|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 11 (December 1), 1999:
pp. 3806-3813
Fibrinogen Niigata With Impaired Fibrin Assembly: An Inherited
Dysfibrinogen With a B Asn-160 to Ser Substitution Associated
With Extra Glycosylation at B Asn-158
By
Teruko Sugo,
Chizuko Nakamikawa,
Hiroshi Takano,
Jun Mimuro,
Shu-ichi Yamaguchi,
Michael W. Mosesson,
David A. Meh,
James P. DiOrio,
Noriko Takahashi,
Hoyu Takahashi,
Koichi Nagai, and
Michio Matsuda
From the Institute of Hematology, Jichi Medical School, Tochigi,
Japan; Sinai Samaritan Medical Center, University of Wisconsin Medical
School, Milwaukee Clinical Campus, Milwaukee, WI; Baxter Healthcare,
Round Lake, IL; GlycoLab, Nakano Vinegar Co, Handa, Aichi,
Japan; Katahigashi-Keyaki Hospital, Katahigashimura, Niigata, Japan;
and Niigata Prefectural Central Hospital, Joetsu, Niigata, Japan.
 |
ABSTRACT |
A novel B Asn-160 (TAA) to Ser (TGA)
substitution has been identified in fibrinogen Niigata derived from a
64-year-old asymptomatic woman, who is heterozygotic for this
abnormality. The mutation creates an Asn-X-Ser-type glycosylation
sequence, and a partially sialylated biantennary oligosaccharide was
linked to the BAsn-158 residue. The functional abnormality was
attributed to delayed lateral association of normally formed
double-stranded protofibrils based on normal cross-linking of fibrin
 -chains and tissue-type plasminogen activator-catalyzed plasmin
generation by polymerizing fibrin monomers. Enzymatic removal of all
the N-linked oligosaccharides from fibrinogen Niigata accelerated
fibrin monomer polymerization that reached the level of untreated
normal fibrin monomers, but the thrombin time was prolonged from 18.2 seconds to 113 seconds (normal: 11.2 seconds to 8.9 seconds). By
scanning electron micrographic analysis, Niigata fibrin fibers were
found to be more curvilinear than normal fibrin fibers. After
deglycosylation, Niigata fibers became straight being similar to
untreated normal fibrin fibers, whereas normal deglycosylated fibrin
appeared to be less-branched than untreated normal or deglycosylated
Niigata fibrin. Although normal and Niigata fibrins were similar to
each other in permeation and compaction studies, deglycosylated normal
and Niigata fibrins had much higher permeability and compaction values,
indicating that deglycosylation had brought about the formation of more
porous networks. The enzymatic deglycosylation necessitates an Asn to Asp change at position B-158 that is responsible for reducing the
fiber thickness because of either local repulsive forces or steric
hindrance in the coiled-coil region.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
FIBRINOGEN IS a glycoprotein composed of
3 pairs of nonidentical chains (A , B, )2 with a combined
molecular weight of 340,000. It contains approximately 3% carbohydrate
consisting of Asn-linked biantennary oligosaccharide skeletons with
different amounts of sialic acid linked to their terminal galactose
residues.1,2 The major component is a monosialylated
oligosaccharide accounting for about 62% followed by a disialylated
oligosaccharide accounting for 22%.1-4 The oligosaccharide
chains are normally linked to Asn-364 of the B chain5
and Asn-52 of the -chain.6 There are 2 other potential
N-glycosylation sequences on the A chain, but they are not linked
with oligosaccharide moieties because of the presence of neighboring
Pro residues.7 No O-linked oligosaccharides have been
identified in any subunits of human fibrinogen.
Five hereditary dysfibrinogens with an amino acid substitution that
generates an Asn-X-Ser/Thr type sequence have been reported to have an
extra oligosaccharide at an Asn residue with the same biantennary
structures found in normal fibrinogen.3,4,8-10 Such an
extra oligosaccharide has been identified in fibrinogen Pontoise at
B Asn-333,8 Asahi at Asn-308,9 Lima at
A Asn-139,4 Caracas II at A Asn-434,3 and
Kaiserslautern at Asn-380.10 In the last 3 fibrinogens,
the major component was a disialylated oligosaccharide accounting for
68.6%, 81.9%, and 95%, respectively.
The role of carbohydrate in fibrinogen function has not been clarified
as yet, but carbohydrate is proposed to be involved in the regulation
of fibrin assembly by contributing a repulsive force to form stable
fibrin networks.11 Indeed, all the extra-glycosylated dysfibrinogens manifest altered fibrin assembly at various stages of
fibrin network formation. Electron microscopic analysis of the Caracas
II fibrin showed that the fibrin networks were made up of thinner and
less ordered fibers than normal control and retained normal stiffness,
although permeability of the clots increased.12 These data
were consistent with biochemical analysis data.3
In this paper, we describe a dysfibrinogen, designated as fibrinogen
Niigata, associated with an extra oligosaccharide unit at Asn-158 on
the B-chain. The study involves ultrastructural analysis of
fibrinogen Niigata and its fibrin structure, mainly focusing on the
evaluation of the extra oligosaccharide in the molecule.
| |
MATERIALS AND METHODS |
Fibrinogen was purified from normal and patient citrated plasma, and
human -thrombin was prepared from prothrombin essentially as
described previously.13,14 Recombinant 2-chain
tissue-plasminogen activator (t-PA) was prepared from myeloma cells.
