific recognition of the blk promoter by the B-lymphoid transcription factor B-cell-specific activator protein.
J Biol Chem
269:15310, 1994[Abstract/Free Full Text]
29.
Fitzsimmons D, Hodsdon W, Wheat W, Maira SM, Wasylyk B, Hagman J:
Pax-5 (BSAP) recruits Ets proto-oncogene family proteins to form functional ternary complexes on a B-cell-specific promoter.
Genes Dev
10:2198, 1996[Abstract/Free Full Text]
30.
Kozmik Z, Wang S, Dorfler P, Adams B, Busslinger M:
The promoter of the CD19 gene is a target for the B-cell-specific transcription factor BSAP.
Mol Cell Biol
12:2662, 1992[Abstract/Free Full Text]
31.
Nutt SL, Morrison AM, Dorfler P, Rolink A, Busslinger M:
Identification of BSAP (Pax-5) target genes in early B-cell development by loss- and gain-of-function experiments.
EMBO J
17:2319, 1998[Medline]
[Order article via Infotrieve]
32.
McBurney MW, Sutherland LC, Adra CN, Leclair B, Rudnicki MA, Jardine K:
The mouse Pgk-1 gene promoter contains an upstream activator sequence.
Nucleic Acids Res
19:5755, 1991[Abstract/Free Full Text]
33.
Adams B, Dorfler P, Aguzzi A, Kozmik Z, Urbanek P, Maurer-Fogy I, Busslinger M:
Pax-5 encodes the transcription factor BSAP and is expressed in B lymphocytes, the developing CNS, and adult testis.
Genes Dev
6:1589, 1992[Abstract/Free Full Text]
34.
Pear WS, Miller JP, Xu L, Pui JC, Soffer B, Quackenbush RC, Pendergast AM, Bronson R, Aster JC, Scott ML, Baltimore D:
Efficient and rapid induction of a chronic myelogenous leukemia-like myeloproliferative disease in mice receiving P210 bcr/abl-transduced bone marrow.
Blood
92:3780, 1998[Abstract/Free Full Text]
35.
Tsai S, Bartelmez S, Sitnicka E, Collins S:
Lymphohematopoietic progenitors immortalized by a retroviral vector harboring a dominant-negative retinoic acid receptor can recapitulate lymphoid, myeloid, and erythroid development.
Genes Dev
8:2831, 1994[Abstract/Free Full Text]
36.
Nakano T, Kodama H, Honjo T:
Generation of lymphohematopoietic cells from embryonic stem cells in culture.
Science
265:1098, 1994[Abstract/Free Full Text]
37.
McMahon SB, Monroe JG:
A ternary complex factor-dependent mechanism mediates induction of egr-1 through selective serum response elements following antigen receptor cross-linking in B lymphocytes.
Mol Cell Biol
15:1086, 1995[Abstract]
38.
Czerny T, Schaffner G, Busslinger M:
DNA sequence recognition by Pax proteins: Bipartite structure of the paired domain and its binding site.
Genes Dev
7:2048, 1993[Abstract/Free Full Text]
39.
Pear WS, Nolan GP, Scott ML, Baltimore D:
Production of high-titer helper-free retroviruses by transient transfection.
Proc Natl Acad Sci USA
90:8392, 1993[Abstract/Free Full Text]
40.
Pear W:
Transduction of genes using retroviral vectors, in
Ausubel FM,
Brent R,
Kingston RE,
Moore DD,
Seidman JG,
Smith JA,
Struhl K
(eds):
Current Protocols in Molecular Biology. Brooklyn, NY, Wiley, 1998, p 9.9.1
41.
Leenen PJ, de Bruijn MF, Voerman JS, Campbell PA, van Ewijk W:
Markers of mouse macrophage development detected by monoclonal antibodies.
J Immunol Methods
174:5, 1994[Medline]
[Order article via Infotrieve]
42.
Austyn JM, Gordon S:
F4/80, a monoclonal antibody directed specifically against the mouse macrophage.
Eur J Immunol
11:805, 1981[Medline]
[Order article via Infotrieve]
43.
Springer T, Galfre G, Secher DS, Milstein C:
Mac-1: A macrophage differentiation antigen identified by monoclonal antibody.
Eur J Immunol
9:301, 1979[Medline]
[Order article via Infotrieve]
44.
Hirsch S, Austyn JM, Gordon S:
Expression of the macrophage-specific antigen F4/80 during differentiation of mouse bone marrow cells in culture.
J Exp Med
154:713, 1981[Abstract/Free Full Text]
45.
Morrison SJ, Hemmati HD, Wandycz AM, Weissman IL:
The purification and characterization of fetal liver hematopoietic stem cells.
Proc Natl Acad Sci USA
92:10302, 1995[Abstract/Free Full Text]
46.
McFarland HI, Nahill SR, Maciaszek JW, Welsh RM:
CD11b (Mac-1): A marker for CD8+ cytotoxic T cell activation and memory in virus infection.
J Immunol
149:1326, 1992[Abstract]
47.
Miyama-Inaba M, Kuma S, Inaba K, Ogata H, Iwai H, Yasumizu R, Muramatsu S, Steinman RM, Ikehara S:
Unusual phenotype of B cells in the thymus of normal mice.
J Exp Med
168:811, 1988[Abstract/Free Full Text]
48.
Osawa M, Hanada K, Hamada H, Nakauchi H:
Long-term lymphohematopoietic reconstitution by a single CD34-low/negative hematopoietic stem cell.
Science
273:242, 1996[Abstract]
49.
Osawa M, Nakamura K, Nishi N, Takahasi N, Tokuomoto Y, Inoue H, Nakauchi H:
In vivo self-renewal of c-Kit+ Sca-1+ Lin(low/) hemopoietic stem cells.
J Immunol
156:3207, 1996[Abstract]
50.
Liao F, Birshtein BK, Busslinger M, Rothman P:
The transcription factor BSAP (NF-HB) is essential for immunoglobulin germ-line epsilon transcription.
J Immunol
152:2904, 1994[Abstract]
51.
Tian J, Okabe T, Miyazaki T, Takeshita S, Kudo A:
Pax-5 is identical to EBB-1/KLP and binds to the VpreB and lambda5 promoters as well as the KI and KII sites upstream of the Jkappa genes.
Eur J Immunol
27:750, 1997[Medline]
[Order article via Infotrieve]
52.
Singh M, Birshtein BK:
NF-HB (BSAP) is a repressor of the murine immunoglobulin heavy-chain 3' alpha enhancer at early stages of B-cell differentiation.
Mol Cell Biol
13:3611, 1993[Abstract/Free Full Text]
53.
Neurath MF, Max EE, Strober W:
Pax5 (BSAP) regulates the murine immunoglobulin 3' alpha enhancer by suppressing binding of NF-alpha P, a protein that controls heavy chain transcription.
Proc Natl Acad Sci USA
92:5336, 1995[Abstract/Free Full Text]
54.
Rinkenberger JL, Wallin JJ, Johnson KW, Koshland ME:
An interleukin-2 signal relieves BSAP (Pax5)-mediated repression of the immunoglobulin J chain gene.
Immunity
5:377, 1996[Medline]
[Order article via Infotrieve]
55.
Stuart ET, Haffner R, Oren M, Gruss P:
Loss of p53 function through PAX-mediated transcriptional repression.
EMBO
14:5638, 1995[Medline]
[Order article via Infotrieve]
56.
Marcu KB, Xu L, Kim MG:
S alpha BP/BSAP/NF-S mu B1, a murine and human B cell stage specific nuclear factor with DNA binding specificity implying roles in switch-recombination and transcription.
Curr Top Microbiol Immunol
182:167, 1992[Medline]
[Order article via Infotrieve]
57.
Xu L, Kim MG, Marcu KB:
Properties of B cell stage specific and ubiquitous nuclear factors binding to immunoglobulin heavy chain gene switch regions.
Int Immunol
4:875, 1992[Abstract/Free Full Text]
58.
Kehrl JH, Riva A, Wilson GL, Thevenin C:
Molecular mechanisms regulating CD19, CD20 and CD22 gene expression.
Immunol Today
15:432, 1994[Medline]
[Order article via Infotrieve]
59.
Waters SH, Saikh KU, Stavnezer J:
A B-cell-specific nuclear protein that binds to DNA sites 5' to immunoglobulin S alpha tandem repeats is regulated during differentiation.
Mol Cell Biol
9:5594, 1989[Abstract/Free Full Text]
60.
Rothman P, Chen YY, Lutzker S, Li SC, Stewart V, Coffman R, Alt FW:
Structure and expression of germ line immunoglobulin heavy-chain epsilon transcripts: Interleukin-4 plus lipopolysaccharide-directed switching to C epsilon.
Mol Cell Biol
10:1672, 1990[Abstract/Free Full Text]
61.
Roque MC, Smith PA, Blasquez VC:
A developmentally modulated chromatin structure at the mouse immunoglobulin kappa 3' enhancer.
Mol Cell Biol
16:3138, 1996[Abstract]
62.
Sigvardsson M, O'Riordan M, Grosschedl R:
EBF and E47 collaborate to induce expression of the endogenous immunoglobulin surrogate light chain genes.
Immunity
7:25, 1997[Medline]
[Order article via Infotrieve]
63.
Martin M, Strasser A, Baumgarth N, Cicuttini FM, Welch K, Salvaris E, Boyd AW:
A novel cellular model (SPGM 1) of switching between the pre-B cell and myelomonocytic lineages.
J Immunol
150:4395, 1993[Abstract]
64.
Lieschke GJ:
CSF-deficient mice What have they taught us?
Ciba Found Symp
204:60, 1997[Medline]
[Order article via Infotrieve]
65.
Nishinakamura R, Miyajima A, Mee PJ, Tybulewicz VL, Murray R:
Hematopoiesis in mice lacking the entire granulocyte-macrophage colony-stimulating factor/interleukin-3/interleukin-5 functions.
Blood
88:2458, 1996[Abstract/Free Full Text]
66.
Stanley E, Lieschke GJ, Grail D, Metcalf D, Hodgson G, Gall JA, Maher DW, Cebon J, Sinickas V, Dunn AR:
Granulocyte/macrophage colony-stimulating factor-deficient mice show no major perturbation of hematopoiesis but develop a characteristic pulmonary pathology.
Proc Natl Acad Sci USA
91:5592, 1994[Abstract/Free Full Text]
67.
Lieschke GJ, Grail D, Hodgson G, Metcalf D, Stanley E, Cheers C, Fowler KJ, Basu S, Zhan YF, Dunn AR:
Mice lacking granulocyte colony-stimulating factor have chronic neutropenia, granulocyte and macrophage progenitor cell deficiency, and impaired neutrophil mobilization.
Blood
84:1737, 1994[Abstract/Free Full Text]
68.
Seymour JF, Lieschke GJ, Grail D, Quilici C, Hodgson G, Dunn AR:
Mice lacking both granulocyte colony-stimulating factor (CSF) and granulocyte-macrophage CSF have impaired reproductive capacity, perturbed neonatal granulopoiesis, lung disease, amyloidosis, and reduced long-term survival.
Blood
90:3037, 1997[Abstract/Free Full Text]
69.
Wiktor-Jedrzejczak WW, Ahmed A, Szczylik C, Skelly RR:
Hematological characterization of congenital osteopetrosis in op/op mouse. Possible mechanism for abnormal macrophage differentiation.
J Exp Med
156:1516, 1982[Abstract/Free Full Text]
70.
Begg SK, Radley JM, Pollard JW, Chisholm OT, Stanley ER, Bertoncello I:
Delayed hematopoietic development in osteopetrotic (op/op) mice.
J Exp Med
177:237, 1993[Abstract/Free Full Text]
71.
Cecchini MG, Dominguez MG, Mocci S, Wetterwald A, Felix R, Fleisch H, Chisholm O, Hofstetter W, Pollard JW, Stanley ER:
Role of colony stimulating factor-1 in the establishment and regulation of tissue macrophages during postnatal development of the mouse.
Development
120:1357, 1994[Abstract]
72.
Bassuk AG, Leiden JM:
The role of Ets transcription factors in the development and function of the mammalian immune system.
Adv Immunol
64:65, 1997[Medline]
[Order article via Infotrieve]
73.
Eder M, Griffin JD, Ernst TJ:
The human granulocyte-macrophage colony-stimulating factor receptor is capable of initiating signal transduction in NIH3T3 cells.
EMBO J
12:1647, 1993[Medline]
[Order article via Infotrieve]
74.
Watanabe S, Mui AL, Muto A, Chen JX, Hayashida K, Yokota T, Miyajima A, Arai K:
Reconstituted human granulocyte-macrophage colony-stimulating factor receptor transduces growth-promoting signals in mouse NIH 3T3 cells: Comparison with signalling in BA/F3 pro-B cells.
Mol Cell Biol
13:1440, 1993[Abstract/Free Full Text]
75.
Sakamaki K, Miyajima I, Kitamura T, Miyajima A:
Critical cytoplasmic domains of the common beta subunit of the human GM-CSF, IL-3 and IL-5 receptors for growth signal transduction and tyrosine phosphorylation.
EMBO J
11:3541, 1992[Medline]
[Order article via Infotrieve]
76.
Sato N, Sakamaki K, Terada N, Arai K, Miyajima A:
Signal transduction by the high-affinity GM-CSF receptor: two distinct cytoplasmic regions of the common beta subunit responsible for different signaling.
EMBO J
12:4181, 1993[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
K. Anderson, C. Rusterholz, R. Mansson, C. T. Jensen, K. Bacos, S. Zandi, Y. Sasaki, C. Nerlov, M. Sigvardsson, and S. E. W. Jacobsen
Ectopic expression of PAX5 promotes maintenance of biphenotypic myeloid progenitors coexpressing myeloid and B-cell lineage-associated genes
Blood,
May 1, 2007;
109(9):
3697 - 3705.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Bai, L. Srinivasan, L. Perkins, and M. L. Atchison
Protein Acetylation Regulates Both PU.1 Transactivation and Ig{kappa} 3' Enhancer Activity
J. Immunol.,
October 15, 2005;
175(8):
5160 - 5169.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. V. Cotta, Z. Zhang, H.-G. Kim, and C. A. Klug
Pax5 determines B- versus T-cell fate and does not block early myeloid-lineage development
Blood,
June 1, 2003;
101(11):
4342 - 4346.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Iwasaki-Arai, H. Iwasaki, T. Miyamoto, S. Watanabe, and K. Akashi
Enforced Granulocyte/Macrophage Colony-stimulating Factor Signals Do Not Support Lymphopoiesis, but Instruct Lymphoid to Myelomonocytic Lineage Conversion
J. Exp. Med.,
May 19, 2003;
197(10):
1311 - 1322.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Yu, D. Allman, M. H. Goldschmidt, M. L. Atchison, J. G. Monroe, and A. Thomas-Tikhonenko
Oscillation between B-lymphoid and myeloid lineages in Myc-induced hematopoietic tumors following spontaneous silencing/reactivation of the EBF/Pax5 pathway
Blood,
March 1, 2003;
101(5):
1950 - 1955.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. A. Evans, S. Ariffin, A. Pierce, and A. D. Whetton
Identification of primary structural features that define the differential actions of IL-3 and GM-CSF receptors
Blood,
October 16, 2002;
100(9):
3164 - 3174.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. J. Collins, J. Ulmer, L. E. Purton, and G. Darlington
Multipotent hematopoietic cell lines derived from C/EBP{alpha}({-}/{-}) knockout mice display granulocyte macrophage-colony-stimulating factor, granulocyte- colony-stimulating factor, and retinoic acid-induced granulocytic differentiation
Blood,
October 15, 2001;
98(8):
2382 - 2388.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. E. Mebius, T. Miyamoto, J. Christensen, J. Domen, T. Cupedo, I. L. Weissman, and K. Akashi
The Fetal Liver Counterpart of Adult Common Lymphoid Progenitors Gives Rise to All Lymphoid Lineages, CD45+CD4+CD3- Cells, As Well As Macrophages
J. Immunol.,
June 1, 2001;
166(11):
6593 - 6601.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Y. Chiang and J. G. Monroe
Role for Transcription Pax5A Factor in Maintaining Commitment to the B Cell Lineage by Selective Inhibition of Granulocyte-Macrophage Colony-Stimulating Factor Receptor Expression
J. Immunol.,
May 15, 2001;
166(10):
6091 - 6098.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION