Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lehrnbecher, T.
Right arrow Articles by Chanock, S. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lehrnbecher, T.
Right arrow Articles by Chanock, S. J.
Related Collections
Right arrow Immunobiology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 94 No. 12 (December 15), 1999: pp. 4220-4232

Variant Genotypes of the Low-Affinity Fcgamma Receptors in Two Control Populations and a Review of Low-Affinity Fcgamma Receptor Polymorphisms in Control and Disease Populations

By Thomas Lehrnbecher, Charles B. Foster, Shaoxian Zhu, Susan F. Leitman, Lynn R. Goldin, Konrad Huppi, and Stephen J. Chanock

From the Immunocompromised Host Section, Pediatric Oncology Branch, the Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, and the Laboratory of Genetics, National Cancer Institute, and the Department of Transfusion Medicine, Clinical Center, National Institutes of Health, Bethesda, MD.


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
NOTE IN PROOF
REFERENCES

Fcgamma -receptors (Fcgamma R) provide a critical link between humoral and cellular immunity. The genes of the low-affinity receptors for IgG and their isoforms, namely, Fcgamma RIIa, Fcgamma RIIb, Fcgamma RIIIa, Fcgamma RIIIb, and SH-Fcgamma RIIIb, are located in close proximity on chromosome 1q22. Variant alleles may differ in biologic activity and a number of studies have reported the frequencies of variant Fcgamma R alleles in both disease and control populations. No large study has evaluated the possibility of a nonrandom distribution of variant genotypes. We analyzed 395 normal individuals (172 African Americans [AA] and 223 Caucasians [CA]) at the following loci: Fcgamma RIIa, Fcgamma RIIIa, and Fcgamma RIIIb, including the SH-Fcgamma RIIIb. The genotypic distributions of Fcgamma RIIa, Fcgamma RIIIa, and Fcgamma RIIIb conform to the Hardy-Weinberg law in each group. There was no strong evidence that combinations of 2-locus genotypes of the 3 loci deviated from random distributions in these healthy control populations. The distribution of SH-Fcgamma RIIIb is underrepresented in CA compared with AA (P < .0001) controls. A previously reported variant Fcgamma RIIb was not detected in 70 normal individuals, indicating that this allele, if it exists, is very rare (<1%). In conclusion, we present data that should serve as the foundation for the interpretation of association studies involving multiple variant alleles of the low-affinity Fcgamma R.
© 1999 by The American Society of Hematology.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
NOTE IN PROOF
REFERENCES

RECEPTORS FOR THE Fc domain of IgG (Fcgamma R) are mainly expressed on cells of hematopoietic lineage and provide a critical link between humoral and cellular immunity.1,2 These receptors mediate a variety of biological responses, including antibody-dependent cellular cytotoxicity, endocytosis, phagocytosis, release of inflammatory mediators, and augmentation of antigen presentation.1,3 Fcgamma R are divided into 3 classes: Fcgamma RI (CD64), Fcgamma RII (CD32), and Fcgamma RIII (CD16). Within each class, isoforms have been identified that vary in molecular weight, in binding affinity to different subclasses of human IgG, and in distribution on the surface of hematopoietic cells. A further level of complexity is introduced by the presence of variant alleles in the low-affinity receptors: Fcgamma RIIa, IIb, IIIa, and IIIb. In some cases, variant forms of the low-affinity receptors have been reported to have biologic differences in in vitro assays. A burgeoning number of association studies, correlating clinical outcomes with variant alleles, underscores the potential importance of these variant alleles in vivo. Accordingly, it is critical to determine the distribution of variant genotypes individually and in combination in a large control population to interpret association studies that seek to evaluate multiple Fcgamma R genotypes in combination.

The structural heterogeneity and complex nature of the isoforms and their variant alleles reflect the functional diversity mediated by these receptors. The low-affinity receptors (Fcgamma RIIa, IIb, IIIa, and IIIb) colocalize with other genes of hematopoietic and immunologic interest to a region in chromosome 1q22 that includes the receptor for interleukin-6, C-reactive protein, the selectin cluster, and the Duffy blood group.4-8 It is estimated that the maximum distance between any of the 2 low-affinity Fcgamma R genes (Fcgamma RIIa, IIb, IIIa and IIIb) is approximately 200 kb.4,9 The location of a recently described variant, SH-Fcgamma RIIIb, which has been identified in individuals in whom a polymerase chain reaction (PCR) fragment can be amplified with NA2-specific primers derived from Fcgamma RIIIb, is not known at this time.10,11

Preliminary results of the human genome project suggest that polymorphisms occur approximately once every 800 to 1,200 bp.12 In regions sharing a high degree of homology, such as the Fcgamma R, crossing over may be favored, and one might expect to see a greater frequency of recombination events and, perhaps, polymorphisms.13 However, only a handful of biologically or clinically significant variant alleles of the low-affinity Fcgamma R, Fcgamma RIIa, IIb, IIIa, and IIIb have been identified.

It has been reported that some variant alleles of the low-affinity Fcgamma R are of functional or clinical importance. For example, Fcgamma RIIa has 2 codominantly expressed alleles that differ at 1 amino acid, R131 and H131.14 These were initially identified on the basis of a functional polymorphism related to murine IgG1 binding and were designated as low responder (LR) and high responder (HR), respectively.15,16 Several groups have shown a decreased ability of the R131 allele to bind human IgG2.14,17-20 Both Fcgamma RIIIa, which is expressed on NK cells and phagocytic cells, and Fcgamma RIIIb, which is expressed on neutrophils, display codominant biallelic variants.21-24 The 158F allele of Fcgamma RIIIa has been shown to bind IgG1, IgG3, and IgG4 less avidly.23,24 We limited our analysis of the Fcgamma RIIIa gene to the V and F alleles at amino acid 158 and did not analyze the tri-allelic polymorphism, 48 L/H/R, which is probably linked to 158 V/F and also appears not to confer a significant biologic difference.23,25 The 2 allotypes of Fcgamma RIIIb, assigned as neutrophil antigen (NA) 1 and 2, differ in at least 5 nucleotides, resulting in changes of 4 amino acids in the membrane-distant Ig-like domain.21,22 In comparison to the neutrophils obtained from NA1 homozygous donors, neutrophils from NA2 homozygous individuals bind human IgG3 less effectively and were consistently found to exhibit lower levels of phagocytosis of erythrocytes sensitized with IgG1 and IgG3 anti-Rhesus D monoclonal antibody.26-28 Furthermore, phagocytosis of IgG1-opsonized bacteria by Fcgamma RIIIb-NA2 neutrophils was also reduced in comparison to Fcgamma RIIIb-NA1 neutrophils, whereas no difference was found using IgG2-opsonized bacteria.28 A single nucleotide change at nucleotide 885 in Fcgamma RIIb1 (T right-arrow G) has been reported at the cDNA level only.29 The proposed change of 1 amino acid appears to alter receptor internalization and capping in in vitro studies.29,30 In addition, we investigated the distribution of the recently described SH-Fcgamma RIIIb, which differs from the wild-type NA-2 allele by at least 1 single nucleotide, although a biologic difference has not been established.10,11

The purpose of our study was to determine the frequency of selected variant alleles of the low-affinity Fcgamma R genes in a large, healthy control population. To this end, we genotyped 395 normal healthy individuals (172 African Americans [AA] and 223 Caucasians [CA]) and determined the distribution and frequency of biologically important variant alleles of Fcgamma RIIa, IIb, IIIa, and IIIb, including SH-Fcgamma RIIIb. We have sought to identify whether there is nonrandom distribution of combinations of variant genotypes in these 2 populations. Understanding the distribution of multiple Fcgamma R variant genotypes in control populations furnishes a critical foundation upon which to interpret future association studies. Our study provides a basis upon which the independent segregation of individual Fcgamma R genes within a population may be estimated. Understanding the extent of the interaction between multiple Fcgamma R genotypes could lead to further insight into the contribution of this complex family of genes to various pathologic conditions.31-33


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
NOTE IN PROOF
REFERENCES

Subjects

Genomic DNA was isolated from peripheral blood using either a phenol-chloroform extraction method (5 Prime-3 Prime, Inc, Boulder, CO) or Puregene DNA isolation kit (Gentra Systems, Minneapolis, MN). Blood samples from 395 normal healthy individuals, consisting of 172 AA and 223 CA, were available for genomic DNA extraction under an Institutional Review Board-approved protocol for anonymous genomic DNA collection under the supervision of the Department of Transfusion Medicine, Clinical Center, National Institutes of Health (Bethesda, MD). Only the race and sex were recorded and linked to an anonymous identifier during collection of samples.

Determination of the Polymorphic Forms of the Low-Affinity Fcgamma R

Genomic DNA was amplified according to conditions specific for each Fcgamma R. Genotype analysis was completed before statistical analysis. All assays were performed at least twice.

Fcgamma RIIa.   The previously reported polymorphism in the coding region of Fcgamma RIIa was determined by allele-specific restriction digest according to methods described by Jiang et al.34 A mutant oligonucleotide-directed restriction site was created in the 5' end of the amplicon using the following sense primer: GGAAAATCCCAGAAATTCTCGC. The less frequent, variant allele, R, contains a BstUI restriction digest site (an introduced G compared with the wild-type A). The antisense primer, CAACAGCCTGACTACCTATTACGCGGG, corresponding to a sequence in the next intron, assures gene specific amplification and introduces a second BstUI restriction site that serves as an internal control for restriction digestion. PCR amplification was performed in a 50 µL reaction with 50 ng genomic DNA, 100 ng of each primer, 200 µmol/L each dNTP, 0.5 U Taq DNA polymerase (Boehringer Mannheim, Mannheim, Germany), and the manufacturer's buffer. A denaturation step of 95°C for 5 minutes was followed by 30 cycles of 94°C for 15 seconds, 55°C for 30 seconds, and 72°C for 40 seconds. After BstUI digestion, samples were analyzed on a 3% agarose gel.

Fcgamma RIIb.   Direct sequence analysis was performed on amplicons amplified using the following sense and antisense primers, TCCCATCCAACCCTGGA and GGCAGATTCCTCAGCAAATCA, respectively. Fifty-microliter reactions containing 50 ng genomic DNA, 150 ng of each primer, 200 µmol/L dNTP, and 0.5 U Taq polymerase were amplified under the following conditions: initial denaturation at 95°C for 5 minutes, followed by 30 cycles of 95°C for 30 seconds, 56°C for 30 seconds, and 72°C for 60 seconds. The primers used for amplification were used for sequencing with the Thermo Sequenase radiolabeled terminator cycle sequencing kit (Amersham Life Sciences, Inc, Cleveland, OH) at 35 cycles and an annealing temperature of 55°C.

Fcgamma RIIIa.   The 158V/F-Fcgamma RIIIa polymorphism was discriminated by an allele-specific oligohybridization of a nested PCR amplification of genomic DNA. A gene-specific, 1.2-kb fragment was amplified using the following sense and antisense primers, ATATTTACAGAATGGCACAGG and GACTTGGTACCCAGGTTGAA, respectively, in a 25 µL reaction with 20 ng of genomic DNA, 75 ng of each primer, 200 µmol/L dNTP, and 0.25 U Taq polymerase. PCR conditions were as follows: 5 minutes of initiation denaturation at 95°C, followed by 35 cycles at 95°C for 1 minute, 56°C for 1 minute, and 72°C for 1 minute. One microliter of this reaction was transferred to a separate microfuge tube for nested PCR in a total volume of 50 µL that included 150 ng of sense and antisense primers, TCATCATAATTCTGACTTCT and CTTGAGTGATGGTGATGTTC, 200 µmol/L dNTP, and 0.5 U Taq polymerase. PCR conditions for the second amplification consisted of 30 cycles of 95°C for 1 minute, 62°C for 1 minute, and 72°C for 1 minute. Ten microliters of the final PCR reaction was transferred to a nylon filter in duplicate (Hybond N+; Amersham). Each filter was hybridized with a [gamma -32P]-ATP-labeled oligonucleotide probe corresponding to the F or V allele, GCAGGGGGCTTTTTGGGAGTAAA or GCAGGGGGCTTGTTGGGAGTAAA. The blots were washed in 6× SSPE with 1% sodium dodecyl sulfate (SDS) at room temperature, 42°C, and twice for 10 minutes each time at 70.5°C for the probe containing the T allele and at 72.5°C for the G allele. Autoradiography was performed and analyzed between 8 and 24 hours later.

Fcgamma RIIIb.   Polymorphic forms of Fcgamma RIIIb were determined by gene- and allele-specific PCR with the following primer pairs, NA1-sense, CTCAATGGTACAGGGTGCTC and NA1-antisense, GGCCTGGCTTGAGATGAGGT or NA2-sense, CTCAATGGTACAGCGTGCTT and NA2-antisense, CACCTGTACTCTCCACTGTCGTT, using a modified protocol according to Hessner et al.35 Control amplification of a 383-bp segment of the C-myc gene was included in each tube with the following primer pair, ACGCCCCTCAACGTTAGCTT and CGCAGATGAAACTCTGGTTCACCAT. Fifty nanograms of genomic DNA was amplified in 50 µL reaction containing 200 µmol/L dNTP, 10 ng of each Myc-primer, 0.5 U Taq polymerase, and either primer pair for NA1 or NA2. The PCR conditions were as follows: 30 cycles of 94°C for 1 minute, 67°C for 1 minute, and 72°C for 1 minute. PCR products were visualized on a 3% agarose gel.

SH-Fcgamma RIIIb.   The reported sequence variation observed in individuals in whom an amplicon can be amplified with NA2-specific primers, SH-Fcgamma RIIIb, was determined by allele-specific digest of a PCR amplicon with SfaNI as described by Bux et al.10 Using the allele-specific primer pair for Fcgamma RIIIb-NA2 under conditions detailed above, digestion with the restriction endonuclease SfaNI was performed for 3 hours and the products were visualized on a 3% agarose gel.

Literature Search

Citations including information on variant alleles of the Fcgamma R and associated clinical studies were identified by performing searches using PubMed extending back to 1980 (National Center for Biotechnology and Information, National Library of Medicine, National Institutes of Health). Keywords included polymorphism, allele, Fc receptor, Fcgamma Receptor, and clinical association. Additional references were identified from bibliographies of identified references.

Statistical Analysis

Allele frequencies were computed from the observed data and deviations of observed genotypic distributions from expected distributions based on the Hardy-Weinberg law were tested using a chi 2 test statistic with 1 degree of freedom. For comparison of 2-locus genotypic distributions from random expectations, a chi 2 test with 4 degrees of freedom was performed on each 3 × 3 table of genotypes. In this exploratory analysis, P values were corrected by a factor of 3, which correlates with the number of loci examined. For any 2-locus test with a P value less than .05, we looked at specific combinations of genotypes by making 3 × 2 tables and computing a chi 2 test with 2 degrees of freedom. Similarly, these P values were corrected by a factor of 3 on the premise that the analysis looked at 3 different genotypes. Statistical analysis was performed using the Macintosh 2.0 version of InStatR (GraphPad Software, San Diego, CA).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
NOTE IN PROOF
REFERENCES

A total of 395 individuals (172 AA and 223 CA) were genotyped for at least 1 low-affinity receptor, Fcgamma RIIa, Fcgamma RIIIa, or Fcgamma RIIIb (Table 1). For each of the Fcgamma R examined, the genotypic distributions in both populations analyzed conform to the Hardy-Weinberg equilibrium (Table 2). In 5 individuals (1.3%), no Fcgamma RIIIb gene was detectable, in accordance with previously reported data indicating that less than 1% of the population lacks the Fcgamma RIIIb phenotype or that additional polymorphisms interfere with allele-specific amplification.36 The allelic frequencies of Fcgamma RIIa, and Fcgamma RIIIb did not differ between AA and CA, but in the Fcgamma RIIIa, there was a marginal difference between the 2 groups for the heterozygotes 158V/F (P = .048).

                              
View this table:
[in this window]
[in a new window]
 
Table 1. Genotype Distribution of Fcgamma RIIa, Fcgamma RIIIa, and Fcgamma RIIIb in Normal, Healthy Controls


                              
View this table:
[in this window]
[in a new window]
 
Table 2. Single Locus Test for Hardy-Weinberg Equilibrium of Low-Affinity Fcgamma Receptors: Fcgamma RIIa, Fcgamma RIIIa, and Fcgamma RIIIb

To further investigate the possibility of a nonrandom distribution of genotypes in a healthy population, we concentrated our analysis on 330 individuals (150 AA and 180 CA) who were successfully typed at the 3 loci for Fcgamma RIIa, Fcgamma RIIIa, and Fcgamma RIIIb. The distribution of allelic variations in this subgroup did not differ significantly from the distribution observed in the total group (data not shown). There was no strong evidence for nonrandom distribution of combinations of variant genotypes in either population (Table 3). It should be noted that, in the CA population, there is a marginally significant P value for the combination of Fcgamma RIIIa and Fcgamma IIIb (P = .046), suggesting an overrepresentation of 1 or more combinations of variant genotypes. When we analyzed this group individually, the only notable finding was for the combination of the 158F/F genotype of Fcgamma RIIIa and the Fcgamma RIIIb alleles (P = .016 corrected for multiple comparisons; n = 3). The other genotypes, V/F and V/V of 158, did not demonstrate a skewed distribution of combinations of the variant genotypes of the 2 loci.

                              
View this table:
[in this window]
[in a new window]
 
Table 3. Analysis of Variant Genotypes of Fcgamma RIIa, Fcgamma RIIIa, and Fcgamma RIIIb in a Healthy, Control Population

Of the 330 individuals genotyped for both Fcgamma RIIIb and SH-Fcgamma RIIIb, the variant sequence of SH-Fcgamma RIIIb was observed exclusively in individuals in whom a PCR fragment could be amplified with NA2-specific primers (Table 4). Accordingly, no individuals homozygous for NA1 had evidence of the sequence of SH-Fcgamma RIIIb. The A sequence, which denotes SH-Fcgamma RIIIb, was significantly underrepresented in CA compared with AA (P < .0001; Table 4).37 We further analyzed the distribution of the SH-Fcgamma RIIIb genotype in individuals in whom a PCR product could be amplified with NA2 specific primers (Table 5). In the AA population, which has a higher frequency of detecting the variant SH-Fcgamma RIIIb sequence, there was no difference in the distribution between those individuals with only NA2 primer-generated products (ie, no NA1 product was seen separately) and those individuals who also had an NA1 allele. These results suggest that SH-Fcgamma RIIIb in AA appears to be randomly distributed between the 2 genotypes that contain fragments generated with NA2-specific primers (ie, with and without the presence of NA1). For those individuals in whom an amplicon was amplified with NA2 primers and complete SfaN1 digestion was observed, it is assumed that only the SH-Fcgamma RIIIb sequence is present. From our typing assays, it is not possible to conclude whether 1 or 2 copies of the SH-Fcgamma RIIIb sequence are present; an Fcgamma RIIIb null gene could be present. Furthermore, our results indicate that, in some individuals, there might be duplication or redundancy of the Fcgamma RIIIb gene, because SH-Fcgamma RIIIb (as indicated by heterozygosity with respect to SfaN1 digestion) is detected in individuals with the NA1 allele and a fragment amplified with the NA2-specific primers (Table 5). Of the 43 AA who were positive for SH-Fcgamma RIIIb, in 29, incomplete Sfa1 digestion was observed (67% of SH-Fcgamma RIIIb and 24% of the total population), indicating either duplication or redundancy of the Fcgamma RIIIb gene, whereas in 14 AA individuals (33% of SH-Fcgamma RIIIb positive and 11% overall), only the SH-Fcgamma RIIIb sequence was detected. In only 1 of 8 CA patients who were positive for SH-Fcgamma RIIIb, complete SfaN1 digestion was observed.

                              
View this table:
[in this window]
[in a new window]
 
Table 4. Genotype Distribution of SH-Fcgamma RIIIb in Individuals in Whom a PCR Fragment Could Be Amplified With NA2-Specific Primers


                              
View this table:
[in this window]
[in a new window]
 
Table 5. Distribution of Variant Genotypes of SH-Fcgamma RIIIb in Individuals, as Determined by SfaN1 Digestion of PCR Fragments Amplified With NA2-Specific Primers

A variant cDNA has been isolated corresponding to a possible polymorphism in Fcgamma RIIb that alters its biologic function.29,30 We directly sequenced 140 separate chromosomes from 52 CA and 18 AA individuals and in each case identified T at bp 885 and no G. We conclude that this proposed variant of Fcgamma RIIb is very rare, if it exists.

A comparison of our results with those of published studies, identified using PubMed, which generally report on only 1 Fcgamma R variant allele, is shown in a meta-analysis in Table 6. The largest collection of studies has been reported for the H/R genotypes of Fcgamma RIIa. In total, 2,419 CA have been genotyped and reported in 23 studies including 24 separate populations.32,38-57,61,66 An analysis of the distribution of variant genotypes of Fcgamma RIIa was performed between individual study populations and the remaining published population as well as against the population reported here. In 3 of the 23 studies, there was a difference detected by 3 × 2 chi 2 analysis.32,38,39 Interestingly, these included the 2 largest studies and 1 of the smallest studies. Comparison of our study results to the total in Table 6 did not show a significant difference overall (P = .14; chi 2 = 3.99) or by genotype (data not shown). Similarly, there was no difference between the reported populations of AA at the Fcgamma RIIa locus or between our population and the total of the 3 studies.38,54,58 However, there is an appreciable difference in the distribution of variant Fcgamma RIIa genotypes in populations from the Far East.31,38,56,60

                              
View this table:
[in this window]
[in a new window]
 
Table 6. Published Data of Frequencies of Variant Genotypes of the Low-Affinity Fcgamma Receptors

In comparison to the published literature on Fcgamma RIIa variant genotypes, there are few studies with small sample sizes reporting the frequency of variant genotypes of Fcgamma RIIIa and Fcgamma RIIIb in CA and Fcgamma RIIIb in AA.23,24,32,35,61,62 Comparison of our results for Fcgamma RIIIa in CA to those of the published literature indicates a difference for the FF genotype only.23 Similarly, the distribution of the NA1/NA2 and NA2/NA2 genotypes in AA differed from the one study in the literature.35 Previously, there were no published data available for Fcgamma RIIIa in AA.

In Table 7, we present an analysis of published studies comparing the distribution of low-affinity Fcgamma R genotypes in cohorts with a well-defined disease versus healthy controls. These studies describe the possible contribution of Fcgamma R variants to development of the underlying disease listed in the left-hand column (Table 7). We analyzed the data presented as raw numbers in each report and reported the findings without correction. The data presented in Table 7 indicate that, in patients with systemic lupus erythematosus (SLE), the association with Fcgamma RIIa variant genotypes varied in different populations. For example, in AA, 2 of 3 studies demonstrated an association, whereas none of the studies in CA are compelling.38,58 In the meta-analysis, the overall effect appears to be stronger for AA compared with CA (P = .001 v P = .078). On the other hand, the association between Fcgamma RIIIa variants and SLE has been well demonstrated in both reported studies (P = .004 and P = .0072).23,24

                              
View this table:
[in this window]
[in a new window]
 
Table 7. Published Studies Comparing the Distribution of Low-Affinity Fcgamma R Genotypes in Disease Versus Normal Control Populations

Published studies exploring the association between low-affinity Fcgamma R genotypes and phenotypic differences within a specific disease population are presented in Table 8. A meta-analysis was performed on studies examining SLE and nephritis at the Fcgamma RIIa locus; the individual studies indicate that the overall association at this locus is weak, at best. In the absence of significance at the locus overall, it is difficult to interpret the marginal association observed between H/H genotype and nephritis in AA with SLE. Table 8 also includes single studies that associate 1 more Fcgamma R with renal dysfunction in Wegener's granulomatosis, thymoma in myasthenia gravis, granulomas or auto-immune disease in chronic granulomatous disease, recurrence of periodontitis, hemolytic anemia in SLE, and severe meningococcal infection.31-33,40,41,64

                              
View this table:
[in this window]
[in a new window]
 
Table 8. Published Studies Exploring the Association Between Low-Affinity Fcgamma R Genotypes and Phenotype Within a Single Disease Population


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
NOTE IN PROOF
REFERENCES

In this study, we analyzed the distribution of variant alleles of members of the low-affinity Fcgamma R family, including Fcgamma RIIa, Fcgamma RIIb, Fcgamma RIIIa, Fcgamma RIIIb, and SH-Fcgamma RIIIb, in 395 healthy, normal individuals. We present a substantially larger healthy cohort than previously published studies and specifically examined both single allelic frequencies and the possibility of nonrandom distribution of variant genotypes. Our data indicate that there is a marginal difference in the distribution of genotypes between AA and CA for the 158V/F genotype of Fcgamma RIIIa (P = .048), whereas no difference was detected for the Fcgamma RIIa and Fcgamma RIIIb genotypes. Notably, our study represents the largest collection of AA controls analyzed at the Fcgamma RIIa and Fcgamma RIIIb loci. Furthermore, we report the first data on allelic distribution of the variant alleles V and F of Fcgamma RIIIa in the AA population.

Despite the fact that the Fcgamma RIIa, Fcgamma RIIIa, and Fcgamma RIIIb genes are most likely derived from a common ancestral gene and are clustered in close proximity on chromosome 1q22, we did not find strong evidence for nonrandom distribution of variant Fcgamma R genotypes within our healthy, control population.4 In the course of our analysis, we only found evidence for a tendency towards a skewed distribution of combinations of the 158 F/F genotype of Fcgamma RIIIa with Fcgamma RIIIB genotypes. The significance of this finding will be borne out in future studies of comparable healthy control populations. The tendency towards a skewed distribution was seen only in the CA population and not in the AA population. Overall, we conclude that, in our population of healthy controls of AA and CA background, Fcgamma R genotypes for the low-affinity receptors, Fcgamma RIIa, Fcgamma RIIIa, and Fcgamma RIIIb, are randomly distributed. Although it has previously been suggested that linkage disequilibrium exists between the NA1 phenotype of Fcgamma RIIIb and the high responder of Fcgamma RIIa, this earlier study relied on phenotype and not genotype data.5 Because the study did not directly examine the distribution of genotypes or allelic frequencies of both genes, Fcgamma RIIa and Fcgamma RIIIb, it is difficult to conclude that linkage disequilibrium exists. However, genotype analysis of our control population did not confirm an association between the pairs of loci genotypes previously reported. These results provide a foundation for future association studies that will look at multiple genotypes of the low-affinity Fcgamma R.

Recently, a new alloantigen of Fcgamma RIIIb, named SH-Fcgamma RIIIb, has been characterized; it differs from the Fcgamma RIIIb-NA2 allele by a single nucleotide change (C for A at position 266) that results in the substitution of a hydrophobic alanine with an aspartic acid residue.10,11 The structural and functional implications of this change are not known. We found that the frequency of the SH variant differs between AA and CA (P < .0001); only 3.8% of CA were SH-Fcgamma RIIIb positive, whereas 25% of AA were SH-Fcgamma RIIIb positive. These data are in agreement with those of other reports.10,11,37 Our results confirm other studies showing that the SH-Fcgamma RIIIb is identified in individuals in whom a fragment can be amplified with NA2-specific primers.11,37 Because there is only a single base difference between NA2 and SH-Fcgamma RIIIb, it could be inferred that the SH-Fcgamma RIIIb is a point-mutated allele of NA2. However, we have considered it as a separate entity for the present analysis. Furthermore, the ability to identify individuals with the NA1 allele plus an amplicon generated with NA2-specific primers that is incompletely digested with SfaN1 (ie, the sequence includes both an A and C with the former denoting the Fcgamma RIIIB) provides evidence for duplication of the gene in selected individuals.11 Interestingly, in individuals in whom a product can be amplified with NA2-specific primers, we did not see evidence of preferential distribution of Fcgamma RIIIb-NA2 genotype and SH-Fcgamma RIIIb. Further studies across generations are required to sort out the exact mode of inheritance. On the other hand, in selected individuals in whom a product could be amplified with NA2-specific primers, only the SH-Fcgamma RIIIb sequence was detected; Table 5 indicates that there are 14 AA and 1 CA with only SH-Fcgamma RIIIb sequence detected and no NA2 allele present. These individuals could have the Fcgamma RIIIb null gene and would phenotype as NA2 but have no NA2 genotype.

The Fcgamma RIIb has been shown to have an inhibitory effect on phagocytosis mediated by Fcgamma RIIa and, to a lesser extent, on phagocytosis mediated by Fcgamma RIIIa.65 Two cDNA clones that differ by a single base at nucleotide 885 have been reported for the isoform Fcgamma RIIb1 and are thought to represent allelic variation.29 The change in an amino acid of the cytoplasmic domain (tyrosine substituted by an aspartic acid) has been reported to display differences in receptor internalization and capping.30 The failure to detect a single G at nucleotide 885 at the genomic level in 70 healthy controls indicates that, if the polymorphism exists, it is very rare. Although we cannot exclude the possibility that our amplification primers could have preferentially recognized a contiguous polymorphic region, linked to the T allele, it is unlikely, because no polymorphism was identified in this region in a previous study.29

When we compared our data with a compilation of reported healthy controls, we uncovered a number of interesting findings. Differences in the distribution of variant alleles within healthy controls were apparent for some loci but not for others, depending on the group studied. For example, comparison of our population with 27 reported populations in Table 6 demonstrated no difference for Fcgamma RIIa (n = 2,419 for CA and n = 227 for AA), but there was an apparent difference between our population and the reported literature at the Fcgamma RIIIb locus (n = 392 for CA). When the Hispanic population reported by Hessner et al35 is excluded from the Fcgamma RIIIb CA population, there is no significant difference between our population and the remaining CA populations (chi 2 = 1.02, P = .60). The issue of geographic and ethnic background is critical in interpreting these studies. Differences in either of these can account for variations in distribution of variant alleles and probably reflect varying evolutionary challenges. Although we analyzed AA and CA, the published literature includes studies of populations from the Far East and Indian subcontinent. Notably, there is an apparent difference between populations from the Far East and CA at the Fcgamma RIIa locus. Lastly, the data in Table 6 indicate that sample size can influence the distribution of variant genotypes. It is not surprising to find a difference between 1 of the smaller studies (n = 49) and the sum of 23 studies. On the other hand, 2 of the large studies of Fcgamma RIIa differed from the sum of the remaining populations. This might reflect that there are actual differences in ethnic populations that become apparent when large enough populations are compared; in turn, these observa-tions underscore the subtle differences between populations of the same ethnic background yet different geographical location.

Recently, a number of groups have investigated the clinical significance of variant alleles in Fcgamma RIIa, Fcgamma IIIa, and Fcgamma IIIb in disease populations. In Table 7, we present a compilation of reported studies and include recalculation of raw data without correction factors. Specifically, we looked at the overall locus and also an association between susceptibility to a disease and individual genotypes. Although the strength of a meta-analysis is undermined by variations in inclusion criteria and patient populations, several points emerge from the analysis. First, the association of variant alleles and disease susceptibility varies between ethnic groups. For example, the meta-analysis of SLE in Table 7 indicates that the association between SLE and Fcgamma RIIa variants is strong in populations of AA and Pacific Rim (PR) background, whereas in CA, the association is marginal. Second, a stronger association was observed for the same disease, SLE, but at a different locus, Fcgamma RIIIa, in CA. These data suggest that differences in the biological role of low-affinity Fcgamma R receptors could influence disease susceptibility. Third, the importance of looking at different populations with sufficient numbers is critical for determining the validity of a proposed association. For example, the proposed association between heparin-induced thrombocytopenia and Fcgamma RIIa variants was based on a series of studies, some of which included a small number of patients.39,44,45,47,57,66 However, a meta-analysis presented in Table 7 of the combined data does not support the proposed association. Lastly, the ability to discern an association between outcomes within a population with a common disease depends on adequate patient numbers.

An analysis of published studies exploring the association between low-affinity Fcgamma R genotypes and phenotype within a single disease population is presented in Table 8. We identified 5 papers reporting on 7 different populations examining a possible association between Fcgamma RIIa variants and nephritis in SLE and found no evidence to support such an association.38,40,49,50,58 There are a number of promising analyses in patients with CGD, meningococcal infection, or SLE and hemolytic anemia that propose new insights into disease pathogenesis.31,33,40,43,64 Clearly, further studies are required to validate and expand the observations, but the ability to observe in vivo the effect of subtle biologic differences (as demonstrated in known variants of the Fcgamma R) provides an important avenue of investigation. In an exploratory study, the combination of low-affinity Fcgamma R, Fcgamma RIIa, Fcgamma RIIIa, and Fcgamma RIIIb was studied in a cohort of CGD patients; coinheritance of variant Fcgamma RIIa and Fcgamma RIIIb genotypes was associated with a greater likelihood for developing granulomas in CGD.33 Similarly, the study also identified a possible association between variant Fcgamma R and other molecules of innate immunity (ie, Fcgamma RIIa and mannose-binding lectin in autoimmune complications of CGD).

In summary, we present genotype analysis of a large healthy control population at multiple loci of low-affinity Fcgamma R and found that the 2-locus genotypes are generally randomly distributed. Accordingly, for the purpose of interpreting population studies, the distribution of variant genotypes of Fcgamma RIIa, Fcgamma RIIIa, and Fcgamma RIIIb may be considered independent. These results provide a foundation for association studies that will seek to analyze multiple Fcgamma R genotypes simultaneously.33


    NOTE IN PROOF
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
NOTE IN PROOF
REFERENCES

Even though we did not find significant distortion of the observed frequencies of the different combinations of 2-locus genotypes from their expected values, this does not rule out disequilibrium of haplotypes. In fact, given the close proximity of the 3 loci, one would expect to find disequilibrium of haplotypes. We tested for disequilibrium among pairs of loci and for all 3 loci separately in CA and AA using the program developed by Long et al.67 In CA, there was significant disequilibrium (P < .001) between all pairs of the 3 loci. In AA, there was significant disequilibrium (P < .05) between IIa-IIIa and IIIa-IIIb, but not between IIa-IIIb. Neither population showed disequilibrium of the 3 locus haplotypes.


    ACKNOWLEDGMENT

The authors thank Steven Stein and Renee Chen for their technical assistance and Drs David Stroncek and David Venzon for their advice and comments.


    FOOTNOTES

Submitted January 15, 1999; accepted August 13, 1999.

T.L. was supported by a Dr. Mildred Scheel Stipendium, Deutsche Krebshilfe e.V.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

Address reprint requests to Stephen J. Chanock, MD, Immunocompromised Host Section, Pediatric Oncology Branch, Bldg 10, Room 13N240, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892; e-mail: sc83a{at}nih.gov.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
NOTE IN PROOF
REFERENCES

1. van de Winkel J, Capel P: Human IgG Fc receptor heterogeneity: Molecular aspects and clinical implications. Immunol Today 14:215, 1993 [Medline] [Order article via Infotrieve]

2. Rascu A, Repp R, Westerdaal N, Kalden J, de Winkel J: Clinical relevance of Fc-gamma-receptor polymorphisms. Ann NY Acad Sci 815:282, 1997 [Medline] [Order article via Infotrieve]

3. Gessner JE, Heiken H, Tamm A, Schmidt RE: The IgG Fc receptor family. Ann Hematol 76:231, 1998 [Medline] [Order article via Infotrieve]

4. Peltz GA, Grundy HO, Lebo RV, Yssel H, Barsh GS, Moore KW: Human Fc gamma RIII: Cloning, expression, and identification of the chromosomal locus of two Fc receptors for IgG. Proc Natl Acad Sci USA 86:1013, 1989 [Abstract/Free Full Text]

5. Schnackenberg L, Flesch BK, Neppert J: Linkage disequilibria between Duffy blood groups, Fc gamma IIa and Fc gamma IIIb allotypes. Exp Clin Immunogenet 14:235, 1997 [Medline] [Order article via Infotrieve]

6. Kluck PM, Wiegant J, Jansen RP, Bolk MW, Raap AK, Willemze R, Landegent JE: The human interleukin-6 receptor alpha chain gene is localized on chromosome 1 band q21. Hum Genet 90:542, 1993 [Medline] [Order article via Infotrieve]

7. Walsh MT, Divane A, Whitehead AS: Fine mapping of the human pentraxin gene region on chromosome 1q23. Immunogenetics 44:62, 1996 [Medline] [Order article via Infotrieve]

8. Watson ML, Kingsmore SF, Johnston GI, Siegelman MH, Le Beau MM, Lemons RS, Bora NS, Howard TA, Weissman IL, McEver RP: Genomic organization of the selectin family of leukocyte adhesion molecules on human and mouse chromosome 1. J Exp Med 172:263, 1990 [Abstract/Free Full Text]

9. Su Y, Brooks DG, Li L, Lepercq J, Trofatter JA, Ravetch JV, Lebo RV: Myelin protein zero gene mutated in Charcot-Marie-tooth type 1B patients. Proc Natl Acad Sci USA 90:10856, 1993 [Abstract/Free Full Text]

10. Bux J, Stein E, Bierling P, Fromont P, Clay M, Stroncek D, Santoso S: Characterization of a new alloantigen (SH) on the human neutrophil Fcgamma -receptor IIIb. Blood 89:1027, 1997 [Abstract/Free Full Text]

11. Koene HR, Kleijer M, Roos D, de Haas M, Von dem Borne AE: Fcgamma RIIIB gene duplication: Evidence for presence and expression of three distinct Fcgamma RIIIB genes in NA(1+,2+)SH(+) individuals. Blood 91:673, 1998 [Abstract/Free Full Text]

12. Wang DG, Fan JB, Siao CJ, Berno A, Young P, Sapolsky R, Ghandour G, Perkins N, Winchester E, Spencer J, Kruglyak L, Stein L, Hsie L, Topaloglou T, Hubbell E, Robinson E, Mittmann M, Morris MS, Shen N, Kilburn D, Rioux J, Nusbaum C, Rozen S, Hudson TJ, Lander ES: Large-scale identification, mapping, and genotyping of single-nucleotide polymorphisms in the human genome. Science 280:1077, 1998 [Abstract/Free Full Text]

13. Gorlach A, Lee PL, Roesler J, Hopkins PJ, Christensen B, Green ED, Chanock SJ, Curnutte JT: A p47-phox pseudogene carries the most common mutation causing p47-phox-deficient chronic granulomatous disease. J Clin Invest 100:1907, 1997 [Medline] [Order article via Infotrieve]

14. Warmerdam PA, van de Winkel JG, Vlug A, Westerdaal NA, Capel PJ: A single amino acid in the second Ig-like domain of the human Fc gamma receptor II is critical for human IgG2 binding. J Immunol 147:1338, 1991 [Abstract]

15. Tax WJ, Willems HW, Reekers PP, Capel PJ, Koene RA: Polymorphism in mitogenic effect of IgG1 monoclonal antibodies against T3 antigen on human T cells. Nature 304:445, 1983 [Medline] [Order article via Infotrieve]

16. Abo T, Tilden AB, Balch CM, Kumagai K, Troup GM, Cooper MD: Ethnic differences in the lymphocyte proliferative response induced by a murine IgG1 antibody, Leu-4, to the T3 molecule. J Exp Med 160:303, 1984 [Abstract/Free Full Text]

17. Clark MR, Clarkson SB, Ory PA, Stollman N, Goldstein IM: Molecular basis for a polymorphism involving Fc receptor II on human monocytes. J Immunol 143:1731, 1989 [Abstract]

18. Tate BJ, Witort E, McKenzie IF, Hogarth PM: Expression of the high responder/non-responder human Fc gamma RII. Analysis by PCR and transfection into FcR-COS cells. Immunol Cell Biol 70:79, 1992

19. Parren PW, Warmerdam PA, Boeije LC, Arts J, Westerdaal NA, Vlug A, Capel PJ, Aarden LA, van de Winkel JG: On the interaction of IgG subclasses with the low affinity Fc gamma RIIa (CD32) on human monocytes, neutrophils, and platelets. Analysis of a functional polymorphism to human IgG2. J Clin Invest 90:1537, 1992

20. Parren PW, Warmerdam PA, Boeije LC, Capel PJ, van de Winkel JG, Aarden LA: Characterization of IgG FcR-mediated proliferation of human T cells induced by mouse and human anti-CD3 monoclonal antibodies. Identification of a functional polymorphism to human IgG2 anti-CD3. J Immunol 148:695, 1992 [Abstract]

21. Ory PA, Clark MR, Kwoh EE, Clarkson SB, Goldstein IM: Sequences of complementary DNAs that encode the NA1 and NA2 forms of Fc receptor III on human neutrophils. J Clin Invest 84:1688, 1989

22. Ory PA, Goldstein IM, Kwoh EE, Clarkson SB: Characterization of polymorphic forms of Fc receptor III on human neutrophils. J Clin Invest 83:1676, 1989

23. Koene H, Kleijer M, Algra J, Roos D, von dem Borne A, de Haas M: Fc gamma RIIIa-158V/F polymorphism influences the binding of IgG by natural killer cell Fc gamma RIIIa, independently of the Fc gamma RIIIa-48L/R/H phenotype. Blood 90:1109, 1997 [Abstract/Free Full Text]

24. Wu J, Edberg J, Redecha P, Bansal V, Guyre P, Coleman K, Salmon J, Kimberly R: A novel polymorphism of FcgammaRIIIa (CD16) alters receptor function and predisposes to autoimmune disease. J Clin Invest 100:1059, 1997 [Medline] [Order article via Infotrieve]

25. de Haas M, Koene H, Kleijer M, de Vries E, Simsek S, van Tool M, Roos D, von dem Borne A: A triallelic Fc gamma receptor type IIIA polymorphism influences the binding of human IgG by NK cell Fc gamma RIIIa. J Immunol 156:2948, 1996 [Abstract]

26. Nagarajan S, Chesla S, Cobern L, Anderson P, Zhu C, Selvaraj P: Ligand binding and phagocytosis by CD16 (Fc gamma receptor III) isoforms. J Biol Chem 270:26762, 1995 [Abstract/Free Full Text]

27. Salmon JE, Edberg JC, Kimberly RP: Fc gamma receptor III on human neutrophils. Allelic variants have functionally distinct capacities. J Clin Invest 85:1287, 1990

28. Bredius RG, Fijen CA, De Haas M, Kuijper EJ, Weening RS, Van de Winkel JG, Out TA: Role of neutrophil Fc gamma RIIa (CD32) and Fc gamma RIIIb (CD16) polymorphic forms in phagocytosis of human IgG1- and IgG3-opsonized bacteria and erythrocytes. Immunology 83:624, 1994 [Medline] [Order article via Infotrieve]

29. Warmerdam PA, van den Herik-Oudijk IE, Parren PW, Westerdaal NA, van de Winkel JG, Capel PJ: Interaction of a human Fc gamma RIIb1 (CD32) isoform with murine and human IgG subclasses. Int Immunol 5:239, 1993 [Abstract/Free Full Text]

30. Van den Herik-Oudijk I, Westerdaal N, Henriquez N, Capel P, Van de Winkel J: Functional analysis of human Fc-gamma-receptor II (CDII) isoforms expressed in B lymphocytes. J Immunol 152:574, 1994 [Abstract]

31. Kobayashi T, Westerdaal NA, Miyazaki A, van der Pol WL, Suzuki T, Yoshie H, van de Winkel JG, Hara K: Relevance of immunoglobulin G Fc receptor polymorphism to recurrence of adult periodontitis in Japanese patients. Infect Immun 65:3556, 1997 [Abstract]

32. Raknes G, Skeie GO, Gilhus NE, Aadland S, Vedeler C: FcgammaRIIA and FcgammaRIIIB polymorphisms in myasthenia gravis. J Neuroimmunol 81:173, 1998 [Medline] [Order article via Infotrieve]

33. Foster CB, Lehrnbecher T, Mol F, Steinberg SM, Venzon DJ, Walsh TJ, Noack D, Rae J, Winkelstein J, Curnutte JT, Chanock SJ: Host defense molecule polymorphisms influence the risk for immune-mediated complications in chronic granulomatous disease. J Clin Invest 102:2146, 1998 [Medline] [Order article via Infotrieve]

34. Jiang X, Arepally G, Poncz M, McKenzie S: Rapid detection of the Fc gamma RIIA-H/R (131) ligand-binding polymorphism using an allele-specific restriction enzyme digestion (ASRED). J Immunol Methods 199:55, 1996 [Medline] [Order article via Infotrieve]

35. Hessner M, Curtis B, Endean D, Aster R: Determination of neutrophil antigen gene frequencies in five ethnic groups by polymerase chain reaction with sequence-specific primers. Transfusion 36:895, 1996 [Medline] [Order article via Infotrieve]

36. Fromont P, Bettaieb A, Skouri H, Floch C, Poulet E, Duedari N, Bierling P: Frequency of the polymorphonuclear neutrophil Fc gamma receptor III deficiency in the French population and its involvement in the development of neonatal alloimmune neutropenia. Blood 79:2131, 1992 [Abstract/Free Full Text]

37. Hessner MJ, Shivaram SM, Curtis BR, Dinauer DM, Endean DJ, Aster RH: Neutrophil antigen SH gene frequencies in six racial groups, determined by allele-specific polymerase chain reaction. Blood 92:16a, 1998 (abstr, suppl 1)

38. Botto M, Theodoridis E, Thompson EM, Beynon HL, Briggs D, Isenberg DA, Walport MJ, Davies KA: Fc gamma RIIa polymorphism in systemic lupus erythematosus (SLE): No association with disease. Clin Exp Immunol 104:264, 1996 [Medline] [Order article via Infotrieve]

39. Bachelot-Loza C, Saffroy R, Lasne D, Chatellier G, Aiach M, Rendu F: Importance of the FcgammaRIIa-Arg/His-131 polymorphism in heparin-induced thrombocytopenia diagnosis. Thromb Haemost 79:523, 1998 [Medline] [Order article via Infotrieve]

40. Manger K, Repp R, Spriewald BM, Rascu A, Geiger A, Wassmuth R, Westerdaal NA, Wentz B, Manger B, Kalden JR, van de Winkel JG: Fcgamma receptor IIa polymorphism in Caucasian patients with systemic lupus erythematosus: Association with clinical symptoms. Arthritis Rheum 41:1181, 1998 [Medline] [Order article via Infotrieve]

41. Edberg JC, Wainstein E, Wu J, Csernok E, Sneller MC, Hoffman GS, Keystone EC, Gross WL, Kimberly RP: Analysis of FcgammaRII gene polymorphisms in Wegener's granulomatosis. Exp Clin Immunogenet 14:183, 1997 [Medline] [Order article via Infotrieve]

42. Sanders LA, van de Winkel JG, Rijkers GT, Voorhorst-Ogink MM, de Haas M, Capel PJ, Zegers BJ: Fc gamma receptor Iia (CD32) heterogeneity in patients with recurrent bacterial respiratory infections. J Infect Dis 170:854, 1994 [Medline] [Order article via Infotrieve]

43. Platonov AE, Shipulin GA, Vershinina IV, Dankert J, van de Winkel JG, Kuijper EJ: Association of human Fc gamma RIIa (CD32) polymorphism with susceptibility to and severity of meningococcal disease. Clin Infect Dis 27:746, 1998 [Medline] [Order article via Infotrieve]

44. Arepally G, McKenzie SE, Jiang XM, Poncz M, Cines DB: Fc gamma RIIA H/R 131 polymorphism, subclass-specific IgG anti-heparin/platelet factor 4 antibodies and clinical course in patients with heparin-induced thrombocytopenia and thrombosis. Blood 89:370, 1997 [Abstract/Free Full Text]

45. Brandt JT, Isenhart CE, Osborne JM, Ahmed A, Anderson CL: On the role of platelet Fc gamma RIIa phenotype in heparin-induced thrombocytopenia. Thromb Haemost 74:1564, 1995 [Medline] [Order article via Infotrieve]

46. Horsewood P, Zyba S, Kelton JG: Role of the platelet FcRIIa polymorphism in idiopathic thrombocytopenia purpura (ITP). Blood 92:85b, 1998 (abstr, suppl 1)

47. Denomme G, Warkentin T, Horsewood P, Sheppard J, Warner M, Kelton J: Activation of platelets by sera containing IgG1 heparin-dependent antibodies: An explanation for the predominance of the Fc gamma RIIa "low responder" (his131) gene in patients with heparin-induced thrombocytopenia. J Lab Clin Med 130:278, 1997 [Medline] [Order article via Infotrieve]

48. Joutsi JL, Javela K, Partanen J, Kekomaki R: Genetic polymorphism H131R of Fcgamma receptor type IIA (Fcgamma RIIA) in a healthy Finnish population and in patients with or without platelt-associated IgG. Eur J Hematol 61:183, 1998 [Medline] [Order article via Infotrieve]

49. Duits AJ, Bootsma H, Derksen RH, Spronk PE, Kater L, Kallenberg CG, Capel PJ, Westerdaal NA, Spierenburg GT, Gmelig-Meyling FH: Skewed distribution of IgG Fc receptor IIa (CD32) polymorphism is associated with renal disease in systemic lupus erythematosus patients. Arthritis Rheum 38:1832, 1995 [Medline] [Order article via Infotrieve]

50. Smyth LJ, Snowden N, Carthy D, Papasteriades C, Hajeer A, Ollier WE: Fc gamma RIIa polymorphism in systemic lupus erythematosus. Ann Rheum Dis 56:744, 1997 [Abstract/Free Full Text]

51. Williams Y, Lynch S, McCann S, Smith O, Feighery C, Whelan A: Correlation of platelet Fc gammaRIIA polymorphism in refractory idiopathic (immune) thrombocytopenic purpura. Br J Haematol 101:779, 1998 [Medline] [Order article via Infotrieve]

52. Abadi J, Zhon Z, Dobroszycki J, Pirofski L: Fc gamma RIIa polymorphism in human immunodeficiency virus-infected children with invasive pneumococcal disease. Pediatr Res 42:259, 1997 [Medline] [Order article via Infotrieve]

53. Salmon JE, Ng S, Lisse J, Friedman AR, Reveille JD, Alarcon GS: Allelic variants of FcgammaRIIA may contribute to the high prevalence of nephritis in Mexican American lupus. Arthritis Rheum 40:S60, 1997 (abstr)

54. Reilly A, Norris C, Surrey S, Bruchak F, Rappaport E, Schwartz E, McKenzie S: Genetic diversity in human Fc receptor II for immunoglobulin G: Fc-gamma-receptor IIA ligand-binding polymorphism. Clin Diagn Lab Immunol 1:640, 1994 [Abstract/Free Full Text]

55. Caliz AR, Atsumi T, Khamashata MA, Amengual O, Hughes GRV: No correlation between FcgammaRII HR131 polymorphism and clinical manifestations of antiphospholipid syndrome (APS). Arthritis Rheum 40:S299, 1997 (abstr)

56. Osborne JM, Chacko GW, Brandt JT, Anderson CL: Ethnic variation in frequency of an allelic polymorphism of human Fc gamma RIIA determined with allele specific oligonucleotide probes. J Immunol Methods 173:207, 1994 [Medline] [Order article via Infotrieve]

57. Burgess J, Lindeman R, Chesterman C, Chong B: Single amino acid mutation of Fc gamma receptor is associated with the development of heparin-induced thrombocytopenia. Br J Haematol 91:761, 1995 [Medline] [Order article via Infotrieve]

58. Salmon JE, Millard S, Schachter LA, Arnett FC, Ginzler EM, Gourley MF, Ramsey-Goldman R, Peterson MG, Kimberly RP: Fc gamma RIIA alleles are heritable risk factors for lupus nephritis in African Americans. J Clin Invest 97:1348, 1996 [Medline] [Order article via Infotrieve]

59. Norris CF, Surrey S, Bunin GR, Schwartz E, Buchanan GR, McKenzie SE: Relationship between Fc receptor IIA polymorphism and infection in children with sickle cell disease. J Pediatr 128:813, 1996 [Medline] [Order article via Infotrieve]

60. Song YW, Han CW, Kang SW, Baek HJ, Lee EB, Shin CH, Hahn BH, Tsao BP: Abnormal distribution of Fcgamma IIa polymorphisms in Korean patients with systemic lupus erythematosus. Arthritis Rheumat 41:421, 1998 [Medline] [Order article via Infotrieve]

61. Koene HR, Kleijer M, Swaak AJ, Sullivan KE, Bijl M, Petri MA, Kallenberg CG, Roos D, van dem Borne AE, de Haas M: The Fc gammaRIIIA-158F allele is a risk factor for systemic lupus erythematosus. Arthritis Rheum 41:1813, 1998 [Medline] [Order article via Infotrieve]

62. Wainstein E, Edberg J, Csernok E, Sneller M, Hoffman G, Gross W, Salmon J, Kimberly R: Fcgamma IIIB alleles predict renal dysfunction in Wegener's granulomatosis (WG). Arthritis Rheum 39:S210, 1996 (abstr)

63. Salmon JE, Ng S, Sobel R, Simantov R, Lo SK, Furie R, Kaell A, Hamburger MI, Silverstein R, Sammaritano LR: FcgammaRIIA allele which binds IgG2 (FcRIIa-H131) is increased in patients with anticardiolipin antibodies and thrombosis. Arthritis Rheum 40:S300, 1997 (abstr)

64. Platonov AE, Kuijper EJ, Vershinina IV, Shipulin GA, Westerdaal N, Fijen CA, van de Winkel JG: Meningococcal disease and polymorphism of FcgammaRIIa (CD32) in late complement component-deficient individuals. Clin Exp Immunol 111:97, 1998 [Medline] [Order article via Infotrieve]

65. Hunter S, Indik ZK, Kim MK, Cauley MD, Park JG, Schreiber AD: Inhibition of Fcgamma receptor-mediated phagocytosis by a nonphagocytic Fcgamma receptor. Blood 91:1762, 1998 [Abstract/Free Full Text]

66. Carlsson L, Santoso S, Baurichter G, Kroll H, Papenberg S, Eichler P, Westerdaal N, Kiefel V, van der Winkel J, Greinacher A: Heparin-induced thrombocytopenia: New insights into the impact of Fcgamma RIIa-R-H131 polymorphism. Blood 92:1526, 1998 [Abstract/Free Full Text]

67. Long JC, Williams RC, Urbanek M: An E-M algorithm and testing strategy for multiple-locus haplotypes. Am J Hum Genet 56:799, 1995 [Medline] [Order article via Infotrieve]


© 1999 by The American Society of Hematology.
 
0006-4971/99/9412-0008$3.00/0

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
P. M. Cardarelli, M.-C. Moldovan-Loomis, B. Preston, A. Black, D. Passmore, T.-H. Chen, S. Chen, J. Liu, M. R. Kuhne, M. Srinivasan, et al.
In vitro and In vivo Characterization of MDX-1401 for Therapy of Malignant Lymphoma
Clin. Cancer Res., May 15, 2009; 15(10): 3376 - 3383.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Bruhns, B. Iannascoli, P. England, D. A. Mancardi, N. Fernandez, S. Jorieux, and M. Daeron
Specificity and affinity of human Fc{gamma} receptors and their polymorphic variants for human IgG subclasses
Blood, April 16, 2009; 113(16): 3716 - 3725.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
J. Lejeune, G. Thibault, D. Ternant, G. Cartron, H. Watier, and M. Ohresser
Evidence for Linkage Disequilibrium Between Fc{gamma}RIIIa-V158F and Fc{gamma}RIIa-H131R Polymorphisms in White Patients, and for an Fc{gamma}RIIIa-Restricted Influence on the Response to Therapeutic Antibodies
J. Clin. Oncol., November 20, 2008; 26(33): 5489 - 5491.
[Full Text] [PDF]


Home page
JCOHome page
A. Musolino, N. Naldi, B. Bortesi, D. Pezzuolo, M. Capelletti, G. Missale, D. Laccabue, A. Zerbini, R. Camisa, G. Bisagni, et al.
In Reply
J. Clin. Oncol., November 20, 2008; 26(33): 5491 - 5492.
[Full Text] [PDF]


Home page
JEMHome page
L. C. Willcocks, P. A. Lyons, M. R. Clatworthy, J. I. Robinson, W. Yang, S. A. Newland, V. Plagnol, N. N. McGovern, A. M. Condliffe, E. R. Chilvers, et al.
Copy number of FCGR3B, which is associated with systemic lupus erythematosus, correlates with protein expression and immune complex uptake
J. Exp. Med., July 7, 2008; 205(7): 1573 - 1582.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
A. Musolino, N. Naldi, B. Bortesi, D. Pezzuolo, M. Capelletti, G. Missale, D. Laccabue, A. Zerbini, R. Camisa, G. Bisagni, et al.
Immunoglobulin G Fragment C Receptor Polymorphisms and Clinical Efficacy of Trastuzumab-Based Therapy in Patients With HER-2/neu-Positive Metastatic Breast Cancer
J. Clin. Oncol., April 10, 2008; 26(11): 1789 - 1796.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. N. Forthal, G. Landucci, J. Bream, L. P. Jacobson, T. B. Phan, and B. Montoya
Fc{gamma}RIIa Genotype Predicts Progression of HIV Infection
J. Immunol., December 1, 2007; 179(11): 7916 - 7923.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
B. Z. Alizadeh, G. Valdigem, M. J.H. Coenen, A. Zhernakova, B. Franke, A. Monsuur, P. L.C.M. van Riel, P. Barrera, T. R.D.J. Radstake, B. O. Roep, et al.
Association analysis of functional variants of the FcgRIIa and FcgRIIIa genes with type 1 diabetes, celiac disease and rheumatoid arthritis
Hum. Mol. Genet., November 1, 2007; 16(21): 2552 - 2559.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Jafarshad, M. H. Dziegiel, R. Lundquist, L. K. Nielsen, S. Singh, and P. L. Druilhe
A Novel Antibody-Dependent Cellular Cytotoxicity Mechanism Involved in Defense against Malaria Requires Costimulation of Monocytes Fc{gamma}RII and Fc{gamma}RIII
J. Immunol., March 1, 2007; 178(5): 3099 - 3106.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. S. Wang, J. R. Cerhan, P. Hartge, S. Davis, W. Cozen, R. K. Severson, N. Chatterjee, M. Yeager, S. J. Chanock, and N. Rothman
Common Genetic Variants in Proinflammatory and Other Immunoregulatory Genes and Risk for Non-Hodgkin Lymphoma
Cancer Res., October 1, 2006; 66(19): 9771 - 9780.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
N.-K. V. Cheung, R. Sowers, A. J. Vickers, I. Y. Cheung, B. H. Kushner, and R. Gorlick
FCGR2A Polymorphism Is Correlated With Clinical Outcome After Immunotherapy of Neuroblastoma With Anti-GD2 Antibody and Granulocyte Macrophage Colony-Stimulating Factor
J. Clin. Oncol., June 20, 2006; 24(18): 2885 - 2890.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
E. E. Brown, M. D. Fallin, J. J. Goedert, R. Chen, D. Whitby, C. B. Foster, C. Lauria, A. J. Alberg, A. Messina, M. Montella, et al.
A Common Genetic Variant in FCGR3A-V158F and Risk of Kaposi Sarcoma Herpesvirus Infection and Classic Kaposi Sarcoma
Cancer Epidemiol. Biomarkers Prev., March 1, 2005; 14(3): 633 - 637.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. Niwa, S. Hatanaka, E. Shoji-Hosaka, M. Sakurada, Y. Kobayashi, A. Uehara, H. Yokoi, K. Nakamura, and K. Shitara
Enhancement of the Antibody-Dependent Cellular Cytotoxicity of Low-Fucose IgG1 Is Independent of Fc{gamma}RIIIa Functional Polymorphism
Clin. Cancer Res., September 15, 2004; 10(18): 6248 - 6255.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
W. L. Gluck, D. Hurst, A. Yuen, A. M. Levine, M. A. Dayton, J. P. Gockerman, J. Lucas, K. Denis-Mize, B. Tong, D. Navis, et al.
Phase I Studies of Interleukin (IL)-2 and Rituximab in B-Cell Non-Hodgkin's Lymphoma: IL-2 Mediated Natural Killer Cell Expansion Correlations with Clinical Response
Clin. Cancer Res., April 1, 2004; 10(7): 2253 - 2264.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
W.-K. Weng and R. Levy
Two Immunoglobulin G Fragment C Receptor Polymorphisms Independently Predict Response to Rituximab in Patients With Follicular Lymphoma
J. Clin. Oncol., November 1, 2003; 21(21): 3940 - 3947.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. Cartron, L. Dacheux, G. Salles, P. Solal-Celigny, P. Bardos, P. Colombat, and H. Watier
Therapeutic activity of humanized anti-CD20 monoclonal antibody and polymorphism in IgG Fc receptor Fcgamma RIIIa gene
Blood, February 1, 2002; 99(3): 754 - 758.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. A. Trikalinos, F. B. Karassa, and J. P. A. Ioannidis
Meta-analysis of the association between low-affinity Fcgamma receptor gene polymorphisms and hematologic and autoimmune diseases
Blood, September 1, 2001; 98(5): 1634 - 1636.
[Full Text] [PDF]


Home page
ASH Education BookHome page
O. W. Press, J. P. Leonard, B. Coiffier, R. Levy, and J. Timmerman
Immunotherapy of Non-Hodgkin's Lymphomas
Hematology, January 1, 2001; 2001(1): 221 - 240.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. M. Taylor, M. P. Reilly, A. D. Schreiber, P. Chien, J. R. Tuckosh, and S. E. McKenzie
Thrombosis and shock induced by activating antiplatelet antibodies in human Fcgamma RIIA transgenic mice: the interplay among antibody, spleen, and Fc receptor
Blood, December 15, 2000; 96(13): 4254 - 4260.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. L. nbecher, C. B. Foster, S. Zhu, D. Venzon, S. M. Steinberg, K. Wyvill, J. A. Metcalf, S. S. Cohen, J. Kovacs, R. Yarchoan, et al.
Variant genotypes of Fcgamma RIIIA influence the development of Kaposi's sarcoma in HIV-infected men
Blood, April 1, 2000; 95(7): 2386 - 2390.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. L. Shields, A. K. Namenuk, K. Hong, Y. G. Meng, J. Rae, J. Briggs, D. Xie, J. Lai, A. Stadlen, B. Li, et al.
High Resolution Mapping of the Binding Site on Human IgG1 for Fcgamma RI, Fcgamma RII, Fcgamma RIII, and FcRn and Design of IgG1 Variants with Improved Binding to the Fcgamma R
J. Biol. Chem., February 23, 2001; 276(9): 6591 - 6604.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lehrnbecher, T.
Right arrow Articles by Chanock, S. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lehrnbecher, T.
Right arrow Articles by Chanock, S. J.
Related Collections
Right arrow Immunobiology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1999 by American Society of Hematology         Online ISSN: 1528-0020