The following enzymes were purchased: human -thrombin used in the
permeation and compaction experiments was from Enzyme Research
Laboratories (South Bend, IL); lysylendopeptidase from Wako Chemical Co
(Osaka, Japan); almond glycopeptidase from Seikagaku Kogyo (Tokyo,
Japan); and recombinant N-Glycosidase F from Boehringer Mannheim
Biochemica (Mannheim, Germany). The following HPLC columns were used:
phenyl-5PW-RP and TSK-Gel Amide-80 from Tosoh (Tokyo, Japan); Cosmosil
5C18P from Nakalai Chemicals Ltd (Kyoto, Japan); and Shimpack CLC-ODS from Shimadzu (Kyoto, Japan).
Description of the patient.
A 64-year-old woman was suspected of having a dysfibrinogenemia based
on coagulation studies conducted before surgery for a urinary bladder
tumor. Namely, there was a marked discrepancy between fibrinogen levels
in plasma determined by 2 assays: less than 50 mg/100 mL by a thrombin
time method and 412 mg/100 mL by a turbidimetric method, where the
heat-denatured (56°C, 10 minutes) fibrinogen in 30-fold diluted
plasma with 0.5% EDTA in 0.9% NaCl was quantified at 660 nm by using
a calibration curve with normal pooled plasma. The one-stage
prothrombin time (PT) and the activated partial thromboplastin time
(aPTT) were both in the normal ranges. The patient underwent surgery
without any excessive bleeding or postoperative thrombosis despite this
abnormality. Her son displayed the same type of coagulation
abnormalities but no history of bleeding or thrombotic tendencies.
Studies on purified fibrinogen.
Coagulation studies were performed according to standard procedures.
When the Niigata fibrinogen was clotted with -thrombin (1.0 NIH
U/mL), the fibrin clot remained transparent over 1 hour of incubation
but became turbid with further elapse of time. Aggregation studies of
preformed and acid-solubilized fibrin monomer and the enhancement of
t-PA-catalyzed activation of plasminogen by the polymerizing fibrin
monomer were performed essentially as described previously.15
Factor XIIIa-catalyzed cross-linking of fibrin.
The Niigata fibrinogen (0.5 mg/mL) was clotted at 25°C with
-thrombin (1.0 NIH U/mL) and factor XIII (1.25 U/mL) in 32 µL of
TBS containing 5 mmol/L CaCl2. At timed intervals, 0.6 µL
of 0.2 mol/L ethylendiaminetetraacetate-Na2 (EDTA) was
added and the clots were immediately dissolved in a reducing sodium
dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) solution
(1.5 mol/L Tris-HCl, pH 8.8 containing 3% SDS, 8 mmol/L
dithiothreitol, 2 mmol/L EDTA, and 8 mol/L urea) and subjected to PAGE analysis.
Lysylendopeptidase mapping of the fibrinogen
B-chain.
The 3 subunits of fibrinogen were separated after reduction and
S-pyridylethylation by high performance liquid chromatography (HPLC)
using a TSK gel Phenyl-5PW-RP column (4.6 × 75 mm). They were
eluted in the order of A, B, and chains with a linear gradient (40 minutes) from 30% to 40% acetonitrile. The Niigata B
chain was eluted in 2 partially separated peaks, namely, when the
gradient was withheld while the A-chain was being eluted; they were
separated into 2 peaks with a ratio of about 1:1 (calculated from peak
areas). For better estimation of the ratio of normal (B) and
abnormal (B') peptide in peptide mapping experiments, the 2 peaks
were combined as the pyridylethylated (PE)-Niigata B-chain. The
PE-Niigata B-chain (0.1 mg/mL, 130 µg) was digested with
lysylendopeptidase (E/S = 1/50, w/w) at 37°C for 18 hours in 50 mmol/L Tris-HCl, pH 9.0 containing 3 mol/L urea and analyzed by HPLC on
a column of Cosmosil 5C18P (4.6 × 150 mm) using a linear gradient
elution from 0% to 40% acetonitrile in 100 minutes.
Amino acid composition and sequence analysis.
The amino acid compositions of fibrinopeptides A, AY, and B were
analyzed with an amino acid analyzer, Derivatizer, model 420H
(PE-Biosystems, Foster City, CA). The amino acid sequence analyses of 3 peptides, Niigata K47, Niigata K49 and normal K48 (see
Fig 2 in Results) were conducted by using a 20% to 25% volume of each
fraction with a Protein Sequencer, model 476A (PE-Applied Biosystems).
Analysis of N-linked oligosaccharide moieties by 3-dimensional
mapping.
About 1 nmol of Niigata K-47 was double digested with almond
glycopeptidase A and thermolysin to liberate the oligosaccharide moieties. The oligosaccharide moieties were purified by HPLC on an
anion-exchange column, and then modified to pyridylaminated (PA)-oligosaccharide as described previously.3,4 The
PA-oligosaccharide was injected onto an ODS-silica column for
identification by a 3-dimensional mapping technique as described
previously.16
Enzymatic elimination of N-linked oligosaccharides in fibrinogen.
To eliminate N-linked oligosaccharide from fibrinogen, we selected
Glycosidase F as a cleaving enzyme because it is known to function
under a neutral pH and nondenaturing conditions. Fibrinogen (10 mg/mL)
was incubated with 4 units of Glycosidase F in a 120 µL of 10 mmol/L
Tris-HCl, pH 7.4, containing 0.15 mol/L NaCl (TBS) at 37°C for 24 hours. After this incubation, most of the N-linked oligosaccharides
from the B, B', and chains were removed as evidenced by
SDS-PAGE. Removal of oligosaccharide moieties was confirmed also by
agarose gel electrophoresis, in which both enzyme-treated normal and
Niigata fibrinogens migrated to more anodal regions than the intact
molecules (data not shown). The fibrinogens thus prepared were
subjected to functional analyses including clotting, aggregation of
fibrin monomer, permeation and compaction studies.
