|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 12 (December 15), 1999:
pp. 4220-4232
Variant Genotypes of the Low-Affinity Fc Receptors in Two Control
Populations and a Review of Low-Affinity Fc Receptor Polymorphisms
in Control and Disease Populations
By
Thomas Lehrnbecher,
Charles B. Foster,
Shaoxian Zhu,
Susan F. Leitman,
Lynn R. Goldin,
Konrad Huppi, and
Stephen J. Chanock
From the Immunocompromised Host Section, Pediatric Oncology Branch,
the Genetic Epidemiology Branch, Division of Cancer Epidemiology and
Genetics, and the Laboratory of Genetics, National Cancer Institute,
and the Department of Transfusion Medicine, Clinical Center, National
Institutes of Health, Bethesda, MD.
 |
ABSTRACT |
Fc -receptors (Fc R) provide a critical link between humoral and
cellular immunity. The genes of the low-affinity receptors for IgG and
their isoforms, namely, Fc RIIa, Fc RIIb, Fc RIIIa, Fc RIIIb,
and SH-Fc RIIIb, are located in close proximity on chromosome 1q22.
Variant alleles may differ in biologic activity and a number of studies
have reported the frequencies of variant Fc R alleles in both disease
and control populations. No large study has evaluated the possibility
of a nonrandom distribution of variant genotypes. We analyzed 395 normal individuals (172 African Americans [AA] and 223 Caucasians
[CA]) at the following loci: Fc RIIa, Fc RIIIa, and Fc RIIIb,
including the SH-Fc RIIIb. The genotypic distributions of Fc RIIa,
Fc RIIIa, and Fc RIIIb conform to the Hardy-Weinberg law in each
group. There was no strong evidence that combinations of 2-locus
genotypes of the 3 loci deviated from random distributions in these
healthy control populations. The distribution of SH-Fc RIIIb is
underrepresented in CA compared with AA (P < .0001) controls. A previously reported variant Fc RIIb was not detected in 70 normal individuals, indicating that this allele, if it exists, is very rare
(<1%). In conclusion, we present data that should serve as the
foundation for the interpretation of association studies involving multiple variant alleles of the low-affinity Fc R.
© 1999 by The American Society of Hematology.
 |
INTRODUCTION |
RECEPTORS FOR THE Fc domain of IgG
(Fc R) are mainly expressed on cells of hematopoietic lineage and
provide a critical link between humoral and cellular
immunity.1,2 These receptors mediate a variety of
biological responses, including antibody-dependent cellular
cytotoxicity, endocytosis, phagocytosis, release of inflammatory mediators, and augmentation of antigen presentation.1,3
Fc R are divided into 3 classes: Fc RI (CD64), Fc RII (CD32), and
Fc RIII (CD16). Within each class, isoforms have been identified that vary in molecular weight, in binding affinity to different subclasses of human IgG, and in distribution on the surface of hematopoietic cells. A further level of complexity is introduced by the presence of
variant alleles in the low-affinity receptors: Fc RIIa, IIb, IIIa,
and IIIb. In some cases, variant forms of the low-affinity receptors
have been reported to have biologic differences in in vitro assays. A
burgeoning number of association studies, correlating clinical outcomes
with variant alleles, underscores the potential importance of these
variant alleles in vivo. Accordingly, it is critical to determine the
distribution of variant genotypes individually and in combination in a
large control population to interpret association studies that seek to
evaluate multiple Fc R genotypes in combination.
The structural heterogeneity and complex nature of the isoforms and
their variant alleles reflect the functional diversity mediated by
these receptors. The low-affinity receptors (Fc RIIa, IIb, IIIa, and
IIIb) colocalize with other genes of hematopoietic and immunologic
interest to a region in chromosome 1q22 that includes the receptor for
interleukin-6, C-reactive protein, the selectin cluster, and the Duffy
blood group.4-8 It is estimated that the maximum distance
between any of the 2 low-affinity Fc R genes (Fc RIIa, IIb, IIIa
and IIIb) is approximately 200 kb.4,9 The location of a
recently described variant, SH-Fc RIIIb, which has been identified in
individuals in whom a polymerase chain reaction (PCR) fragment can be
amplified with NA2-specific primers derived from Fc RIIIb, is not
known at this time.10,11
Preliminary results of the human genome project suggest that
polymorphisms occur approximately once every 800 to 1,200 bp.12 In regions sharing a high degree of homology, such as
the Fc R, crossing over may be favored, and one might expect to see a
greater frequency of recombination events and, perhaps,
polymorphisms.13 However, only a handful of biologically or
clinically significant variant alleles of the low-affinity Fc R,
Fc RIIa, IIb, IIIa, and IIIb have been identified.
It has been reported that some variant alleles of the low-affinity
Fc R are of functional or clinical importance. For example, Fc RIIa
has 2 codominantly expressed alleles that differ at 1 amino acid, R131
and H131.14 These were initially identified on the basis of
a functional polymorphism related to murine IgG1 binding and were
designated as low responder (LR) and high responder (HR),
respectively.15,16 Several groups have shown a decreased ability of the R131 allele to bind human IgG2.14,17-20 Both
Fc RIIIa, which is expressed on NK cells and phagocytic cells, and
Fc RIIIb, which is expressed on neutrophils, display codominant
biallelic variants.21-24 The 158F allele of Fc RIIIa has
been shown to bind IgG1, IgG3, and IgG4 less avidly.23,24
We limited our analysis of the Fc RIIIa gene to the V and F alleles
at amino acid 158 and did not analyze the tri-allelic polymorphism, 48 L/H/R, which is probably linked to 158 V/F and also appears not to
confer a significant biologic difference.23,25 The 2 allotypes of Fc RIIIb, assigned as neutrophil antigen (NA) 1 and 2, differ in at least 5 nucleotides, resulting in changes of 4 amino acids
in the membrane-distant Ig-like domain.21,22 In comparison
to the neutrophils obtained from NA1 homozygous donors, neutrophils
from NA2 homozygous individuals bind human IgG3 less effectively and
were consistently found to exhibit lower levels of phagocytosis of
erythrocytes sensitized with IgG1 and IgG3 anti-Rhesus D monoclonal
antibody.26-28 Furthermore, phagocytosis of IgG1-opsonized
bacteria by Fc RIIIb-NA2 neutrophils was also reduced in comparison
to Fc RIIIb-NA1 neutrophils, whereas no difference was found using
IgG2-opsonized bacteria.28 A single nucleotide change at
nucleotide 885 in Fc RIIb1 (T G) has been reported at the
cDNA level only.29 The proposed change of 1 amino acid
appears to alter receptor internalization and capping in in vitro
studies.29,30 In addition, we investigated the distribution
of the recently described SH-Fc RIIIb, which differs from the
wild-type NA-2 allele by at least 1 single nucleotide, although a
biologic difference has not been established.10,11
The purpose of our study was to determine the frequency of selected
variant alleles of the low-affinity Fc R genes in a large, healthy
control population. To this end, we genotyped 395 normal healthy
individuals (172 African Americans [AA] and 223 Caucasians [CA])
and determined the distribution and frequency of biologically important
variant alleles of Fc RIIa, IIb, IIIa, and IIIb, including SH-Fc RIIIb. We have sought to identify whether there is nonrandom distribution of combinations of variant genotypes in these 2 populations. Understanding the distribution of multiple Fc R variant
genotypes in control populations furnishes a critical foundation upon
which to interpret future association studies. Our study provides a basis upon which the independent segregation of individual Fc R genes
within a population may be estimated. Understanding the extent of the
interaction between multiple Fc R genotypes could lead to further
insight into the contribution of this complex family of genes to
various pathologic conditions.31-33
 |
MATERIALS AND METHODS |
Subjects
Genomic DNA was isolated from peripheral blood using either a
phenol-chloroform extraction method (5 Prime-3 Prime, Inc, Boulder, CO)
or Puregene DNA isolation kit (Gentra Systems, Minneapolis, MN). Blood
samples from 395 normal healthy individuals, consisting of 172 AA and
223 CA, were available for genomic DNA extraction under an
Institutional Review Board-approved protocol for anonymous genomic DNA
collection under the supervision of the Department of Transfusion
Medicine, Clinical Center, National Institutes of Health (Bethesda,
MD). Only the race and sex were recorded and linked to an anonymous
identifier during collection of samples.
Determination of the Polymorphic Forms of the Low-Affinity
Fc R
Genomic DNA was amplified according to conditions specific for each
Fc R. Genotype analysis was completed before statistical analysis.
All assays were performed at least twice.
Fc RIIa.
The previously reported polymorphism in the coding region of Fc RIIa
was determined by allele-specific restriction digest according to
methods described by Jiang et al.34 A mutant
oligonucleotide-directed restriction site was created in the 5'
end of the amplicon using the following sense primer:
GGAAAATCCCAGAAATTCTCGC. The less frequent, variant allele, R, contains
a BstUI restriction digest site (an introduced G compared with
the wild-type A). The antisense primer, CAACAGCCTGACTACCTATTACGCGGG,
corresponding to a sequence in the next intron, assures gene specific
amplification and introduces a second BstUI restriction site
that serves as an internal control for restriction digestion. PCR
amplification was performed in a 50 µL reaction with 50 ng genomic
DNA, 100 ng of each primer, 200 µmol/L each dNTP, 0.5 U Taq DNA
polymerase (Boehringer Mannheim, Mannheim, Germany), and the
manufacturer's buffer. A denaturation step of 95°C for 5 minutes
was followed by 30 cycles of 94°C for 15 seconds, 55°C for 30 seconds, and 72°C for 40 seconds. After BstUI digestion,
samples were analyzed on a 3% agarose gel.
Fc RIIb.
Direct sequence analysis was performed on amplicons amplified using the
following sense and antisense primers, TCCCATCCAACCCTGGA and
GGCAGATTCCTCAGCAAATCA, respectively. Fifty-microliter reactions containing 50 ng genomic DNA, 150 ng of each primer, 200 µmol/L dNTP,
and 0.5 U Taq polymerase were amplified under the following conditions:
initial denaturation at 95°C for 5 minutes, followed by 30 cycles
of 95°C for 30 seconds, 56°C for 30 seconds, and 72°C for
60 seconds. The primers used for amplification were used for sequencing
with the Thermo Sequenase radiolabeled terminator cycle sequencing kit
(Amersham Life Sciences, Inc, Cleveland, OH) at 35 cycles and an
annealing temperature of 55°C.
Fc RIIIa.
The 158V/F-Fc RIIIa polymorphism was discriminated by an
allele-specific oligohybridization of a nested PCR amplification of
genomic DNA. A gene-specific, 1.2-kb fragment was amplified using the
following sense and antisense primers, ATATTTACAGAATGGCACAGG and
GACTTGGTACCCAGGTTGAA, respectively, in a 25 µL reaction with 20 ng of
genomic DNA, 75 ng of each primer, 200 µmol/L dNTP, and 0.25 U Taq
polymerase. PCR conditions were as follows: 5 minutes of initiation
denaturation at 95°C, followed by 35 cycles at 95°C for 1 minute, 56°C for 1 minute, and 72°C for 1 minute. One
microliter of this reaction was transferred to a separate microfuge
tube for nested PCR in a total volume of 50 µL that included 150 ng of sense and antisense primers, TCATCATAATTCTGACTTCT and
CTTGAGTGATGGTGATGTTC, 200 µmol/L dNTP, and 0.5 U Taq polymerase. PCR
conditions for the second amplification consisted of 30 cycles of
95°C for 1 minute, 62°C for 1 minute, and 72°C for 1 minute. Ten microliters of the final PCR reaction was transferred to a
nylon filter in duplicate (Hybond N+; Amersham). Each filter was
hybridized with a [ -32P]-ATP-labeled oligonucleotide probe
corresponding to the F or V allele, GCAGGGGGCTTTTTGGGAGTAAA
or GCAGGGGGCTTGTTGGGAGTAAA. The blots were washed in 6×
SSPE with 1% sodium dodecyl sulfate (SDS) at room temperature,
42°C, and twice for 10 minutes each time at 70.5°C for the
probe containing the T allele and at 72.5°C for the G allele.
Autoradiography was performed and analyzed between 8 and 24 hours later.
Fc RIIIb.
Polymorphic forms of Fc RIIIb were determined by gene- and
allele-specific PCR with the following primer pairs, NA1-sense, CTCAATGGTACAGGGTGCTC and NA1-antisense, GGCCTGGCTTGAGATGAGGT or NA2-sense, CTCAATGGTACAGCGTGCTT and NA2-antisense,
CACCTGTACTCTCCACTGTCGTT, using a modified protocol according to Hessner
et al.35 Control amplification of a 383-bp segment of the
C-myc gene was included in each tube with the following primer pair,
ACGCCCCTCAACGTTAGCTT and CGCAGATGAAACTCTGGTTCACCAT. Fifty nanograms of
genomic DNA was amplified in 50 µL reaction containing 200 µmol/L
dNTP, 10 ng of each Myc-primer, 0.5 U Taq polymerase, and either primer pair for NA1 or NA2. The PCR conditions were as follows: 30 cycles of
94°C for 1 minute, 67°C for 1 minute, and 72°C for 1 minute. PCR products were visualized on a 3% agarose gel.
SH-Fc RIIIb.
The reported sequence variation observed in individuals in whom an
amplicon can be amplified with NA2-specific primers, SH-Fc RIIIb, was
determined by allele-specific digest of a PCR amplicon with SfaNI as described by Bux et al.10 Using the
allele-specific primer pair for Fc RIIIb-NA2 under conditions
detailed above, digestion with the restriction endonuclease
SfaNI was performed for 3 hours and the products were
visualized on a 3% agarose gel.
Literature Search
Citations including information on variant alleles of the Fc R and
associated clinical studies were identified by performing searches
using PubMed extending back to 1980 (National Center for Biotechnology
and Information, National Library of Medicine, National Institutes of
Health). Keywords included polymorphism, allele, Fc receptor,
Fc Receptor, and clinical association. Additional references were
identified from bibliographies of identified references.
Statistical Analysis
Allele frequencies were computed from the observed data and deviations
of observed genotypic distributions from expected distributions based
on the Hardy-Weinberg law were tested using a 2 test
statistic with 1 degree of freedom. For comparison of 2-locus genotypic
distributions from random expectations, a 2 test with 4 degrees of freedom was performed on each 3 × 3 table of
genotypes. In this exploratory analysis, P values were
corrected by a factor of 3, which correlates with the number of loci
examined. For any 2-locus test with a P value less than .05, we
looked at specific combinations of genotypes by making 3 × 2 tables and computing a 2 test with 2 degrees of freedom.
Similarly, these P values were corrected by a factor of 3 on
the premise that the analysis looked at 3 different genotypes.
Statistical analysis was performed using the Macintosh 2.0 version of
InStatR (GraphPad Software, San Diego, CA).
 |
RESULTS |
A total of 395 individuals (172 AA and 223 CA) were genotyped for at
least 1 low-affinity receptor, Fc RIIa, Fc RIIIa, or Fc RIIIb
(Table 1). For each of the Fc R examined,
the genotypic distributions in both populations analyzed conform to the
Hardy-Weinberg equilibrium (Table 2). In 5 individuals (1.3%), no Fc RIIIb gene was detectable, in accordance
with previously reported data indicating that less than 1% of the
population lacks the Fc RIIIb phenotype or that additional
polymorphisms interfere with allele-specific amplification.36 The allelic frequencies of Fc RIIa, and
Fc RIIIb did not differ between AA and CA, but in the Fc RIIIa,
there was a marginal difference between the 2 groups for the
heterozygotes 158V/F (P = .048).
View this table:
[in this window]
[in a new window]
|
Table 2.
Single Locus Test for Hardy-Weinberg Equilibrium of
Low-Affinity Fc Receptors: Fc RIIa, Fc RIIIa, and Fc RIIIb
|
|
To further investigate the possibility of a nonrandom distribution of
genotypes in a healthy population, we concentrated our analysis on 330 individuals (150 AA and 180 CA) who were successfully typed at the 3 loci for Fc RIIa, Fc RIIIa, and Fc RIIIb. The distribution of
allelic variations in this subgroup did not differ significantly from
the distribution observed in the total group (data not shown). There
was no strong evidence for nonrandom distribution of combinations of
variant genotypes in either population
(Table 3). It should be noted that, in the
CA population, there is a marginally significant P value for
the combination of Fc RIIIa and Fc IIIb (P = .046), suggesting an overrepresentation of 1 or more combinations of variant
genotypes. When we analyzed this group individually, the only notable
finding was for the combination of the 158F/F genotype of Fc RIIIa
and the Fc RIIIb alleles (P = .016 corrected for multiple comparisons; n = 3). The other genotypes, V/F and V/V of 158, did not
demonstrate a skewed distribution of combinations of the variant
genotypes of the 2 loci.
Of the 330 individuals genotyped for both Fc RIIIb and SH-Fc RIIIb,
the variant sequence of SH-Fc RIIIb was observed exclusively in
individuals in whom a PCR fragment could be amplified with NA2-specific
primers (Table 4). Accordingly, no
individuals homozygous for NA1 had evidence of the sequence of
SH-Fc RIIIb. The A sequence, which denotes SH-Fc RIIIb, was
significantly underrepresented in CA compared with AA (P < .0001; Table 4).37 We further analyzed the distribution of
the SH-Fc RIIIb genotype in individuals in whom a PCR product could
be amplified with NA2 specific primers (Table 5). In the AA population, which has
a higher frequency of detecting the variant SH-Fc RIIIb sequence,
there was no difference in the distribution between those individuals
with only NA2 primer-generated products (ie, no NA1 product was seen
separately) and those individuals who also had an NA1 allele. These
results suggest that SH-Fc RIIIb in AA appears to be randomly
distributed between the 2 genotypes that contain fragments generated
with NA2-specific primers (ie, with and without the presence of NA1).
For those individuals in whom an amplicon was amplified with NA2
primers and complete SfaN1 digestion was observed, it is
assumed that only the SH-Fc RIIIb sequence is present. From our
typing assays, it is not possible to conclude whether 1 or 2 copies of
the SH-Fc RIIIb sequence are present; an Fc RIIIb null gene could
be present. Furthermore, our results indicate that, in some
individuals, there might be duplication or redundancy of the Fc RIIIb
gene, because SH-Fc RIIIb (as indicated by heterozygosity with
respect to SfaN1 digestion) is detected in individuals with the
NA1 allele and a fragment amplified with the NA2-specific primers
(Table 5). Of the 43 AA who were positive for SH-Fc RIIIb, in 29, incomplete Sfa1 digestion was observed (67% of SH-Fc RIIIb
and 24% of the total population), indicating either duplication or
redundancy of the Fc RIIIb gene, whereas in 14 AA individuals (33%
of SH-Fc RIIIb positive and 11% overall), only the SH-Fc RIIIb
sequence was detected. In only 1 of 8 CA patients who were positive for
SH-Fc RIIIb, complete SfaN1 digestion was observed.
View this table:
[in this window]
[in a new window]
|
Table 4.
Genotype Distribution of SH-Fc RIIIb in
Individuals in Whom a PCR Fragment Could Be Amplified With
NA2-Specific Primers
|
|
View this table:
[in this window]
[in a new window]
|
Table 5.
Distribution of Variant Genotypes of SH-Fc RIIIb in
Individuals, as Determined by SfaN1 Digestion of PCR Fragments
Amplified With NA2-Specific Primers
|
|
A variant cDNA has been isolated corresponding to a possible
polymorphism in Fc RIIb that alters its biologic
function.29,30 We directly sequenced 140 separate
chromosomes from 52 CA and 18 AA individuals and in each case
identified T at bp 885 and no G. We conclude that this proposed variant
of Fc RIIb is very rare, if it exists.
A comparison of our results with those of published studies, identified
using PubMed, which generally report on only 1 Fc R variant allele,
is shown in a meta-analysis in
Table 6. The largest collection of studies has been reported for the H/R genotypes of Fc RIIa. In total, 2,419 CA have been genotyped and reported in 23 studies including 24 separate populations.32,38-57,61,66 An
analysis of the distribution of variant genotypes of Fc RIIa was
performed between individual study populations and the remaining published population as well as against the population reported here.
In 3 of the 23 studies, there was a difference detected by 3 × 2 2 analysis.32,38,39 Interestingly, these
included the 2 largest studies and 1 of the smallest studies.
Comparison of our study results to the total in Table 6 did not show a
significant difference overall (P = .14; 2 = 3.99) or by genotype (data not shown). Similarly, there was no
difference between the reported populations of AA at the Fc RIIa locus or between our population and the total of the 3 studies.38,54,58 However, there is an appreciable
difference in the distribution of variant Fc RIIa genotypes in
populations from the Far East.31,38,56,60
In comparison to the published literature on Fc RIIa variant
genotypes, there are few studies with small sample sizes reporting the
frequency of variant genotypes of Fc RIIIa and Fc RIIIb in CA and
Fc RIIIb in AA.23,24,32,35,61,62 Comparison of our results for Fc RIIIa in CA to those of the published literature indicates a difference for the FF genotype only.23
Similarly, the distribution of the NA1/NA2 and NA2/NA2 genotypes in AA
differed from the one study in the literature.35
Previously, there were no published data available for Fc RIIIa in AA.
In Table 7, we present an
analysis of published studies comparing the distribution of
low-affinity Fc R genotypes in cohorts with a well-defined disease
versus healthy controls. These studies describe the possible
contribution of Fc R variants to development of the underlying
disease listed in the left-hand column (Table 7). We analyzed the data
presented as raw numbers in each report and reported the findings
without correction. The data presented in Table 7 indicate that, in
patients with systemic lupus erythematosus (SLE), the association with
Fc RIIa variant genotypes varied in different populations. For
example, in AA, 2 of 3 studies demonstrated an association, whereas
none of the studies in CA are compelling.38,58 In the
meta-analysis, the overall effect appears to be stronger for AA
compared with CA (P = .001 v P = .078). On the
other hand, the association between Fc RIIIa variants and SLE has
been well demonstrated in both reported studies (P = .004 and
P = .0072).23,24
View this table:
[in this window]
[in a new window]
|
Table 7.
Published Studies Comparing the Distribution of
Low-Affinity Fc R Genotypes in Disease Versus Normal Control
Populations
|
|
Published studies exploring the association between low-affinity Fc R
genotypes and phenotypic differences within a specific disease
population are presented in Table 8. A
meta-analysis was performed on studies examining SLE and nephritis at
the Fc RIIa locus; the individual studies indicate that the overall
association at this locus is weak, at best. In the absence of
significance at the locus overall, it is difficult to interpret the
marginal association observed between H/H genotype and nephritis in AA with SLE. Table 8 also includes single studies that associate 1 more
Fc R with renal dysfunction in Wegener's granulomatosis, thymoma in
myasthenia gravis, granulomas or auto-immune disease in chronic
granulomatous disease, recurrence of periodontitis, hemolytic anemia in
SLE, and severe meningococcal infection.31-33,40,41,64
View this table:
[in this window]
[in a new window]
|
Table 8.
Published Studies Exploring the Association
Between Low-Affinity Fc R Genotypes and Phenotype Within a Single
Disease Population
|
|
 |
DISCUSSION |
In this study, we analyzed the distribution of variant alleles of
members of the low-affinity Fc R family, including Fc RIIa, Fc RIIb, Fc RIIIa, Fc RIIIb, and SH-Fc RIIIb, in 395 healthy, normal individuals. We present a substantially larger healthy cohort
than previously published studies and specifically examined both single
allelic frequencies and the possibility of nonrandom distribution of
variant genotypes. Our data indicate that there is a marginal
difference in the distribution of genotypes between AA and CA for the
158V/F genotype of Fc RIIIa (P = .048), whereas no difference
was detected for the Fc RIIa and Fc RIIIb genotypes. Notably, our
study represents the largest collection of AA controls analyzed at the
Fc RIIa and Fc RIIIb loci. Furthermore, we report the first data on
allelic distribution of the variant alleles V and F of Fc RIIIa in
the AA population.
Despite the fact that the Fc RIIa, Fc RIIIa, and Fc RIIIb genes
are most likely derived from a common ancestral gene and are clustered
in close proximity on chromosome 1q22, we did not find strong evidence
for nonrandom distribution of variant Fc R genotypes within our
healthy, control population.4 In the course of our analysis, we only found evidence for a tendency towards a skewed distribution of combinations of the 158 F/F genotype of Fc RIIIa with
Fc RIIIB genotypes. The significance of this finding will be borne
out in future studies of comparable healthy control populations. The
tendency towards a skewed distribution was seen only in the CA
population and not in the AA population. Overall, we conclude that, in
our population of healthy controls of AA and CA background, Fc R
genotypes for the low-affinity receptors, Fc RIIa, Fc RIIIa, and
Fc RIIIb, are randomly distributed. Although it has previously been
suggested that linkage disequilibrium exists between the NA1 phenotype
of Fc RIIIb and the high responder of Fc RIIa, this earlier study
relied on phenotype and not genotype data.5 Because the
study did not directly examine the distribution of genotypes or allelic
frequencies of both genes, Fc RIIa and Fc RIIIb, it is difficult to
conclude that linkage disequilibrium exists. However, genotype analysis
of our control population did not confirm an association between the
pairs of loci genotypes previously reported. These results provide a
foundation for future association studies that will look at multiple
genotypes of the low-affinity Fc R.
Recently, a new alloantigen of Fc RIIIb, named SH-Fc RIIIb, has
been characterized; it differs from the Fc RIIIb-NA2 allele by a
single nucleotide change (C for A at position 266) that results in the
substitution of a hydrophobic alanine with an aspartic acid
residue.10,11 The structural and functional implications of
this change are not known. We found that the frequency of the SH
variant differs between AA and CA (P < .0001); only 3.8% of CA were SH-Fc RIIIb positive, whereas 25% of AA were SH-Fc RIIIb positive. These data are in agreement with those of other
reports.10,11,37 Our results confirm other studies showing
that the SH-Fc RIIIb is identified in individuals in whom a fragment
can be amplified with NA2-specific primers.11,37 Because
there is only a single base difference between NA2 and SH-Fc RIIIb,
it could be inferred that the SH-Fc RIIIb is a point-mutated allele
of NA2. However, we have considered it as a separate entity for the
present analysis. Furthermore, the ability to identify individuals with
the NA1 allele plus an amplicon generated with NA2-specific primers
that is incompletely digested with SfaN1 (ie, the sequence
includes both an A and C with the former denoting the Fc RIIIB)
provides evidence for duplication of the gene in selected
individuals.11 Interestingly, in individuals in whom a
product can be amplified with NA2-specific primers, we did not see
evidence of preferential distribution of Fc RIIIb-NA2 genotype and
SH-Fc RIIIb. Further studies across generations are required to sort
out the exact mode of inheritance. On the other hand, in selected
individuals in whom a product could be amplified with NA2-specific
primers, only the SH-Fc RIIIb sequence was detected; Table 5
indicates that there are 14 AA and 1 CA with only SH-Fc RIIIb
sequence detected and no NA2 allele present. These individuals could
have the Fc RIIIb null gene and would phenotype as NA2 but have no
NA2 genotype.
The Fc RIIb has been shown to have an inhibitory effect on
phagocytosis mediated by Fc RIIa and, to a lesser extent, on
phagocytosis mediated by Fc RIIIa.65 Two cDNA clones that
differ by a single base at nucleotide 885 have been reported for the
isoform Fc RIIb1 and are thought to represent allelic
variation.29 The change in an amino acid of the cytoplasmic
domain (tyrosine substituted by an aspartic acid) has been reported to
display differences in receptor internalization and
capping.30 The failure to detect a single G at nucleotide
885 at the genomic level in 70 healthy controls indicates that, if the
polymorphism exists, it is very rare. Although we cannot exclude the
possibility that our amplification primers could have preferentially
recognized a contiguous polymorphic region, linked to the T allele, it
is unlikely, because no polymorphism was identified in this region in a
previous study.29
When we compared our data with a compilation of reported healthy
controls, we uncovered a number of interesting findings. Differences in
the distribution of variant alleles within healthy controls were
apparent for some loci but not for others, depending on the group
studied. For example, comparison of our population with 27 reported
populations in Table 6 demonstrated no difference for Fc RIIa (n = 2,419 for CA and n = 227 for AA), but there was an apparent difference
between our population and the reported literature at the Fc RIIIb
locus (n = 392 for CA). When the Hispanic population reported by
Hessner et al35 is excluded from the Fc RIIIb CA
population, there is no significant difference between our population
and the remaining CA populations ( 2 = 1.02, P = .60). The issue of geographic and ethnic background is critical in
interpreting these studies. Differences in either of these can account
for variations in distribution of variant alleles and probably reflect
varying evolutionary challenges. Although we analyzed AA and CA, the
published literature includes studies of populations from the Far East
and Indian subcontinent. Notably, there is an apparent difference
between populations from the Far East and CA at the Fc RIIa locus.
Lastly, the data in Table 6 indicate that sample size can influence the
distribution of variant genotypes. It is not surprising to find a
difference between 1 of the smaller studies (n = 49) and the sum of 23 studies. On the other hand, 2 of the large studies of Fc RIIa
differed from the sum of the remaining populations. This might reflect that there are actual differences in ethnic populations that become apparent when large enough populations are compared; in turn, these
observa-tions underscore the subtle differences between populations of
the same ethnic background yet different geographical location.
Recently, a number of groups have investigated the clinical
significance of variant alleles in Fc RIIa, Fc IIIa, and Fc IIIb in disease populations. In Table 7, we present a compilation of
reported studies and include recalculation of raw data without correction factors. Specifically, we looked at the overall locus and
also an association between susceptibility to a disease and individual
genotypes. Although the strength of a meta-analysis is undermined by
variations in inclusion criteria and patient populations, several
points emerge from the analysis. First, the association of variant
alleles and disease susceptibility varies between ethnic groups. For
example, the meta-analysis of SLE in Table 7 indicates that the
association between SLE and Fc RIIa variants is strong in populations
of AA and Pacific Rim (PR) background, whereas in CA, the association
is marginal. Second, a stronger association was observed for the same
disease, SLE, but at a different locus, Fc RIIIa, in CA. These data
suggest that differences in the biological role of low-affinity Fc R
receptors could influence disease susceptibility. Third, the importance
of looking at different populations with sufficient numbers is critical
for determining the validity of a proposed association. For example,
the proposed association between heparin-induced thrombocytopenia and
Fc RIIa variants was based on a series of studies, some of which
included a small number of patients.39,44,45,47,57,66
However, a meta-analysis presented in Table 7 of the combined data does not support the proposed association. Lastly, the ability to discern an
association between outcomes within a population with a common disease
depends on adequate patient numbers.
An analysis of published studies exploring the association between
low-affinity Fc R genotypes and phenotype within a single disease
population is presented in Table 8. We identified 5 papers reporting on
7 different populations examining a possible association between
Fc RIIa variants and nephritis in SLE and found no evidence to
support such an association.38,40,49,50,58 There are a
number of promising analyses in patients with CGD, meningococcal infection, or SLE and hemolytic anemia that propose new insights into
disease pathogenesis.31,33,40,43,64 Clearly, further studies are required to validate and expand the observations, but the
ability to observe in vivo the effect of subtle biologic differences
(as demonstrated in known variants of the Fc R) provides an important
avenue of investigation. In an exploratory study, the combination of
low-affinity Fc R, Fc RIIa, Fc RIIIa, and Fc RIIIb was studied
in a cohort of CGD patients; coinheritance of variant Fc RIIa and
Fc RIIIb genotypes was associated with a greater likelihood for
developing granulomas in CGD.33 Similarly, the study also identified a possible association between variant Fc R and other molecules of innate immunity (ie, Fc RIIa and mannose-binding lectin
in autoimmune complications of CGD).
In summary, we present genotype analysis of a large healthy control
population at multiple loci of low-affinity Fc R and found that the
2-locus genotypes are generally randomly distributed. Accordingly, for
the purpose of interpreting population studies, the distribution of
variant genotypes of Fc RIIa, Fc RIIIa, and Fc RIIIb may be
considered independent. These results provide a foundation for
association studies that will seek to analyze multiple Fc R genotypes
simultaneously.33
 |
NOTE IN PROOF |
Even though we did not find significant distortion of the observed
frequencies of the different combinations of 2-locus genotypes from
their expected values, this does not rule out disequilibrium of
haplotypes. In fact, given the close proximity of the 3 loci, one would
expect to find disequilibrium of haplotypes. We tested for
disequilibrium among pairs of loci and for all 3 loci separately in CA
and AA using the program developed by Long et al.67 In CA,
there was significant disequilibrium (P < .001) between all pairs of the 3 loci. In AA, there was significant disequilibrium (P < .05) between IIa-IIIa and IIIa-IIIb, but not between
IIa-IIIb. Neither population showed disequilibrium of the 3 locus haplotypes.
 |
ACKNOWLEDGMENT |
The authors thank Steven Stein and Renee Chen for their technical
assistance and Drs David Stroncek and David Venzon for their advice and comments.
 |
FOOTNOTES |
Submitted January 15, 1999; accepted August 13, 1999.
T.L. was supported by a Dr. Mildred Scheel Stipendium, Deutsche
Krebshilfe e.V.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Stephen J. Chanock, MD, Immunocompromised
Host Section, Pediatric Oncology Branch, Bldg 10, Room 13N240, National
Cancer Institute, National Institutes of Health, Bethesda, MD 20892;
e-mail: sc83a{at}nih.gov.
 |
REFERENCES |
1.
van de Winkel J, Capel P:
Human IgG Fc receptor heterogeneity: Molecular aspects and clinical implications.
Immunol Today
14:215, 1993
[Medline]
[Order article via Infotrieve]
2.
Rascu A, Repp R, Westerdaal N, Kalden J, de Winkel J:
Clinical relevance of Fc-gamma-receptor polymorphisms.
Ann NY Acad Sci
815:282, 1997
[Medline]
[Order article via Infotrieve]
3.
Gessner JE, Heiken H, Tamm A, Schmidt RE:
The IgG Fc receptor family.
Ann Hematol
76:231, 1998
[Medline]
[Order article via Infotrieve]
4.
Peltz GA, Grundy HO, Lebo RV, Yssel H, Barsh GS, Moore KW:
Human Fc gamma RIII: Cloning, expression, and identification of the chromosomal locus of two Fc receptors for IgG.
Proc Natl Acad Sci USA
86:1013, 1989
[Abstract/Free Full Text]
5.
Schnackenberg L, Flesch BK, Neppert J:
Linkage disequilibria between Duffy blood groups, Fc gamma IIa and Fc gamma IIIb allotypes.
Exp Clin Immunogenet
14:235, 1997
[Medline]
[Order article via Infotrieve]
6.
Kluck PM, Wiegant J, Jansen RP, Bolk MW, Raap AK, Willemze R, Landegent JE:
The human interleukin-6 receptor alpha chain gene is localized on chromosome 1 band q21.
Hum Genet
90:542, 1993
[Medline]
[Order article via Infotrieve]
7.
Walsh MT, Divane A, Whitehead AS:
Fine mapping of the human pentraxin gene region on chromosome 1q23.
Immunogenetics
44:62, 1996
[Medline]
[Order article via Infotrieve]
8.
Watson ML, Kingsmore SF, Johnston GI, Siegelman MH, Le Beau MM, Lemons RS, Bora NS, Howard TA, Weissman IL, McEver RP:
Genomic organization of the selectin family of leukocyte adhesion molecules on human and mouse chromosome 1.
J Exp Med
172:263, 1990
[Abstract/Free Full Text]
9.
Su Y, Brooks DG, Li L, Lepercq J, Trofatter JA, Ravetch JV, Lebo RV:
Myelin protein zero gene mutated in Charcot-Marie-tooth type 1B patients.
Proc Natl Acad Sci USA
90:10856, 1993
[Abstract/Free Full Text]
10.
Bux J, Stein E, Bierling P, Fromont P, Clay M, Stroncek D, Santoso S:
Characterization of a new alloantigen (SH) on the human neutrophil Fc -receptor IIIb.
Blood
89:1027, 1997
[Abstract/Free Full Text]
11.
Koene HR, Kleijer M, Roos D, de Haas M, Von dem Borne AE:
Fc RIIIB gene duplication: Evidence for presence and expression of three distinct Fc RIIIB genes in NA(1+,2+)SH(+) individuals.
Blood
91:673, 1998
[Abstract/Free Full Text]
12.
Wang DG, Fan JB, Siao CJ, Berno A, Young P, Sapolsky R, Ghandour G, Perkins N, Winchester E, Spencer J, Kruglyak L, Stein L, Hsie L, Topaloglou T, Hubbell E, Robinson E, Mittmann M, Morris MS, Shen N, Kilburn D, Rioux J, Nusbaum C, Rozen S, Hudson TJ, Lander ES:
Large-scale identification, mapping, and genotyping of single-nucleotide polymorphisms in the human genome.
Science
280:1077, 1998
[Abstract/Free Full Text]
13.
Gorlach A, Lee PL, Roesler J, Hopkins PJ, Christensen B, Green ED, Chanock SJ, Curnutte JT:
A p47-phox pseudogene carries the most common mutation causing p47-phox-deficient chronic granulomatous disease.
J Clin Invest
100:1907, 1997
[Medline]
[Order article via Infotrieve]
14.
Warmerdam PA, van de Winkel JG, Vlug A, Westerdaal NA, Capel PJ:
A single amino acid in the second Ig-like domain of the human Fc gamma receptor II is critical for human IgG2 binding.
J Immunol
147:1338, 1991
[Abstract]
15.
Tax WJ, Willems HW, Reekers PP, Capel PJ, Koene RA:
Polymorphism in mitogenic effect of IgG1 monoclonal antibodies against T3 antigen on human T cells.
Nature
304:445, 1983
[Medline]
[Order article via Infotrieve]
16.
Abo T, Tilden AB, Balch CM, Kumagai K, Troup GM, Cooper MD:
Ethnic differences in the lymphocyte proliferative response induced by a murine IgG1 antibody, Leu-4, to the T3 molecule.
J Exp Med
160:303, 1984
[Abstract/Free Full Text]
17.
Clark MR, Clarkson SB, Ory PA, Stollman N, Goldstein IM:
Molecular basis for a polymorphism involving Fc receptor II on human monocytes.
J Immunol
143:1731, 1989
[Abstract]
18.
Tate BJ, Witort E, McKenzie IF, Hogarth PM:
Expression of the high responder/non-responder human Fc gamma RII. Analysis by PCR and transfection into FcR-COS cells.
Immunol Cell Biol
70:79, 1992
19.
Parren PW, Warmerdam PA, Boeije LC, Arts J, Westerdaal NA, Vlug A, Capel PJ, Aarden LA, van de Winkel JG:
On the interaction of IgG subclasses with the low affinity Fc gamma RIIa (CD32) on human monocytes, neutrophils, and platelets. Analysis of a functional polymorphism to human IgG2.
J Clin Invest
90:1537, 1992
20.
Parren PW, Warmerdam PA, Boeije LC, Capel PJ, van de Winkel JG, Aarden LA:
Characterization of IgG FcR-mediated proliferation of human T cells induced by mouse and human anti-CD3 monoclonal antibodies. Identification of a functional polymorphism to human IgG2 anti-CD3.
J Immunol
148:695, 1992
[Abstract]
21.
Ory PA, Clark MR, Kwoh EE, Clarkson SB, Goldstein IM:
Sequences of complementary DNAs that encode the NA1 and NA2 forms of Fc receptor III on human neutrophils.
J Clin Invest
84:1688, 1989
22.
Ory PA, Goldstein IM, Kwoh EE, Clarkson SB:
Characterization of polymorphic forms of Fc receptor III on human neutrophils.
J Clin Invest
83:1676, 1989
23.
Koene H, Kleijer M, Algra J, Roos D, von dem Borne A, de Haas M:
Fc gamma RIIIa-158V/F polymorphism influences the binding of IgG by natural killer cell Fc gamma RIIIa, independently of the Fc gamma RIIIa-48L/R/H phenotype.
Blood
90:1109, 1997
[Abstract/Free Full Text]
24.
Wu J, Edberg J, Redecha P, Bansal V, Guyre P, Coleman K, Salmon J, Kimberly R:
A novel polymorphism of FcgammaRIIIa (CD16) alters receptor function and predisposes to autoimmune disease.
J Clin Invest
100:1059, 1997
[Medline]
[Order article via Infotrieve]
25.
de Haas M, Koene H, Kleijer M, de Vries E, Simsek S, van Tool M, Roos D, von dem Borne A:
A triallelic Fc gamma receptor type IIIA polymorphism influences the binding of human IgG by NK cell Fc gamma RIIIa.
J Immunol
156:2948, 1996
[Abstract]
26.
Nagarajan S, Chesla S, Cobern L, Anderson P, Zhu C, Selvaraj P:
Ligand binding and phagocytosis by CD16 (Fc gamma receptor III) isoforms.
J Biol Chem
270:26762, 1995
[Abstract/Free Full Text]
27.
Salmon JE, Edberg JC, Kimberly RP:
Fc gamma receptor III on human neutrophils. Allelic variants have functionally distinct capacities.
J Clin Invest
85:1287, 1990
28.
Bredius RG, Fijen CA, De Haas M, Kuijper EJ, Weening RS, Van de Winkel JG, Out TA:
Role of neutrophil Fc gamma RIIa (CD32) and Fc gamma RIIIb (CD16) polymorphic forms in phagocytosis of human IgG1- and IgG3-opsonized bacteria and erythrocytes.
Immunology
83:624, 1994
[Medline]
[Order article via Infotrieve]
29.
Warmerdam PA, van den Herik-Oudijk IE, Parren PW, Westerdaal NA, van de Winkel JG, Capel PJ:
Interaction of a human Fc gamma RIIb1 (CD32) isoform with murine and human IgG subclasses.
Int Immunol
5:239, 1993
[Abstract/Free Full Text]
30.
Van den Herik-Oudijk I, Westerdaal N, Henriquez N, Capel P, Van de Winkel J:
Functional analysis of human Fc-gamma-receptor II (CDII) isoforms expressed in B lymphocytes.
J Immunol
152:574, 1994
[Abstract]
31.
Kobayashi T, Westerdaal NA, Miyazaki A, van der Pol WL, Suzuki T, Yoshie H, van de Winkel JG, Hara K:
Relevance of immunoglobulin G Fc receptor polymorphism to recurrence of adult periodontitis in Japanese patients.
Infect Immun
65:3556, 1997
[Abstract]
32.
Raknes G, Skeie GO, Gilhus NE, Aadland S, Vedeler C:
FcgammaRIIA and FcgammaRIIIB polymorphisms in myasthenia gravis.
J Neuroimmunol
81:173, 1998
[Medline]
[Order article via Infotrieve]
33.
Foster CB, Lehrnbecher T, Mol F, Steinberg SM, Venzon DJ, Walsh TJ, Noack D, Rae J, Winkelstein J, Curnutte JT, Chanock SJ:
Host defense molecule polymorphisms influence the risk for immune-mediated complications in chronic granulomatous disease.
J Clin Invest
102:2146, 1998
[Medline]
[Order article via Infotrieve]
34.
Jiang X, Arepally G, Poncz M, McKenzie S:
Rapid detection of the Fc gamma RIIA-H/R (131) ligand-binding polymorphism using an allele-specific restriction enzyme digestion (ASRED).
J Immunol Methods
199:55, 1996
[Medline]
[Order article via Infotrieve]
35.
Hessner M, Curtis B, Endean D, Aster R:
Determination of neutrophil antigen gene frequencies in five ethnic groups by polymerase chain reaction with sequence-specific primers.
Transfusion
36:895, 1996
[Medline]
[Order article via Infotrieve]
36.
Fromont P, Bettaieb A, Skouri H, Floch C, Poulet E, Duedari N, Bierling P:
Frequency of the polymorphonuclear neutrophil Fc gamma receptor III deficiency in the French population and its involvement in the development of neonatal alloimmune neutropenia.
Blood
79:2131, 1992
[Abstract/Free Full Text]
37.
Hessner MJ, Shivaram SM, Curtis BR, Dinauer DM, Endean DJ, Aster RH:
Neutrophil antigen SH gene frequencies in six racial groups, determined by allele-specific polymerase chain reaction.
Blood
92:16a, 1998
(abstr, suppl 1)
38.
Botto M, Theodoridis E, Thompson EM, Beynon HL, Briggs D, Isenberg DA, Walport MJ, Davies KA:
Fc gamma RIIa polymorphism in systemic lupus erythematosus (SLE): No association with disease.
Clin Exp Immunol
104:264, 1996
[Medline]
[Order article via Infotrieve]
39.
Bachelot-Loza C, Saffroy R, Lasne D, Chatellier G, Aiach M, Rendu F:
Importance of the FcgammaRIIa-Arg/His-131 polymorphism in heparin-induced thrombocytopenia diagnosis.
Thromb Haemost
79:523, 1998
[Medline]
[Order article via Infotrieve]
40.
Manger K, Repp R, Spriewald BM, Rascu A, Geiger A, Wassmuth R, Westerdaal NA, Wentz B, Manger B, Kalden JR, van de Winkel JG:
Fcgamma receptor IIa polymorphism in Caucasian patients with systemic lupus erythematosus: Association with clinical symptoms.
Arthritis Rheum
41:1181, 1998
[Medline]
[Order article via Infotrieve]
41.
Edberg JC, Wainstein E, Wu J, Csernok E, Sneller MC, Hoffman GS, Keystone EC, Gross WL, Kimberly RP:
Analysis of FcgammaRII gene polymorphisms in Wegener's granulomatosis.
Exp Clin Immunogenet
14:183, 1997
[Medline]
[Order article via Infotrieve]
42.
Sanders LA, van de Winkel JG, Rijkers GT, Voorhorst-Ogink MM, de Haas M, Capel PJ, Zegers BJ:
Fc gamma receptor Iia (CD32) heterogeneity in patients with recurrent bacterial respiratory infections.
J Infect Dis
170:854, 1994
[Medline]
[Order article via Infotrieve]
43.
Platonov AE, Shipulin GA, Vershinina IV, Dankert J, van de Winkel JG, Kuijper EJ:
Association of human Fc gamma RIIa (CD32) polymorphism with susceptibility to and severity of meningococcal disease.
Clin Infect Dis
27:746, 1998
[Medline]
[Order article via Infotrieve]
44.
Arepally G, McKenzie SE, Jiang XM, Poncz M, Cines DB:
Fc gamma RIIA H/R 131 polymorphism, subclass-specific IgG anti-heparin/platelet factor 4 antibodies and clinical course in patients with heparin-induced thrombocytopenia and thrombosis.
Blood
89:370, 1997
[Abstract/Free Full Text]
45.
Brandt JT, Isenhart CE, Osborne JM, Ahmed A, Anderson CL:
On the role of platelet Fc gamma RIIa phenotype in heparin-induced thrombocytopenia.
Thromb Haemost
74:1564, 1995
[Medline]
[Order article via Infotrieve]
46.
Horsewood P, Zyba S, Kelton JG:
Role of the platelet FcRIIa polymorphism in idiopathic thrombocytopenia purpura (ITP).
Blood
92:85b, 1998
(abstr, suppl 1)
47.
Denomme G, Warkentin T, Horsewood P, Sheppard J, Warner M, Kelton J:
Activation of platelets by sera containing IgG1 heparin-dependent antibodies: An explanation for the predominance of the Fc gamma RIIa "low responder" (his131) gene in patients with heparin-induced thrombocytopenia.
J Lab Clin Med
130:278, 1997
[Medline]
[Order article via Infotrieve]
48.
Joutsi JL, Javela K, Partanen J, Kekomaki R:
Genetic polymorphism H131R of Fc receptor type IIA (Fc RIIA) in a healthy Finnish population and in patients with or without platelt-associated IgG.
Eur J Hematol
61:183, 1998
[Medline]
[Order article via Infotrieve]
49.
Duits AJ, Bootsma H, Derksen RH, Spronk PE, Kater L, Kallenberg CG, Capel PJ, Westerdaal NA, Spierenburg GT, Gmelig-Meyling FH:
Skewed distribution of IgG Fc receptor IIa (CD32) polymorphism is associated with renal disease in systemic lupus erythematosus patients.
Arthritis Rheum
38:1832, 1995
[Medline]
[Order article via Infotrieve]
50.
Smyth LJ, Snowden N, Carthy D, Papasteriades C, Hajeer A, Ollier WE:
Fc gamma RIIa polymorphism in systemic lupus erythematosus.
Ann Rheum Dis
56:744, 1997
[Abstract/Free Full Text]
51.
Williams Y, Lynch S, McCann S, Smith O, Feighery C, Whelan A:
Correlation of platelet Fc gammaRIIA polymorphism in refractory idiopathic (immune) thrombocytopenic purpura.
Br J Haematol
101:779, 1998
[Medline]
[Order article via Infotrieve]
52.
Abadi J, Zhon Z, Dobroszycki J, Pirofski L:
Fc gamma RIIa polymorphism in human immunodeficiency virus-infected children with invasive pneumococcal disease.
Pediatr Res
42:259, 1997
[Medline]
[Order article via Infotrieve]
53.
Salmon JE, Ng S, Lisse J, Friedman AR, Reveille JD, Alarcon GS:
Allelic variants of FcgammaRIIA may contribute to the high prevalence of nephritis in Mexican American lupus.
Arthritis Rheum
40:S60, 1997
(abstr)
54.
Reilly A, Norris C, Surrey S, Bruchak F, Rappaport E, Schwartz E, McKenzie S:
Genetic diversity in human Fc receptor II for immunoglobulin G: Fc-gamma-receptor IIA ligand-binding polymorphism.
Clin Diagn Lab Immunol
1:640, 1994
[Abstract/Free Full Text]
55.
Caliz AR, Atsumi T, Khamashata MA, Amengual O, Hughes GRV:
No correlation between FcgammaRII HR131 polymorphism and clinical manifestations of antiphospholipid syndrome (APS).
Arthritis Rheum
40:S299, 1997
(abstr)
56.
Osborne JM, Chacko GW, Brandt JT, Anderson CL:
Ethnic variation in frequency of an allelic polymorphism of human Fc gamma RIIA determined with allele specific oligonucleotide probes.
J Immunol Methods
173:207, 1994
[Medline]
[Order article via Infotrieve]
57.
Burgess J, Lindeman R, Chesterman C, Chong B:
Single amino acid mutation of Fc gamma receptor is associated with the development of heparin-induced thrombocytopenia.
Br J Haematol
91:761, 1995
[Medline]
[Order article via Infotrieve]
58.
Salmon JE, Millard S, Schachter LA, Arnett FC, Ginzler EM, Gourley MF, Ramsey-Goldman R, Peterson MG, Kimberly RP:
Fc gamma RIIA alleles are heritable risk factors for lupus nephritis in African Americans.
J Clin Invest
97:1348, 1996
[Medline]
[Order article via Infotrieve]
59.
Norris CF, Surrey S, Bunin GR, Schwartz E, Buchanan GR, McKenzie SE:
Relationship between Fc receptor IIA polymorphism and infection in children with sickle cell disease.
J Pediatr
128:813, 1996
[Medline]
[Order article via Infotrieve]
60.
Song YW, Han CW, Kang SW, Baek HJ, Lee EB, Shin CH, Hahn BH, Tsao BP:
Abnormal distribution of Fcgamma IIa polymorphisms in Korean patients with systemic lupus erythematosus.
Arthritis Rheumat
41:421, 1998
[Medline]
[Order article via Infotrieve]
61.
Koene HR, Kleijer M, Swaak AJ, Sullivan KE, Bijl M, Petri MA, Kallenberg CG, Roos D, van dem Borne AE, de Haas M:
The Fc gammaRIIIA-158F allele is a risk factor for systemic lupus erythematosus.
Arthritis Rheum
41:1813, 1998
[Medline]
[Order article via Infotrieve]
62.
Wainstein E, Edberg J, Csernok E, Sneller M, Hoffman G, Gross W, Salmon J, Kimberly R:
Fcgamma IIIB alleles predict renal dysfunction in Wegener's granulomatosis (WG).
Arthritis Rheum
39:S210, 1996
(abstr)
63.
Salmon JE, Ng S, Sobel R, Simantov R, Lo SK, Furie R, Kaell A, Hamburger MI, Silverstein R, Sammaritano LR:
FcgammaRIIA allele which binds IgG2 (FcRIIa-H131) is increased in patients with anticardiolipin antibodies and thrombosis.
Arthritis Rheum
40:S300, 1997
(abstr)
64.
Platonov AE, Kuijper EJ, Vershinina IV, Shipulin GA, Westerdaal N, Fijen CA, van de Winkel JG:
Meningococcal disease and polymorphism of FcgammaRIIa (CD32) in late complement component-deficient individuals.
Clin Exp Immunol
111:97, 1998
[Medline]
[Order article via Infotrieve]
65.
Hunter S, Indik ZK, Kim MK, Cauley MD, Park JG, Schreiber AD:
Inhibition of Fcgamma receptor-mediated phagocytosis by a nonphagocytic Fcgamma receptor.
Blood
91:1762, 1998
[Abstract/Free Full Text]
66.
Carlsson L, Santoso S, Baurichter G, Kroll H, Papenberg S, Eichler P, Westerdaal N, Kiefel V, van der Winkel J, Greinacher A:
Heparin-induced thrombocytopenia: New insights into the impact of Fc RIIa-R-H131 polymorphism.
Blood
92:1526, 1998
[Abstract/Free Full Text]
67.
Long JC, Williams RC, Urbanek M:
An E-M algorithm and testing strategy for multiple-locus haplotypes.
Am J Hum Genet
56:799, 1995
[Medline]
[Order article via Infotrieve]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
L. G. Perez, M. R. Costa, C. A. Todd, B. F. Haynes, and D. C. Montefiori
Utilization of Immunoglobulin G Fc Receptors by Human Immunodeficiency Virus Type 1: a Specific Role for Antibodies against the Membrane-Proximal External Region of gp41
J. Virol.,
August 1, 2009;
83(15):
7397 - 7410.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. M. Cardarelli, M.-C. Moldovan-Loomis, B. Preston, A. Black, D. Passmore, T.-H. Chen, S. Chen, J. Liu, M. R. Kuhne, M. Srinivasan, et al.
In vitro and In vivo Characterization of MDX-1401 for Therapy of Malignant Lymphoma
Clin. Cancer Res.,
May 15, 2009;
15(10):
3376 - 3383.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Bruhns, B. Iannascoli, P. England, D. A. Mancardi, N. Fernandez, S. Jorieux, and M. Daeron
Specificity and affinity of human Fc{gamma} receptors and their polymorphic variants for human IgG subclasses
Blood,
April 16, 2009;
113(16):
3716 - 3725.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Lejeune, G. Thibault, D. Ternant, G. Cartron, H. Watier, and M. Ohresser
Evidence for Linkage Disequilibrium Between Fc{gamma}RIIIa-V158F and Fc{gamma}RIIa-H131R Polymorphisms in White Patients, and for an Fc{gamma}RIIIa-Restricted Influence on the Response to Therapeutic Antibodies
J. Clin. Oncol.,
November 20, 2008;
26(33):
5489 - 5491.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Musolino, N. Naldi, B. Bortesi, D. Pezzuolo, M. Capelletti, G. Missale, D. Laccabue, A. Zerbini, R. Camisa, G. Bisagni, et al.
In Reply
J. Clin. Oncol.,
November 20, 2008;
26(33):
5491 - 5492.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. C. Willcocks, P. A. Lyons, M. R. Clatworthy, J. I. Robinson, W. Yang, S. A. Newland, V. Plagnol, N. N. McGovern, A. M. Condliffe, E. R. Chilvers, et al.
Copy number of FCGR3B, which is associated with systemic lupus erythematosus, correlates with protein expression and immune complex uptake
J. Exp. Med.,
July 7, 2008;
205(7):
1573 - 1582.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Musolino, N. Naldi, B. Bortesi, D. Pezzuolo, M. Capelletti, G. Missale, D. Laccabue, A. Zerbini, R. Camisa, G. Bisagni, et al.
Immunoglobulin G Fragment C Receptor Polymorphisms and Clinical Efficacy of Trastuzumab-Based Therapy in Patients With HER-2/neu-Positive Metastatic Breast Cancer
J. Clin. Oncol.,
April 10, 2008;
26(11):
1789 - 1796.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. N. Forthal, G. Landucci, J. Bream, L. P. Jacobson, T. B. Phan, and B. Montoya
Fc{gamma}RIIa Genotype Predicts Progression of HIV Infection
J. Immunol.,
December 1, 2007;
179(11):
7916 - 7923.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Z. Alizadeh, G. Valdigem, M. J.H. Coenen, A. Zhernakova, B. Franke, A. Monsuur, P. L.C.M. van Riel, P. Barrera, T. R.D.J. Radstake, B. O. Roep, et al.
Association analysis of functional variants of the FcgRIIa and FcgRIIIa genes with type 1 diabetes, celiac disease and rheumatoid arthritis
Hum. Mol. Genet.,
November 1, 2007;
16(21):
2552 - 2559.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Jafarshad, M. H. Dziegiel, R. Lundquist, L. K. Nielsen, S. Singh, and P. L. Druilhe
A Novel Antibody-Dependent Cellular Cytotoxicity Mechanism Involved in Defense against Malaria Requires Costimulation of Monocytes Fc{gamma}RII and Fc{gamma}RIII
J. Immunol.,
March 1, 2007;
178(5):
3099 - 3106.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. S. Wang, J. R. Cerhan, P. Hartge, S. Davis, W. Cozen, R. K. Severson, N. Chatterjee, M. Yeager, S. J. Chanock, and N. Rothman
Common Genetic Variants in Proinflammatory and Other Immunoregulatory Genes and Risk for Non-Hodgkin Lymphoma
Cancer Res.,
October 1, 2006;
66(19):
9771 - 9780.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N.-K. V. Cheung, R. Sowers, A. J. Vickers, I. Y. Cheung, B. H. Kushner, and R. Gorlick
FCGR2A Polymorphism Is Correlated With Clinical Outcome After Immunotherapy of Neuroblastoma With Anti-GD2 Antibody and Granulocyte Macrophage Colony-Stimulating Factor
J. Clin. Oncol.,
June 20, 2006;
24(18):
2885 - 2890.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. E. Brown, M. D. Fallin, J. J. Goedert, R. Chen, D. Whitby, C. B. Foster, C. Lauria, A. J. Alberg, A. Messina, M. Montella, et al.
A Common Genetic Variant in FCGR3A-V158F and Risk of Kaposi Sarcoma Herpesvirus Infection and Classic Kaposi Sarcoma
Cancer Epidemiol. Biomarkers Prev.,
March 1, 2005;
14(3):
633 - 637.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Niwa, S. Hatanaka, E. Shoji-Hosaka, M. Sakurada, Y. Kobayashi, A. Uehara, H. Yokoi, K. Nakamura, and K. Shitara
Enhancement of the Antibody-Dependent Cellular Cytotoxicity of Low-Fucose IgG1 Is Independent of Fc{gamma}RIIIa Functional Polymorphism
Clin. Cancer Res.,
September 15, 2004;
10(18):
6248 - 6255.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. L. Gluck, D. Hurst, A. Yuen, A. M. Levine, M. A. Dayton, J. P. Gockerman, J. Lucas, K. Denis-Mize, B. Tong, D. Navis, et al.
Phase I Studies of Interleukin (IL)-2 and Rituximab in B-Cell Non-Hodgkin's Lymphoma: IL-2 Mediated Natural Killer Cell Expansion Correlations with Clinical Response
Clin. Cancer Res.,
April 1, 2004;
10(7):
2253 - 2264.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-K. Weng and R. Levy
Two Immunoglobulin G Fragment C Receptor Polymorphisms Independently Predict Response to Rituximab in Patients With Follicular Lymphoma
J. Clin. Oncol.,
November 1, 2003;
21(21):
3940 - 3947.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Cartron, L. Dacheux, G. Salles, P. Solal-Celigny, P. Bardos, P. Colombat, and H. Watier
Therapeutic activity of humanized anti-CD20 monoclonal antibody and polymorphism in IgG Fc receptor Fcgamma RIIIa gene
Blood,
February 1, 2002;
99(3):
754 - 758.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. A. Trikalinos, F. B. Karassa, and J. P. A. Ioannidis
Meta-analysis of the association between low-affinity Fcgamma receptor gene polymorphisms and hematologic and autoimmune diseases
Blood,
September 1, 2001;
98(5):
1634 - 1636.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. W. Press, J. P. Leonard, B. Coiffier, R. Levy, and J. Timmerman
Immunotherapy of Non-Hodgkin's Lymphomas
Hematology,
January 1, 2001;
2001(1):
221 - 240.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Taylor, M. P. Reilly, A. D. Schreiber, P. Chien, J. R. Tuckosh, and S. E. McKenzie
Thrombosis and shock induced by activating antiplatelet antibodies in human Fcgamma RIIA transgenic mice: the interplay among antibody, spleen, and Fc receptor
Blood,
December 15, 2000;
96(13):
4254 - 4260.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. L. nbecher, C. B. Foster, S. Zhu, D. Venzon, S. M. Steinberg, K. Wyvill, J. A. Metcalf, S. S. Cohen, J. Kovacs, R. Yarchoan, et al.
Variant genotypes of Fcgamma RIIIA influence the development of Kaposi's sarcoma in HIV-infected men
Blood,
April 1, 2000;
95(7):
2386 - 2390.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. L. Shields, A. K. Namenuk, K. Hong, Y. G. Meng, J. Rae, J. Briggs, D. Xie, J. Lai, A. Stadlen, B. Li, et al.
High Resolution Mapping of the Binding Site on Human IgG1 for Fcgamma RI, Fcgamma RII, Fcgamma RIII, and FcRn and Design of IgG1 Variants with Improved Binding to the Fcgamma R
J. Biol. Chem.,
February 23, 2001;
276(9):
6591 - 6604.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|