Nucleotide sequencing of exon IV of the fibrinogen B-chain gene.
The DNA fragment coding exon IV of the fibrinogen B-chain gene was
amplified by polymerase chain reaction (PCR) using a synthesized primer, BF4, corresponding to nucleotides 4872-4896 in intron 3 (TATATGTCATGCGCCAAATCATTTC), and a 100-fold excess of primer B4R
(GGTGTGTGAGTTCTTCTGGAACTCT), corresponding to the complementary sequence of nucleotides 5298-5322 in intron 4 of the fibrinogen B-chain gene. The DNA product obtained consisted mostly of a single-strand DNA fragment with the primer B4R-derived fragment on its
5' end, and was directly sequenced using Sequenase (Amersham, Arlington
Heights, IL), 35S-dATP (Amersham) and primer B4F essentially according
to Gyllensten and Erlich.17
Permeation studies.
Permeability measurements were performed according to the methods of
Nair and Dhall,18 with a slight modification. Fibrin networks with a height of approximately 4 cm were formed in polystyrene tubes (4 mm in diameter), which had been precoated with fibrinogen at 1 mg/mL and air-dried before use. Clotting was initiated in a separate
tube with a mixture of fibrinogen (2 mg/mL) and thrombin (0.05 NIH
U/mL) in TBS, and the mixture was immediately transferred to another
tube and incubated overnight at 22°C. Before the measurement of flow
rate, irregularities or defects in fibrin network formation (ie,
channeling) were examined by passing a solution of fuchsin basic.
Permeation experiments were performed with pressure gradients of 2- to
3-fold clot height, and pressure was kept constant during the
experiment. Flow rate was determined by measurements of the volume of
liquid eluted over a fixed period of time. After the rate
determinations, channeling along the walls or other irregularities of
flow through the gels were again examined by passing a solution of
fuchsin basic.
The permeability constant ( ) was determined from Darcy's law:
where "Q/t" is the
flow rate; " ," the relative viscosity of the buffer;
"h," the length of the clot; "F," its cross-sectional area
and "p," the applied pressure.
Compaction studies.
Compaction experiments were performed by a minor modification of a
previously described method.19 Conical microfuge tubes were
precoated with cooking oil and dried with a cotton swab. The fibrin
matrix was formed in these tubes with 0.60 mg/mL fibrinogen, 0.06 NIH
U/mL thrombin in TBS. After incubation at 25°C for 2 hours, the tubes
were centrifuged at 4200g for 30 seconds and the volume of the
expelled buffer was withdrawn and measured with a Hamilton
syringe (Hamilton Co, Reno, NV). Percentage compaction was expressed as
the ratio of the expressed volume to the original volume (0.75 mL) of
the clot.
Specimen preparation for electron microscopy.
For examination of fibrin by scanning electron microscopy (SEM), fibrin
was formed on carbon-formvar coated gold grids in 50 mmol/L Tris-HCl,
pH 7.4, containing 0.1 mol/L NaCl and 0.1 U/mL thrombin. Clots were
incubated for 3 hours in a humidity chamber, then fixed with 2.5%
glutaraldehyde in 0.1 mol/L Hepes buffer, pH 7 containing 0.2% tannic
acid, washed several times with Hepes buffer, dehydrated in graded
ethanol solutions, CO2 critical point dried, and
sputter-coated with platinum-gold. SEM was performed in a
JEOL JSM6300F Field Emission Scanning Electron Microscope
(Japan Electron Optics Laboratory, Tokyo, Japan). Samples of fibrinogen
for transmission electron microscopy (TEM) were formed from stock
solutions of 1 mg/mL or higher in 30% glycerol, containing 0.15 mol/L
ammonium acetate, pH 7 buffer, diluted to 30 µg/mL in the above
buffer, sprayed onto freshly cleaved mica sheets, rotary shadowed with
platinum-carbon, and then examined in a Philips 400 electron microscope
(Philips, Amsterdam, The Netherlands).
| |
RESULTS |
Abnormality of purified fibrinogen Niigata.
The patient-derived purified fibrinogen has 2 species of the B chain
denoted as B' and B as evidenced by SDS-PAGE (Fig 1). The B chain species corresponded to
the normal B chain, whereas the B' chain species was found to
have a molecular weight higher by about 3,000 as compared with the
normal B chain. The A and chains appeared to be normal.
View larger version (99K):
[in this window]
[in a new window]
| Fig 1.
Subunit polypeptides of purified fibrinogen Niigata
examined by SDS-PAGE. To each lane 1.5 µg of protein was loaded on
7.5% to 12.5% gradient gel under the reducing (lanes 1 and 2) or
nonreducing (lanes 3 and 4) conditions and the proteins were stained
with Coomassie Brilliant Blue R250. Lanes 1 and 3 are normal fibrinogen
and lanes 2 and 4 are patient's fibrinogen.
|
|
The thrombin time of fibrinogen Niigata was 18.4 seconds (control, 11.8 seconds) and the addition of Ca2+ corrected it partially
(14.8 seconds; control, 10.8 seconds). Profiles of
-thrombin-released fibrinopeptides A and B were indistinguishable from those for normal as evidenced by SDS-PAGE and HPLC elution profiles, and both peptides were normal as assessed by amino acid composition analysis (data not shown).
In the absence of Ca2+, fibrinogen Niigata formed at first
a transparent clot on incubation with thrombin, which then gradually transformed to a turbid clot. The aggregation profile of Niigata fibrin
monomer disclosed an elongated lag phase, a normal increase in
turbidity and low maximum amplitude as compared with normal control
(Fig 2). In the presence of
Ca2+, a turbid clot was formed as a normal fibrin clot,
which was expected from the normal aggregation profile of Niigata
fibrin in the presence of Ca2+. Because the Niigata fibrin
monomer manifested almost normal enhancement of t-PA-mediated
plasminogen activation (data not shown), and the factor XIIIa-catalyzed
cross-linking of the -chain took place in a normal fashion (data not
shown), double-stranded protofibrils may have been constructed normally
via a set of `A'-`a' polymerization sites.
View larger version (19K):
[in this window]
[in a new window]
| Fig 2.
Aggregation profiles of acid-solubilized fibrin monomers
derived from normal, DG-normal, Niigata, and DG-Niigata fibrinogen.
Aggregation of acid-solubilized fibrin monomer was studied by
monitoring absorbance at 350 nm. Each fibrin monomer was prepared as
described in Materials and Methods. DG-normal and Niigata fibrin
monomer were expressed as Normal (+Glycosidase) and Niigata
(+Glycosidase).
|
|
Identification of an aberrant peptide in lysylendopeptidase digests
of the PE-B-chain.
In the mapping profile of the lysylendopeptidase digests of PE-B
chain derived from the patient's and normal fibrinogen, there was an
aberrant peptide peak in the patient's PE-B digests (Fig
3, upper panel), denoted as K47, which was
not present in the normal PE-B digests (Fig 3, lower panel). On the
other hand, the peptide peak denoted as K49 in the patient's PE-B
digests was apparently smaller than the normal counterpart (K48) in the normal PE-B digests. Niigata K47 and K49 and normal K48 were found
to compose the B (149-178) segment by amino acid sequence analysis.
The amino acid sequence of Niigata K47 was identical with that of
Niigata K49 except at cycles 10 and 12 (Table
1). At cycle 10 (position 158), no
PTH-amino acid derivative was identified, because the solvent system
used in the protein sequencer could not extract the sugar-attached
PTH-Asn. At cycle 12, (position 160), Ser was identified instead of
Asn. The amino acid substitution was verified by analysis of the
nucleotide sequence of PCR-amplified exon-IV of the fibrinogen
B-chain gene derived from the patient, in which adenine (A) at
position 5121 had been replaced by guanine (G), thus constructing a
codon TGA coding for Ser instead of Asn at position 160 of
the B-chain (Fig 4). This mutation
created an Asn-X-Ser-type consensus sequence for N-glycosylation of
the Asn residue in this region. Indeed, we isolated oligosaccharide moieties from Niigata K47 as anticipated and identified their structure
by the 3-dimensional oligosaccharide mapping technique (Fig
5). The purified oligosaccharides were
mixtures of 4 kinds of biantennary skeleton oligosaccharides with or
without sialic acid linked to their terminal galactose residues. The
major component was monosialyl oligosaccharides (Mono-S) accounting for
47%, followed by neutral oligosaccharides (Neutral-a and Neutral-b)
and disialyl oligosaccharides (Di-S) accounting for 39% and 13%,
respectively (Table 2). The content of
neutral oligosacharides in K47 was higher than those found in the extra
oligosaccharide units in fibrinogens Lima, Caracas II, and
Kaiserslautern, where at much higher rates the oligosaccharides were
disialylated.3,4,10 The structures of the extra
oligosaccharides are shown in Table 2.
View larger version (33K):
[in this window]
[in a new window]
| Fig 3.
HPLC profile of lysylendopeptidase digests of B-chain.
The lysylendopeptidase digests of PE-B chains derived from normal
fibrinogen and fibrinogen Niigata were injected on to a Cosmosil 5C18P
column (4.6 × 150 nm), and the peptides were eluted with a linear
gradient from 0% to 40% acetonitril in 100 minutes. Three peaks,
Niigata K47 (*), Niigata K49 (**), and normal K48 (**), were collected
and subjected to N-terminal amino acid sequence analysis.
|
|
View larger version (42K):
[in this window]
[in a new window]
| Fig 4.
Direct nucleotide sequencing of PCR-amplified exon IV of
the patient-derived fibrinogen B-chain gene. The DNA sample of
PCR-amplified exon of patient's fibrinogen B-chain gene was
subjected to urea-PAGE and subsequently to autoradiography. Part of the
autoradiogram is shown. The arrow indicates the mutation of G for A at
position 5121, coding Ser (TGA) for Asn (TAA) at position 160 of the
fibrinogen chain.
|
|
View larger version (15K):
[in this window]
[in a new window]
| Fig 5.
Analysis of PA-oligosaccharides derived from Niigata K47
peptide by HPLC on an octadecylsilyl (ODS)-silica column. The Niigata
peptide was double digested with glycopeptidase from almond and
thermolysin to form the oligosaccharides. The oligosaccharides were
purified by HPLC on a column of DEAE column and then subjected to
aminopyridylation. The PA-oligosaccharides were injected to an ODS
column for the identification by 3-dimensional mapping technique. From
the 3-D elution mapping chart, the Niigata K47 peptide was found to
contain 2 kinds of biantennary neutral oligosaccharides (Neutral-a and
Neutral-b) and biantennary sialyl oligosaccharides (Mono-S and Di-S),
respectively.
|
|
Effect of removal of extra oligosaccharides on the fibrin clot
formation.
We prepared deglycosylated (DG)-Niigata fibrinogen to clarify the
effect of extra oligosaccharides on the clot formation. Incubation of
fibrinogens with Glycosidase F resulted in the decrease of relative
molecular masses of the B and -chains of normal and Niigata
fibrinogens by about 4,000 (Fig 6), which
was consistent with the oligosaccharide moiety at Asn-364 and Asn-52 of
normal fibrinogen, respectively. It is notable that 2 B-chain bands were detected in Niigata fibrinogen on Laemmli's SDS-PAGE even after
the removal of all N-linked oligosaccharides. This molecular difference
may be because of the presence of newly formed Asp-158 in the variant
B-chain, because such alterations in electrophoretic mobility have
been described in a variety of proteins with a single point mutation
including congenital dysfibrinogens.20-23 These data also
suggest that there is a distinct structural difference between the 2 DG-fibrinogen molecules. Indeed, a significant difference in the
thrombin clotting of these DG-fibrinogens was observed (Table
3). DG-normal fibrinogen had a slightly
shortened thrombin time (11.3 seconds to 8.9 seconds) and formed a
highly turbid clot as compared with intact normal fibrinogen. These
results were in agreement with those of Langer et al.11 On
the other hand, DG-Niigata fibrinogen had a markedly prolonged thrombin time (18.4 seconds to 113 seconds) as compared with intact Niigata fibrinogen. Furthermore, DG-Niigata fibrinogen initially formed a
transparent fibrin clot, but its turbidity increased rather rapidly as
compared with untreated Niigata fibrinogen. The transformation from the
transparent clot to the turbid clot seemed to be accelerated by the
removal of oligosaccharide moieties from Niigata fibrinogen.
View larger version (64K):
[in this window]
[in a new window]
| Fig 6.
Removal of N-linked oligosaccharides from B and chains of fibrinogen. Fibrinogen (10 mg/mL) was incubated with
Glycosidase F (45 U/mL) or without enzymes at 37°C for 24 hours in
TBS and then subjected to SDS-PAGE analysis.
|
|
In aggregation experiments, DG-normal and Niigata fibrin monomers
manifested a much shorter lag-time and a greater amplitude, though the
turbidity of DG-Niigata fibrin monomer did not reach the level of
DG-normal fibrin monomer (Fig 2). In the case of DG-Niigata fibrin
monomer, the aggregation profile seemed to be almost identical with
that of intact normal fibrin monomer.
Compaction and permeation studies.
Normal and Niigata fibrin had similar compactability, although their
deglycosylated counterparts were more easily compacted (Table
4), indicating that DG-fibrin networks have
thicker fibers and larger pore sizes. DG-normal fibrin was considerably
more compactible than DG-Niigata fibrin (P = .005), a finding
that is consistent with the appearance of SEM images (see the
following).
Results of permeation studies were less satisfactory, especially with
respect to DG-fibrin values. The permeation values for normal and
Niigata fibrin were in the same range and did not differ significantly
from each other (P = .22). However, DG-fibrin, either normal
or Niigata, tended to separate from the walls of the permeation tube.
Permeation constants for those clots that did adhere adequately were
considerably higher than those for the non-DG fibrin and the values
covered a wide range (10 to 105 ×10 9 cm2,
n = 10). This observation suggested that although there was no gross
evidence for channeling, this was indeed occurring. Thus, apart from
the high permeation constant, which was largely reflective of the high
porosity observed in SEM experiments and detected by compactability, we
did not use these values for quantitative determinations in Table
4.
SEM of Niigata and its DG-fibrin clots.
SEM images of normal fibrin showed a typical matrix composed of thick
elongated branching fibers (Fig 7). After
treatment of normal fibrinogen with glycosidase, the resulting fibrin
fibers were thicker than untreated fibrin fibers, yielding a network with greater porosity than normal fibrin, consistent with compaction and permeation measurements.
The Niigata fibrin matrix was similar to that of normal in that the
fiber widths were about the same, but differed from normal in subtle
ways. Most prominently, Niigata fibers were more curvilinear than those
of normal fibrin. A sense of the porosity of this matrix relative to
normal could not be gained from simply observing the overall network
structure. After glycosidase treatment, the Niigata fibers became
straighter and the general appearance was similar to those of untreated
normal fibrin. There was a general sense that the porosity of
this network was greater than those of normal or untreated
Niigata fibrin, and this impression was confirmed by permeation and
compaction experiments.
Examination of a rotary-shadowed preparation of fibrinogen Niigata
showed trinodular molecules that did not differ in any recognizable way
from normal fibrinogen molecules (data not shown).
| |
DISCUSSION |
Abnormal fibrinogens with extra oligosaccharides are occasionally
endowed with strong negative electric charges. Thus, when they are
converted to fibrin, extra repulsive forces may arise and affect
lateral association of normally constructed fibrin protofibrils and
fiber packing. In fact, such phenomena have been observed in
fibrinogens Lima, Caracas II, and Kaiserslautern, and as anticipated,
desialylation alone was able to normalize the prolonged thrombin times
and altered fibrin polymerization profiles in these
molecules.3,4,10 On the other hand, desialylation alone was
unable to normalize these functional abnormalities as we have observed
in fibrinogen Niigata, and also fibrinogen Asahi with an extra
oligosaccharide at Asn-308 (data not shown). These data indicate
that some other factors such as the steric constraints by the backbone
of neutral sugars or the amino acid substitution itself may profoundly
affect the process of fibrin assembly in fibrinogens Niigata and Asahi.
The location of extra oligosaccharides in some abnormal fibrinogens
suggests possible explanations of their effect on fibrin polymerization. In fibrinogen Caracas II, a highly negatively charged
oligosaccharide is located at A Asn-434 in the C
domain3 that modulates lateral association of fibrin
protofibrils,24,25 and indeed, untethered C domains of
fibrinogen molecules and loosely packed thin fibrin fibers were
observed by electron microscopy.12 A recent crystal
structure of the cross-linked fibrin D-dimer26 indicates
that the position of -Asn-308 is not directly involved in the D:D
interface but is close to the interface. Thus, the carbohydrate
backbone attached at -Asn-308 in fibrinogen Asahi may have a high
freedom of rotation and may be long enough to interfere with the E-D
binding, D:D association,26,27 and factor XIIIa-catalyzed
cross-linking of the -chain in concert with steric hindrance.9 On the basis of crystal structure of fragment
D, the B-158 residue is located in the middle of the coiled-coil region, a region interposed between the E and D domains.
It is well known that the ultrastructure of fibrin clots is highly
dependent on ionic strength, pH, divalent metal ions, and negatively
charged substances, and some plasma proteins, such as albumin, were
reported to influence the structure of fibrin network.28-34
The role of the carbohydrate as a regulating factor in the process of
fibrin assembly was first shown by Langer et al11 in the
experiments using deglycosylated normal fibrinogen, where the
DG-fibrinogen manifested shortened thrombin clotting with accelerated
polymerization and formation of highly turbid clots made of thick and
less-branched straight fibers. These findings were confirmed in
DG-normal fibrinogen, but not in DG-Niigata fibrinogen (Table 3 and Fig
2). The enzymatic removal of N-linked oligosaccharides inevitably
changes the Asn residue to an Asp residue by hydrolyzing the
-aspartylglucosamine bond, and results in the introduction of a
negative charge in the variant B-chain, as observed by increased
mobility of DG-Niigata B'-chain on SDS-PAGE (Fig 6). This additional
negative charge of DG-Niigata fibrinogen was probably responsible for
the difference in network structure, especially in fiber width, length,
and the number of branch points of the 2 DG-fibrins (Fig 7). In SEM
images, the DG-normal fibrin network was more porous, and was composed
of thick and straight fibers, whereas the DG-Niigata fibrin network
fibers were similar to the non-DG normal fibrin network. On the
contrary, the differences between the 2 untreated fibrins seem to be
minor, although the network of Niigata fibrin was made of more
curvilinear fibers.
The change from a curvilinear fiber network to a straighter fiber
network observed in the DG-Niigata fibrin suggested the restoration of
the fibrin structures to that of normal, although the widths of Niigata
fibrin fibers were generally not as wide as the DG-normal fibrin. The
normal and DG-Niigata fibrins have different biophysical properties
from their non-DG counterparts, as evidenced by permeability and
compaction experiments (Table 4). Compaction, the collapsibility of the
network under constant centrifugal forces, is dependent on the
characteristics of the clot structure, ie, fiber thickness and branch
point density in the network. It has been shown that when the number of
branch points is reduced, fibrin fibers become thick and compaction
increases proportionately. Because compaction and permeability
correlate significantly to the overall network structure observed by
electron microscopy, we speculate on Niigata fibrin as follows: (1) on incubation with thrombin, Niigata fibrinogen forms a fibrin network in
which the fibers are curvilinear and more branched but their lengths
and widths are similar to those of normal fibrin. This type of network
retains similar network strength and permeation to that of normal
fibrin. This is consistent with the observation that the patient and
her son are asymptomatic. (2) DG-fibrinogen Niigata forms a fibrin
network similar to non-DG-normal fibrin in appearance but its
structure and biophysical characteristics may be intermediate between
that of the non-DG-normal and DG-normal fibrin. This type of network
has higher permeation and lower stiffness than that of untreated normal
fibrin, suggesting that DG-Niigata fibrin aggregated obviously with a
much slower rate than the non-DG-normal and Niigata fibrins. This
retardation or perturbation of fiber aggregation of the DG-Niigata
fibrin may partly be attributed to the negative charge of a newly
formed Asp residue at position B-158.
Taken together, we conclude that the extra oligosaccharide introduced
into the middle of coiled-coil region of fibrinogen Niigata may perturb
the lateral association of protofibrils and fiber aggregation by the
steric constraint of the carbohydrate backbone and also by its terminal
negative charges. However, their effect would not disrupt the
interactions of major polymerization domains so that the fibrin Niigata
retained normal stiffness and permeability.
| |
ACKNOWLEDGMENT |
We thank Michiko Takano for her expert secretarial assistance.
| |
FOOTNOTES |
Submitted January 18, 1999; accepted July 16, 1999.
Supported in part by Scientific Research Grants-in-Aid for Scientific
Research 08407034 and 11470250, and for International Scientific
Research Program, Joint Research Grants 09044329, 10044316, and
11694308 from the Ministry of Education, Science and Culture of the
Government of Japan and the American Heart Association, Wisconsin
Affiliate, Grants-In-Aid 97-GB-88 and 97-GC-60.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Teruko Sugo, PhD, Division of Hemostasis
and Thrombosis Research, Institute of Hematology, Jichi Medical School,
Yakushiji 3311-1, Tochigi, 329-0498, Japan.
| |
REFERENCES |
1.
Mizuochi T, Taniguchi T, Asami Y, Tamakatsu J, Okuda M, Iwanaga S, Kobata A:
Comparative studies on the structure of the carbohydrate moieties of human fibrinogen and abnormal fibrinogen Nagoya.
J Biochem (Tokyo)
92:283, 1982[Abstract/Free Full Text]
2.
Townsend RR, Hilliker E, Li YT, Laine RA, Bell WR, Lee YC:
Carbohydrate structure of human fibrinogen.
J Biol Chem
257:9704, 1982[Abstract/Free Full Text]
3.
Maekawa H, Yamazumi K, Muramatsu S, Kaneko M, Hirata H, Takahashi N, Bosch NB, Carvajal Z, Ojeda A, Arocha-Piñango CL, Matsuda M:
An A Ser-434 to N-glycosylated Asn substitution in a dysfibrinogen, fibrinogen Caracas II, characterized by impaired fibrin gel formation.
J Biol Chem
266:11575, 1991[Abstract/Free Full Text]
4.
Maekawa H, Yamazumi K, Muramatsu S, Kaneko M, Hirata H, Takahashi N, Arocha-Piñango CL, Rodriguez S, Nagy H, Perez-Requejo JL, Matsuda M:
Fibrinogen Lima: A homozygous dysfibrinogen with an A-arginine-141 to serine substitution associated with extra N-glycosylation at A-asparagine-139.
J Clin Invest
90:67, 1992
5.
Watt KW, Takagi T, Doolittle RF:
Amino acid sequence of the beta chain of fibrinogen.
Biochemistry
18:68, 1979[Medline]
[Order article via Infotrieve]
6.
Iwanaga S, Blombäck B, Gröndahl NJ, Hessel B, Wallén P:
Amino acid sequence of the N-terminal part of gamma-chain in human fibrinogen.
Biochim Biophys Acta
160:280, 1968[Medline]
[Order article via Infotrieve]
7.
Henschen AH, Lottspeich F, Kehl M, Southan C:
Covalent structure of fibrinogen.
Ann NY Acad Sci
408:28, 1983[Medline]
[Order article via Infotrieve]
8.
Kaudewitz H, Henschen A, Soria J, Soria C:
Fibrinogen Pontoise A genetically abnormal fibrinogen with defective fibrin polymerisation but normal fibrinopeptide release, in
Lane DA,
Henschen A,
Jasani HK
(eds):
Fibrinogen, Fibrin Formation and Fibrinolysis. Berlin, Walter de Gruyter, 1986, p 91
9.
Yamazumi K, Shimura K, Terukina S, Takahashi N, Matsuda M:
A methionine-310 to threonine substitution and consequent N-glycosylation at asparagine-308 identified in a congenital dysfibrinogenemia associated with posttraumatic bleeding, fibrinogen Asahi.
J Clin Invest
83:1590, 1989
10.
Brennan SO, Loreth RM, George PM:
Oligosaccharide configuration of fibrinogen Kaiserslautern: Electrospray ionisation analysis of intact -chains.
Thromb Haemost
80:263, 1998[Medline]
[Order article via Infotrieve]
11.
Langer BG, Weisel JW, Dinauer PA, Nagaswami C, Bell WR:
Deglycosylation of fibrinogen accelerates polymerization and increased lateral aggregation of fibrin fibers.
J Biol Chem
263:15056, 1988[Abstract/Free Full Text]
12.
Woodhead JL, Nagaswami C, Matsuda M, Arocha-Piñango CL, Weisel JW:
The ultrastructure of fibrinogen Caracas II molecules, fibers, and clots.
J Biol Chem
271:4946, 1996[Abstract/Free Full Text]
13.
Matsuda M, Baba M, Morimoto K, Nakamikawa C:
"Fibrinogen Tokyo II": An abnormal fibrinogen with an impaired polymerization site on the aligned DD domain of fibrin molecules.
J Clin Invest
72:1034, 1983
14.
Tanabe S, Sugo T, Matsuda M:
Synthesis of protein C in human umbilical vein endothelial cells.
J Biochem (Tokyo)
109:924, 1991[Abstract/Free Full Text]
15.
Sugo T, Nakamikawa C, Takebe M, Kohno I, Egbring R, Matsuda M:
Factor XIIIa-cross-linking of the Marburg fibrin: Formation of m · n-heteromultimers and the -chain-linked albumin · complex, and disturbed protofibril assembly resulting in acquisition of plasmin-resistance relevant to thrombophila.
Blood
91:3282, 1998[Abstract/Free Full Text]
16.
Takahashi N, Nakagawa H, Fujikawa K, Kawamura Y, Tomiya N:
Three-dimensional elution mapping of pyridylaminated N-linked neutral and sialyl oligosaccharides.
Anal Biochem
226:139, 1995[Medline]
[Order article via Infotrieve]
17.
Gyllensten UB, Erlich HA:
Generation of single-stranded DNA by the polymerase chain reaction and its application to direct sequencing the HLA-DQA locus.
Proc Natl Acad Sci USA
85:7652, 1988[Abstract/Free Full Text]
18.
Nair CH, Dhall DP:
Studies on fibrin network structure in human plasma. Part I: Method for clinical application.
Thromb Res
64:455, 1991[Medline]
[Order article via Infotrieve]
19.
van Gelder JM:
The permeability of the human fibrin network. Doctoral thesis from the University of Melbourne, Australia, 1996
20.
de Jong WW, Zweera A, Cohen LH:
Influence of single amino acid substitutions on electrophoretic mobility on sodium dodecyl sulfate-protein complexes.
Biochim Biophys Res Commun
82:532, 1979
21.
Noel D, Nikaido K, Ames FL:
A single amino acid substitution in a histidine-transport protein drastically alters its mobility in sodium dodecyl sulfate-polyacrylamide gel electrophoresis.
Biochemistry
18:4159, 1979[Medline]
[Order article via Infotrieve]
22.
Terukina S, Matsuda M, Hirata H, Takeda Y, Miyata T, Takao T, Shimonishi Y:
Substitution of Arg-275 by Cys in an abnormal fibrinogen, "fibrinogen Osaka II": Evidence for a unique solitary cystine structure at the mutation site.
J Biol Chem
263:13579, 1988[Abstract/Free Full Text]
23.
Yoshida N, Okuma M, Moroi M, Matsuda M:
A lower molecular weight chain variant in a congenital abnormal fibrinogen (Kyoto).
Blood
68:703, 1986[Abstract/Free Full Text]
24.
Veklich Y, Gorkun OV, Medvéd LV, Niewenhuizen W, Weisel JW:
Carboxy-terminal portions of the chains of fibrinogen and fibrin.
J Biol Chem
268:13577, 1993[Abstract/Free Full Text]
25.
Gorkun OV, Veklich YI, Medvéd LV, Henschen AH, Weisel JW:
Role of the C domain of fibrin in clot formation.
Biochemistry
33:6986, 1994[Medline]
[Order article via Infotrieve]
26.
Spraggon G, Everse SJ, Doolittle RF:
Crystal structures of fragment D from human fibrinogen and its crosslinked counterpart from fibrin.
Nature
389:455, 1997[Medline]
[Order article via Infotrieve]
27.
Mosesson MW, Siebenlist KR, DiOrio JP, Matsuda M, Hainfeld JF, Wall JS:
The role of fibrinogen D domain intermolecular association sites in the polymerization of fibrin and fibrinogen Tokyo II (275 Arg  Cys).
J Clin Invest
96:1053, 1995
28.
Blombäck B, Carlsson K, Hessel B, Liljeborg A, Procyk R, Åslund N:
Native fibrin gel networks observed by 3D microscopy, permeation and turbidity.
Biochim Biophys Acta
997:96, 1989[Medline]
[Order article via Infotrieve]
29.
Carr ME Jr, Cromartie R, Gabriel DA:
Effect of homo poly (L-amino acids) on fibrin assembly: Role of charge and molecular weight.
Biochemistry
28:1384, 1989[Medline]
[Order article via Infotrieve]
30.
Torbet J:
Fibrin assembly in human plasma and fibrinogen/albumin mixtures.
Biochemistry
25:5309, 1986[Medline]
[Order article via Infotrieve]
31.
Marx G:
Divalent cations induce protofibril gelation.
Am J Hematol
27:104, 1988[Medline]
[Order article via Infotrieve]
32.
Galanakis DK, Lane BP, Simon SR:
Albumin modulates lateral assembly of fibrin polymers: Evidence of enhanced fine fibril formation and of unique synergism with fibrinogen.
Biochemistry
26:2389, 1987[Medline]
[Order article via Infotrieve]
33.
Collet JP, Woodhead JL, Soria J, Soria C, Mirshahi M, Caen JP, Weisel JW:
Fibrinogen Dusart: Electron microscopy of molecules, fibers and clots, and viscoelastic properties of clots.
Biophys J
70:500, 1996[Medline]
[Order article via Infotrieve]
34.
Mosesson MW, Siebenlist KR, Hainfeld J, Wall JS, Soria J, Soria C, Caen JP:
The relationship between the fibrinogen D domain self-association/cross-linking site (XL) and the fibrinogen Dusart abnormality (A R554C-albumin).
J Clin Invest
97:2342, 1996[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
A. A. Amelot, M. Tagzirt, G. Ducouret, R. L. Kuen, and B. F. Le Bonniec
Platelet Factor 4 (CXCL4) Seals Blood Clots by Altering the Structure of Fibrin
J. Biol. Chem.,
January 5, 2007;
282(1):
710 - 720.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Hamano, J. Mimuro, M. Aoshima, T. Itoh, N. Kitamura, S. Nishinarita, K. Takano, A. Ishiwata, Y. Kashiwakura, K. Niwa, et al.
Thrombophilic dysfibrinogen Tokyo V with the amino acid substitution of {gamma} Ala327Thr: formation of fragile but fibrinolysis-resistant fibrin clots and its relevance to arterial thromboembolism
Blood,
April 15, 2004;
103(8):
3045 - 3050.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. C. Lounes, J. B. Lefkowitz, A. H. Henschen-Edman, A. I. Coates, R. R. Hantgan, and S. T. Lord
The impaired polymerization of fibrinogen Longmont (B{beta}166Arg{right-arrow}Cys) is not improved by removal of disulfide-linked dimers from a mixture of dimers and cysteine-linked monomers
Blood,
August 1, 2001;
98(3):
661 - 666.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Sugo, C. Nakamikawa, N. Yoshida, K. Niwa, M. Sameshima, J. Mimuro, J. W. Weisel, A. Nagita, and M. Matsuda
End-linked homodimers in fibrinogen Osaka VI with a Bbeta -chain extension lead to fragile clot structure
Blood,
December 1, 2000;
96(12):
3779 - 3785.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION
