|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 12 (December 15), 1999:
pp. 4233-4246
The BCR/ABL Oncogene Alters the Chemotactic Response to
Stromal-Derived Factor-1
By
Ravi Salgia,
Elizabeth Quackenbush,
Jeffrey Lin,
Natalia Souchkova,
Martin Sattler,
Darren S. Ewaniuk,
Kevin M. Klucher,
George Q. Daley,
Stine K. Kraeft,
Robert Sackstein,
Edwin P. Alyea III,
Ulrich H. von Andrian,
Lan Bo Chen,
Jose-Carlos Gutierrez-Ramos,
Ann-Marie Pendergast, and
James D. Griffin
From the Department of Medical Oncology and Division of Hematologic
Oncology, Division of Cellular and Molecular Biology, Dana-Farber
Cancer Institute, Harvard Medical School, Boston, MA; Center for Blood
Research and Harvard Medical School, Boston, MA; The
Children's Hospital, Boston, MA; Whitehead Institute Biomedical
Research, Cambridge, MA; Department of Pharmacology and Cancer Biology,
Duke University Medical Center, Levine Science Research Center, Durham,
NC; Millennium Pharmaceuticals Inc, Cambridge, MA; and Department of
Medicine, Brigham and Women's Hospital/Massachusetts General Hospital,
Boston, MA.
 |
ABSTRACT |
The chemokine stromal-derived factor-1 (SDF-1) is a
chemoattractant for CD34+ progenitor cells, in vitro and
in vivo. The receptor for SDF-1, CXCR-4, is a 7 transmembrane domain
receptor, which is also a coreceptor for human immunodeficiency virus
(HIV). Here we show that transformation of hematopoietic cell lines by
BCR/ABL significantly impairs their response to SDF-1. Three
different hematopoietic cell lines, Ba/F3, 32Dcl3, and Mo7e, were found
to express CXCR-4 and to respond to SDF-1 with increased migration
in a transwell assay. In contrast, after transformation by the BCR/ABL
oncogene, the chemotactic response to SDF-1 was reduced in all 3 lines. This effect was directly due to BCR/ABL, because Ba/F3 cells, in
which the expression of BCR/ABL could be regulated by a
tetracycline-inducible promoter, also had reduced chemotaxis to
SDF-1 when BCR/ABL was induced. The reduced response to SDF-1 was
not due to an inability of BCR/ABL-transformed cell lines to migrate in
general, as spontaneous motility of BCR/ABL-transformed cells was
increased. In mice, injection of SDF-1 into the spleen resulted in a
transient accumulation of untransformed Ba/F3 cells, but not
Ba/F3.p210BCR/ABL cells administered simultaneously. The
mechanism may involve inhibition of CXCR-4 receptor function, because
in BCR/ABL-transformed cells, CXCR-4 receptors were expressed on the
cell surface, but SDF-1 calcium flux was inhibited. Because SDF-1
and CXCR-4 are felt to be involved in progenitor cell homing to marrow,
the abnormality decribed here could contribute to the homing and
retention defects typical of immature myeloid cells in chronic
myelogenous leukemia.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
CHRONIC MYELOGENOUS leukemia (CML) is a
myeloproliferative disorder caused by the BCR/ABL fusion oncogene. CML
is characterized by premature release of myeloid cells from the marrow
and massive accumulation of both mature and immature myeloid cells in
blood, spleen, and marrow.1 There is growing evidence to
suggest that the interaction of CML cells with the marrow
microenvironment is abnormal. Gordon et al2 showed in 1987 that CML progenitor cells had diminished capacity to adhere to stromal
cell layers. More recently, it was reported that CML cells have reduced
long-term adhesion to the extracellular matrix protein fibronectin, and this impairment was thought to be due to abnormal function of  1
integrins.3,4 p210BCR/ABL is partially
localized to the cytoskeleton, and we have previously shown that
several cytoskeletal proteins associated with integrin regulation, such
as paxillin, FAK, CRKL, and vinculin, are prominent substrates of the
BCR/ABL tyrosine kinase.5,6 The functions of these proteins
are altered by phosphorylation and/or direct interaction with
p210BCR/ABL, presumably contributing to the abnormal
integrin function in CML.3
The ability of CML cells to leave the marrow at an immature stage of
differentiation, circulate in high numbers in the blood, and accumulate
in the spleen indicates that events that normally regulate migration
and retention of hematopoietic progenitor cells are also defective. We
have previously shown that spontaneous motility of BCR/ABL-transformed
cells on fibronectin-coated surfaces is increased, and this prompted us
to ask if more specific migration and retention functions of CML
progenitor cells might also be abnormal.7
The events controlling homing of CD34+ cells to marrow and
the retention of normal immature myeloid cells in the marrow are not
well understood. Recently, however, the chemokine stromal-derived factor-1 (SDF-1), which is produced by marrow stromal cells, has
been shown to be a potent chemoattractant for human
CD34+ progenitor cells.8 SDF-1 is a
mem- ber of the (CXC) chemokine family and it has homology
to interleukin-8 (IL-8) and MIP-1.9 However, unlike
these chemokines, SDF-1 elicits transendothelial chemotaxis of human
CD34+ cells both in vitro and in vivo.8,10
SDF-111 and CXCR-412,13 null mutant
mice have profound defects in myeloid and lymphoid development,
further suggesting that this chemokine is important in regulating
hematopoietic cell migration.
In this report, we provide evidence that BCR/ABL transformation
inhibits migration of hematopoietic cells in response to SDF-1 in
vitro and in vivo. BCR/ABL did not affect expression of SDF-1 receptors, but directly inhibited signal transduction. This defect may
explain some of the homing and retention defects typical of immature
myeloid cells in CML.
| |
MATERIALS AND METHODS |
Cells and cell culture.
The murine hematopoietic cell lines Ba/F3 and 32Dcl3 (also identified
as 32D) were cultured at 37°C with 5% CO2 in
RPMI 1640 (Mediatech, Washington, DC) containing 10% (vol/vol) WEHI-3B
conditioned medium as a source of interleukin-3 and 10% (vol/vol)
fetal calf serum (FCS) (PAA Laboratories Inc, Newport Beach, CA). The
human megakaryoblastic cell line Mo7e was maintained in
Dulbecco's Modified Eagle's Medium (DMEM; Mediatech), 10 ng/mL
granulocyte-macrophage colony-stimulating factor (GM-CSF: Genetics
Institute, Cambridge, MA), and 20% (vol/vol) FCS at 37°C with
10% CO2. The BCR/ABL-expressing cell lines
Ba/F3.p210BCR/ABL, Ba/F3.p185BCR/ABL,
32D.p210BCR/ABL, 32D.p185BCR/ABL , and
Mo7e.p210BCR/ABL were generated by transfection
with the pGD vector containing the BCR/ABL cDNA, as previously
described.14 p185 and p210 are different forms of BCR/ABL.
BCR/ABL-containing cells were cultured in RPMI 1640 medium with 10%
FCS, but without any source of IL-3 or GM-CSF. A Ba/F3 cell line,
TonB210.1, with tetracycline-dependent BCR/ABL expression, was grown in
RPMI 1640 medium containing 10% WEHI-conditioned medium and 10%
FCS.15 For induction experiments of less than 5 hours,
cells were growth factor deprived for 18 hours in RPMI 1640 containing
0.5% bovine serum albumin (BSA). For induction experiments longer than
1 day, cells were grown in RPMI 1640 containing WEHI. The BCR/ABL
expression was induced by treatment with doxycycline (2 µg/mL) for 1 day.
Conditioned medium from the bone marrow-derived mouse stromal cell
line, MS-5, was used as one source of SDF-1.8 Once the
growing cells reached subconfluence, the medium was replaced with
serum-free medium (UltraCULTURE; Biowhittaker, Walkersville, MD), which
was collected after 2 days of culture and passed through a 0.45-mm
filter. Recombinant, purified human SDF-1 was purchased from R&D
Systems (Minneapolis, MN).
Confocal microscopy.
F-actin was visualized in fixed cells (1% paraformaldehyde in
phosphate-buffered saline [PBS]) using rhodamine phalloidin (Molecular Probes, Eugene, OR), as described.5 The focal
adhesion protein paxillin was visualized using indirect
immunofluorescence with the antipaxillin monoclonal antibody clone 5H11
(UBI; Lake Placid, NY), detected by a fluorescein isothiocyanate
(FITC)-conjugated goat antimouse antibody. Confocal image analysis was
performed using a Zeiss model LSM4 confocal laser scanning microscope
(Zeiss, Jena, Germany) equipped with an external
argon-krypton laser (488 nm and 568 nm). Optical sections of 512 × 512 pixels were digitally recorded within 2 seconds and
2× line-averaging. Images were printed with a Fujix Pictography
3000 printer (Fuji, Japan) using Adobe Photoshop software (Adobe
Systems, Mountain View, CA).
Scanning electron microscopy.
Cells grown in suspension were concentrated to 1 × 105 cells/mL, and the cells were either unstimulated or
stimulated with SDF-1. One drop of such suspension was placed onto a
plastic cover slip previously coated with 1% poly-L-lysine (Sigma, St. Louis, MO) in water. The coverslip was then allowed to stand in a small
Petri dish at room temperature for 15 to 30 minutes in order for the
cells to adhere to the slip. Fixative (1.5% glutaradehyde in 0.01 mol/L phosphate buffer, pH 7.4) was added to the petri dish to cover
the slip and the cells were fixed for 1 hour at 40°C. The coverslip
was then taken through graded alcohols and dried in a Ladd Critical
Point Dryer (Model 28000; Ladd Research Industries, Williston,
VT), coated with platinum in a polaron SEM coating system.
Samples were examined with a JEOL JSM-35 CF scanning electron
microscope at an accelerating voltage of 20 KV.
Calcium flux analysis.
Cells were resuspended and analyzed for calcium flux using fluorescent
indicator indo-1 AM (Molecular Probes), at a final concentration of 5 µg/mL at 37°C for 30 minutes. Cells were washed with PBS and
starved in RPMI 1640 media containing 10% FCS, 1% penicillin-streptomycin for 10 hours at 5 × 105/mL.
After starving in the absence of growth factors, 3 × 106 cells were treated with pertussis toxin (Sigma) at 100 ng/mL. Then the remaining cells were suspended in starvation media at 1 × 107 per mL. Indo-1 AM (1 mg/mL in DMSO) was added
to the resuspending cells, making the concentration 1:100, and the
cells were placed in the dark for 30 minutes. Afterwards, they were
washed and resuspended in starvation media at 5 × 105
per mL. Finally, 1 mL of resuspended cells was placed into a FACS
analysis tube. Samples were analyzed on an EPICS ELITE (Coulter Corporation, Miami, FL) flow cytometer equipped with an ultraviolet enhanced Argon Ion laser tuned to 351 to 363 nm (10nW output power.) The fluorescent emission of indo-1 AM loaded cells was detected by
measuring both the violet bound form (405 nm) and blue/green (525 nm)
unbound form of the dye in separate photomultiplier tubes (PMT). A
ratio parameter was created using the 405 nm PMT as the denominator and
the 525nm PMT as the numerator.
Recombinant SDF-1 was used at a concentration of 1 µg/mL, while
ionomycin (Sigma) was used at 5 µg/mL. The tube was then placed back
on the cytometer and reanalyzed for 3 minutes to detect any shift in
the ratio of 525 nm/405 nm fluorescence. Data was initially analyzed
using the Multigraph analysis program that is standard for the
instrument. Processed 2 parameter histograms portraying ratio
(ordinate) versus time (abscissa) were then subsequently analyzed for
degree of responsiveness using the Multitime Software program (Phoenix
Flow Systems) and plotted graphically as percent response versus time.
Adhesion assay.
Adhesion of hematopoietic cells (with and without BCR/ABL) was measured
on plastic plates that were uncoated, or coated with bovine serum
albumin (5µg/mL) or fibronectin (5µg/mL) (Becton Dickinson Labware,
Bedford, MA), as described previously.16
Time-lapse video microscopy.
Cells were cultured on fibronectin-coated tissue culture plates (Becton
Dickinson Labware) in a temperature and CO2 controlled chamber in their standard growth media and stimulated with either SDF-1 or supernatant from the MS-5 cell line (1:1).7 The
cells were examined using an Olympus IX70 inverted microscope (Olympus, Lake Success, NY), Omega temperature control
device (Therm-Omega-Tech, Warmington, PA), Optronics
Engineering DEI-750 3CCD digital video camera (Optronics,
Galeta, CA), and Sony SVT-S3100 time-lapse S-VHS video recorder (Sony,
Tokyo, Japan). For image presentation, video images were
captured and printed with the Sony Color Video Printer UP-5600MD.
Chemotaxis assay.
Chemotaxis assays were performed using the chemotaxis microplate system
(Neuro Probe, Inc, Cabin John, MD). Cells were incubated for 4 hours in
IL-3- and GM-CSF-deficient media at 37°C, resuspended in
serum-free medium, and rewarmed to 37°C for 20 minutes before loading. UltraCULTURE alone was used as a nega- tive control and SDF-1 was diluted to 100 ng/mL in UltraCULTURE medium. MS-5
supernatant was used undiluted. One × 105 cells (in
25 µL) were allowed to migrate for 3 hours at 37°C, and migrating
cells were resuspended in 200 µL of 1% formalin in
phosphate-buffered saline (PBS), then counted for 30 seconds on a flow
cytometer (Becton Dickinson, Mountain View, CA). The chemotactic index,
a measure of the specificity of migration, was determined by dividing:
(the number of cells migrating to chemokine)/(the number that migrated
to medium alone). For blocking studies, 50 µg/mL of anti-SDF-1
antibody (R&D Systems) was added to the chemokine-containing medium 30 minutes before initiation of chemotaxis.
Detection of CXCR-4 by immunoblotting and immunofluorescent
staining.
Immunoblots using the anti-CXCR-4 rabbit polyclonal antibody were
performed as previously described.17 For indirect
immunofluorescent staining, cells (1 × 106) were
washed and resuspended in PBS containing 0.1% bovine serum albumin and
0.1% sodium azide (staining buffer). The cells were incubated for 30 minutes at 4°C with mouse antihuman CXCR-4 (R&D Systems; 0.1 mg/mL
final concentration) or rabbit-antimouse-CXCR-4 (1:1000) polyclonal
antibody, washed 3 times in staining buffer, and incubated with
fluorescein isothiocyanate (FITC)-conjugated goat-antimouse or
goat-antirabbit antibody (30 minutes, 4°C). After 3 washes, the
stained cells were analyzed by FACS-sort flow cytometry using Cell
Quest software (Becton Dickinson).
Reverse transcription-polymerase chain reaction (RT-PCR).
One microgram of RNA was reverse transcribed using a Perkin Elmer
RT-PCR kit (Roche Molecular Systems, Inc, Branchburg, NJ). RT reactions
were brought to a final volume of 40 µL, and cycling conditions were
25°C × 10 minutes, 42°C × 1 hour, then 99°C × 5 minutes. Primer sequences for SDF-1 are:
(5')GACGGTAAACC- AGTCAG and (3')ACTGCCCTTGCATCTCCCCAC;
mouse CXCR-4: (5')GGCTGTAGAGCGAGTGTTGCC and
(3')GTAGAGGTTGACA- GTGTAGAT; and mouse -actin:
(5')TGGAATCCTGTGGCATCCATGAAAC and
(3')TAAAACGCAGC-TCAGTAACAGTCCG. PCR was conducted using 1 to 5 µL of the RT products in a final volume of 25 µL, for 30 cycles
(94°C, 1 minute; 54°C, 30 seconds; 72°C, 30 seconds).18
Homing assays.
Ba/F3 and Ba/F3.p210BCR/ABL cells were washed three times
in DMEM (Biowhittaker) containing 20 mmol/L HEPES and 1% FCS, pH 7.4. Cells were resuspended at 20 × 106/mL and then
incubated for 20 minutes with TRITC (30 µg/mL; Molecular Probes) or
Calcein-AM (200 nmol/L; Molecular Probes).19 Labeling was
performed for 10 minutes at 37°C and cells were mixed frequently during the incubation. Cells were then spun through an equal volume of
fresh FCS or 20% BSA at 1300 rpm for 10 minutes. Viability was checked
and cells were rewarmed at 37°C for 15 minutes before injection.
For homing experiments, C57BL/6 mice of both sexes were anesthetized by
intraperitoneal injection of physiological saline containing
ketamine-HCL (5 mg/mL) and xylazine (1 mg/mL) under Institutional
Review Board approved protocols.19 The left carotid artery
was cannulated with PE-10 polyethylene tubing to allow injection of
cells into the descending aorta. Just before cell injection, a left
flank incision was made and the exposed spleen was injected with 50 µL of PBS alone or PBS containing 1 µg of SDF-1. After suturing
the incision, equal amounts of labeled Ba/F3 and
Ba/F3.p210BCR/ABL cells were pooled for injection (total
volume of 0.5 mL, containing 107 cells). The cells were
injected slowly, over a 15 to 20 minute period, and the animals were
allowed to awaken. After 3 hours, the animals were sacrificed and
spleen, lungs, bone marrow, and peripheral blood (via cardiac puncture)
were harvested. Single-cell suspensions were prepared from minced
tissues by gently passing them through a 70µ nylon mesh. The
single-cell suspensions were separated on a Histopaque-1077 (Sigma)
gradient and the cell populations recovered at the gradient interface
were washed in DMEM, pelleted and fixed in 4% paraformaldehyde for
analysis on a FACScan flow cytometer (Becton Dickinson, San Jose, CA).
The residual red and green fluorescent cells present in the catheter
after injection were counted to determine the ratio of each cell line
in the input population. Between 5 to 10 × 105 cells
were analyzed for each tissue and fluorescent cells were quantitated
within a gated region whose borders were determined from the injected
pool. The percentages of gated cells recovered in each organ were
corrected for differences in the percentage of each labeled cell type
in the input population.
In vitro methylcellulose colony forming unit (CFU) assay.
Chemotaxis assays were performed using bone marrow (BM) cells harvested
from patients with untreated CML or from normal donors with IRB
approved protocol. Peripheral blood samples from patients with
untreated CML were also tested. Mononuclear cell populations were
obtained using Histopaque-1077, and the cells were washed 3 times at
4oC in UltraCULTURE medium. Immunofluorescent staining with
monoclonal antibodies to human CD34 (Pharmingen, San Diego, CA) and
CXCR-4 (R&D Systems) was done on selected samples. Chemotaxis assays were performed, as described above, using the Corning Costar Transwell assay (5 micron pore) and SDF-1 (100 ng/mL) or UltraCULTURE alone (control). Inserts were loaded with 100 µL containing 5 × 105 viable cells (input population) and the assay was
allowed to proceed for 3 hours at 37°C. Separate aliquots of input
cells (10, 20, and 60 µL) were also plated in methylcellulose to
determine the CFU-GM capacity of the input population.
The migratory cells (output population) were harvested, diluted with
UltraCULTURE, spun gently at 900 rpm for 10 minutes and the
supernatants were aspirated carefully. The cell pellets were resuspended in 700 µL of a cocktail containing GM-CSF (50 ng/mL). The
cocktail was prepared as described.8 An equal volume of methylcellulose was added to the tube, and the cells, GM-CSF cocktail, and methylcellulose were mixed using a 3 mL syringe and 16 gauge needle. Bubbles were allowed to dissipate and the mixture was plated
into 35 × 10 mm petri dishes. Colonies were counted after 7 days
in culture. Colonies were defined as containing greater than 50 cells
and clusters less than 50 cells. The total number of colonies and
clusters were scored by a blinded observer in 10 high power fields. The
percent CFU-GM were plotted as: (total number of colonies and clusters
obtained with the output population)/(the number of colonies and
clusters obtained with the input population) × 100. Colony counts
obtained with input cells were multiplied by the appropriate correction
factor to determine the total CFU-GM capacity of 100 µL (5 × 105) of input cells.
Detection of p70 S6 kinase by immunoblotting.
The murine Ba/F3 and Ba/F3.p210BCR/ABL cell lines were washed in the
absence of IL-3 and lysed in lysis buffer (20 mmol/L Tris pH 8.0, 150 mmol/L NaCl, 10% glycerol, 1% NP-40, 0.42% NaF) containing
inhibitors (10 µL of 100 µmol/L PMSF, 10 µL of 100 mmol/L
Na3VO4, 5 µL aprotinin (Sigma), and 2 µL of
10 mg/mL leupeptin). Whole cell lysates (25 µg) were separated by a
7.5% SDS-PAGE, and electrophoretically transferred to Immobilon PVDF
membrane (Millipore, Bedford, MA). The membrane was immunoblotted with the following rabbit polyclonal antibodies: phosphospecific p70 S6
kinase (Thr421/Ser424) antibody (1:1000, rabbit polyclonal; New England
Biolabs, Beverly, MA) and S6 kinase antibody (1:1000, rabbit
polyclonal; New England Biolabs).
| |
RESULTS |
Expression of CXCR-4 receptors in hematopoietic cell lines and their
BCR/ABL-transformed counterparts.
The expression of CXCR-4 and SDF-1 was determined by RT-PCR in the
IL-3-dependent murine cell lines Ba/F3 (pre-B) and 32D (myeloid),
before and after transformation to growth factor-independence by
BCR/ABL (Fig 1A). Expression of CXCR-4
messenger RNA (mRNA) was detected in all cell lines tested. In
addition, FACS analysis using a rabbit polyclonal antibody to murine
CXCR-4 showed surface expression of CXCR-4 receptors (Fig 1B). Using an
antihuman CXCR-4 antibody, surface expression of CXCR-4 was also found
to be equivalent in the megakaryoblastic cell lines Mo7e and
Mo7e.p210BCR/ABL (Fig 1B). SDF-1 expression was weakly
detected in K562 cell lines by RT-PCR but not in the 2 murine cell
lines. However, conditioned medium from K562 cells was unable to induce
cytoskeletal changes or migration of Ba/F3 cells (data not shown),
suggesting that there was no significant secretion of SDF-1. CXCR-4
was also detected by immunoblotting in 32D and Ba/F3 cells and their
BCR/ABL transformed counterparts using an antimurine CXCR-4 antibody
(Fig 1C), which has a very low cross-reactivity with human cell lines.
View larger version (25K):
[in this window]
[in a new window]
| Fig 1.
Analysis of SDF-1 mRNA and CXCR-4 expression in
murine and human cell lines with and without BCR/ABL. (A) The
expression of SDF-1 and CXCR-4 mRNA was evaluated by RT-PCR in the
murine pre-B cell line Ba/F3, the murine myeloid cell line 32D, and in
their BCR/ABL-transformed counterparts. The human erythroleukemia cell
line K562 was also evaluated. Primers for -actin were used to
equalize the amount of RT-products used. (B) Immunostaining with
antibodies to murine CXCR-4 was performed with the Ba/F3 and
Ba/F3.p210BCR/ABL cell lines (solid histogram). Background
staining was determined using a nonspecific isotype matched IgG (clear
histogram). Immunostaining with antibodies to human CXCR-4 was
performed with the human Mo7e, Mo7e.p210BCR/ABL
megakaryocytic, and K562 cell lines (solid histogram). Background
staining (clear histogram) was determined using a nonspecific isotype
matched IgG. (C) Expression of murine CXCR-4 by immunoblotting of
protein extracts prepared from Ba/F3, 32D, Mo7e, and their BCR/ABL
counterparts. The molecular weight marker of 45 kD is shown and CXCR-4
has an approximate molecular weight of 48 kD.
|
|
SDF-1 induces actin cytoskeleton changes in untransformed, but not
in BCR/ABL-transformed, hematopoietic cell lines.
Ba/F3 and Ba/F3.p210BCR/ABL cells were treated with
SDF-1 and examined for changes in cytoskeletal morphology and actin
content by confocal microscopy. SDF-1 increased the content of
F-actin in Ba/F3 cells and also induced a morphological change
characterized by polarization, increased lamellipodia, filopodia, and
uropod-like structures (Fig 2A). The focal
adhesion protein paxillin was detected in lamellipodia upon stimulation
with SDF-1. F-actin and paxillin both form punctate (podosome-like)
structures at sites of contact between the cell and the substratum in
the BCR/ABL transformed cells, and no changes were appreciated after
stimulation by SDF-1. Similar morphological changes were observed by
scanning electron microscopy (Fig 2B).
View larger version (39K):
[in this window]
[in a new window]
| Fig 2.
(A) Actin and paxillin staining, as visualized by
confocal microscopy, of untransformed and BCR/ABL-transformed
hematopoietic cells in response to SDF-1. Cells were fixed and
stained for actin using rhodamine-labeled phalloidin, and for paxillin
using indirect immunofluorescent staining with the antipaxillin
monoclonal antibody 5H11. Note the difference in shape and staining
pattern of actin and paxillin in response to SDF-1 of normal Ba/F3
cells. There is no change in shape or staining pattern in response to
SDF-1 for BCR/ABL-transformed Ba/F3 cells. The bar is 10 µm. (B)
Scanning electron microscopy of untransformed and BCR/ABL-transformed
hematopoietic cells in response to SDF-1. Ba/F3 cells and
BCR/ABL-transformed Ba/F3 cells were either unstimulated or stimulated
with SDF-1 and scanning electron micrographs were taken. Shown is
the ruffling of an untransformed Ba/F3 cell; BCR/ABL containing cells
had numerous extensions but there was no change in response to
SDF-1. The bar represents 1.0 U.
|
|
SDF-1 alters cell motility of untransformed hematopoietic cell
lines, but not BCR/ABL-transformed cell lines.
Because there is actin cytoskeleton rearrangement and altered adhesion
in response to SDF-1, we asked if SDF-1 also affects spontaneous
in vitro motility of untransformed and BCR/ABL-transformed cell lines.
Time-lapse video microscopy (TLVM) showed that unstimulated Ba/F3 cells
exhibited a round morphology with little movement on a
fibronectin-coated surface
(Fig 3). In
response to SDF-1, however, Ba/F3 cells underwent a dramatic
increase in spontaneous motility. BCR/ABL-transformed Ba/F3 cells, in
contrast, constitutively exhibited a high degree of spontaneous
motility in the absence of SDF-1. In contrast to untransformed
cells, these transformed cells did not further increase their
spontaneous motility in response to SDF-1. Similar results were
observed comparing 32D and the 32D.p210BCR/ABL cells (data
not shown).
View larger version (117116123113K):
[in this window]
[in a new window]
| Fig 3.
Time-lapse video microscopy of untransformed and BCR/ABL
transformed cells in response to SDF-1. As described in Materials
and Methods, Ba/F3 (A/B) and BCR/ABL-transformed Ba/F3 (C/D) cells were
visualized by time-lapse video microscopy, without (A/C) and with (B/D)
SDF-1. Ba/F3 cells have increased membrane ruffling, microspikes,
and formation of pseudopods in response to SDF-1. In contrast,
Ba/F3.p210BCR/ABL cells had enhanced cell motility (as
characterized by membrane ruffling, formation of pseudopods, formation
of filopodia, and formation of uropod structures) with or without
SDF-1.
|
|
BCR/ABL-transformed cell lines have a reduced chemotactic response to
SDF-1.
Using a transwell migration assay, the chemotactic index of Ba/F3, 32D,
Mo7e cells, and their BCR/ABL-transformed counterparts was determined
(Fig 4). Ba/F3 cells have a dramatic
chemotactic response to either supernatant harvested from the murine
bone marrow-derived stromal cell line MS-5 (as a source of SDF-1) or
recombi- nant SDF-1, whereas BCR/ABL-transformed cells (both p185
and p210 forms of BCR/ABL) are less responsive. Similar
results were obtained when comparing Mo7e cells and
Mo7e.p210BCR/ABL cells. Untransformed 32D cells did not
have a high chemotactic response to SDF-1, but again,
BCR/ABL-transformed 32D cells had an even lower response. Both the
percent migrating cells and the chemotactic index were reduced in
BCR/ABL-transformed cells (Fig 4C). Also, using a doxycycline-inducible
BCR/ABL cell line, TonB210.1,15 we found that activation of
BCR/ABL was associated with a reduced chemotactic response to SDF-1
(Fig 5). We found an average decrease of
2.9-fold in migration of doxycyline-induced BCR/ABL in the TonB210.1
cell line (n = 4). Uninduced TonB210.1 cells have a lower migratory
response to SDF-1 compared with Ba/F3 cells, possibly because these
cells express low levels of p210BCR/ABL even in the absence
of doxycycline induction (data not shown).
View larger version (33K):
[in this window]
[in a new window]
| Fig 4.
Chemotaxis of murine and human cell lines to SDF-1 and
MS-5 supernatant. Several cell lines were tested for their ability to
migrate in transwell assays in response to SDF-1 (100 ng/mL) and
MS-5 supernatant (undiluted). The number of cells that migrated to
SDF-1 or MS-5 was divided by the number of background cells (cells
that migrated to medium alone) to determine the chemotactic index, for
panels A, B, and D. In panel C, the percentage of migrating cells is
shown for comparison. In some columns, the standard deviations were too
small to be visualized. Similarly, the chemotactic index of transformed
K562 cells migrating to MS-5 supernatant and SDF-1 was
below 1.0. Standard er- ror bars for the cell lines
Ba/F3.p185BCR/ABL, Mo7e,
Mo7e.p210BCR/ABL, K562,
32D.p210BCR/ABL, and
32D.p185BCR/ABL are calculated from triplicate values
in single migration experiments, whereas the error bars for Ba/F3 and
Ba/F3.p210BCR/ABL cells were calculated from data obtained
in 6 and 4 migration experiments, respectively. In panel C, Ba/F3 cells
transformed with p210 were tested and data from 4 migration experiments
(2 per cell line) were pooled.
|
|
View larger version (13K):
[in this window]
[in a new window]
| Fig 5.
Doxycycline-induced expression of BCR/ABL in TonB210.1
cells impairs chemotaxis to SDF-1. The Ba/F3 cell line, TonB210.1,
which expresses BCR/ABL in the presence of doxycycline, was tested (n
= 4) for a chemotactic response to medium alone (Neg Ctrl), MS-5
supernatant, and SDF-1 (100 ng/mL) using a transwell assay system.
The open bars represent control cells (minus doxycycline) and solid
bars represent doxycycline-treated cells. Panel A shows the percentage
of migrating cells and panel B shows the chemotactic index.
|
|
To ensure that the response of hematopoietic cells to the MS-5
supernatant was due to SDF-1, we determined the chemotactic index in
the presence of an SDF-1 blocking antibody (Fig 4D). The chemotactic
response of Ba/F3 cells to MS-5 supernatant was nearly completely
abrogated by a blocking antibody, indicating that the chemotactic
response of these cells in the transwell assay was due to the SDF-1
present in the MS-5 supernatant.
When Mo7e and Ba/F3 cell lines were pretreated for 4 hours with
pertussis toxin (100 ng/mL), transwell migratory response to SDF-1
was markedly reduced (Mo7e: 47 % v 8 %; Ba/F3: 26% v 6%, without or with pertussis toxin, respectively).
Homing of untransformed and BCR/ABL-transformed cells in response to
SDF-1, in vivo.
To test the in vivo homing of cells to SDF-1, we injected SDF-1
(1 µg in 50 µL of PBS) or an equal volume of PBS into a subcapsular
site in the spleens of anesthetized C57Bl/6 mice, and then injected
Ba/F3 and Ba/F3.p210BCR/ABL cells intra-arterially. The
Ba/F3 and Ba/F3.p210BCR/ABL cells were
differentially-labeled with the fluorescent dyes, calcein-AM (green) or
TRITC (red), respectively. Two-color flow cytometry was then used to
quantitate these 2 populations in single-cell suspensions of different
organs harvested 3 hours later. Both dye combinations were tested, with
similar results found. Equal numbers of labeled wild-type and
transformed cells (5 × 106 of each) were mixed and
the pool was injected intra-arterially. After 3 hours, the spleen, bone
marrow, peripheral blood and lungs were harvested and single-cell
suspensions were prepared. There was a significant, 2.6 (± 1.0)-fold increase in the ratio of (Ba/F3: Ba/F3.p210BCR/ABL) cells found in the spleens of recipient
mice (n = 4) injected with recombinant SDF-1 (P < .05),
compared with mice injected with PBS (Fig
6). No significant difference in the ratio of wild-type to
BCR/ABL-transformed Ba/F3 cells was found in the peripheral blood,
lung, or bone marrow (data not shown). In 2 of 4 experiments, the ratio
of Ba/F3 to Ba/F3.p210BCR/ABL cells that homed to the
spleen in the presence of PBS alone was greater than 1.0, which may be
due to endogenous expression of SDF-1 by splenic
stroma.8 Further studies for homing experiments using
BCR/ABL and the various mutants of BCR/ABL would be useful.
View larger version (15K):
[in this window]
[in a new window]
| Fig 6.
Enhanced homing of Ba/F3 cells to the spleen in the
presence of SDF-1, in vivo. The splenic ratio of
differently-labeled, fluorescent Ba/F3 and
Ba/F3.p210BCR/ABL cells was determined 3 hours after
injection into mice. Recipient mice spleens were injected with PBS
( ) or recombinant SDF-1 (1µg;  ) immediately before infusion
of pooled cells. Ba/F3 cells homed more efficiently to the spleen than
Ba/F3.p210BCR/ABL cells in the presence of SDF-1
(P < .05). The lines connecting circles indicate paired mice
in 4 independent experiments.
|
|
The SDF-1 response of granulocytic and
macrophage-colony forming progenitors (CFU-GM) is reduced in CML
patient samples.
Using a transwell migration assay, we measured the total CFU-GM
capacity of SDF-1 responsive-BM progenitors isolated from 3 normal
donors and from 2 patients with untreated CML
(Fig 7). Four peripheral blood samples from
untreated CML patients were also tested. The results are presented as
the percentage of CFU-GM formed by the migrating cell population
compared to the total CFU-GM capacity of the input population (see
Materials and Methods). The mean corrected ratios (percent migration
minus background) obtained were 15.7 ± 3 for normal BM (n = 3), 5.5 for CML BM (n = 2), and 5.4 ± 3 for peripheral blood CML (n = 4)
samples.
View larger version (23K):
[in this window]
[in a new window]
| Fig 7.
SDF-1 responsiveness, measured by CFU-GM, is reduced
in CML patient samples. Chemotaxis assays were performed with
mononuclear cells isolated from normal BM, BM from CML patients, and
from peripheral blood samples from CML patients. CFU-GM are plotted as:
(total number of colonies and clusters obtained with the migratory
population)/(the number of colonies and clusters obtained with the
input population) × 100 (see Materials and Methods). The stippled and
solid bars represent CFU-GM formed by cells migrating to UltraCULTURE
alone (control) or to 100 ng/mL of SDF-1, respectively.
|
|
Overall, there is a significant, 2.7-fold decrease in the percentage of
CFU-GM migrating in response to SDF1 from CML patient samples
compared with normal donor BM (P < .01). This correlates well
with the altered SDF-1 responses seen in our in vivo homing and in
vitro transwell migration assays performed with cell lines. In selected
experiments, the mononuclear cells used for chemotaxis were
immunofluorescently stained with antibodies to CD34 and CXCR-4. The
percentages of double-positive cells in two CML peripheral blood
samples were 1.8% and 2.6%, compared with 0.7% in 1 normal BM.
Variability between CML samples may reflect differences in expression
of BCR/ABL or some other downstream signaling targets of BCR/ABL.
BCR/ABL reduces CXCR-4 signal transduction.
To assess the effects of BCR/ABL on CXCR4 signaling, we examined
mobilization of intracellular calcium in response to SDF-1 (100 ng/mL, Fig 8) in hematopoietic cell lines
before and after transformation by BCR/ABL. SDF-1 induced a rapid,
transient flux of intracellular calcium in wild-type Ba/F3 (panel A,
graph 2) and uninduced TonB210.1 cells (panel B, graph 2) but not in
BCR/ABL-expressing Ba/F3 cells (panel A, graph 2') or in the
doxycycline-treated TonB210.1 cells (panel B, graph 2'). Positive
responses to SDF-1 were blocked by preincubating the cell lines with
pertussis toxin (panels A and B, graphs 3). Similar results were
obtained in 32D and Mo7e cells before and after BCR/ABL transformation
(data not shown). BCR/ABL-transformation of hematopoietic cell lines
did not affect expression of CXCR-4 (Fig 1), but reduced
SDF-1-mediated calcium flux in each case.
View larger version (21K):
[in this window]
[in a new window]
| Fig 8.
Calcium flux analysis of untransformed and
BCR/ABL-transformed hematopoietic cells in response to SDF-1.
Analysis of calcium flux of Ba/F3 and BCR/ABL transformed Ba/F3
cells, as described in Materials and Methods. Ba/F3,
Ba/F3.p210BCR/ABL (panel A, graphs 1 and 1',
respectively), and TonB210.1 (with and without doxycycline, panel B,
graphs 1 and 1') had equal basal levels of calcium fluxes.
When SDF-1 (100 ng/mL) was added to Ba/F3 (A, graph 2) and
TonB210.1 (without doxycycline; B, graph 2), an increase flux of
calcium was observed. Unlike the wild-type Ba/F3 and uninduced
TonB210.1, the BCR/ABL-transformed cell line
Ba/F3.p210BCR/ABL (A, graph 2') and activated
BCR/ABL TonB210.1 (with doxycycline; B, graph 2') showed no
calcium flux in response to SDF-1. Similar to the baseline levels of
calcium fluxes of Ba/F3 and Ton B210.1, cells that were pretreated with
pertussis toxin lacked a response to SDF-1 (A, graph 3 and B, graph
3, respectively). As a positive control for the Ba/F3 and
Ba/F3.p210BCR/ABL cell lines (A, graphs 4 and 4',
respectively), we measured calcium fluxes in response to ionomycin (5 µg/mL). The arrow in each panel represents the time of addition of
SDF-1.
|
|
We have previously determined that S6 kinase is rapidly phosphorylated
in response to SDF-1 in Ba/F3 cells (R. Salgia et al, unpublished
observation). As shown in Fig 9, S6 kinase
is phosphorylated in response to SDF-1 in Ba/F3 cells and not
Ba/F3.p210 cells. Thus, BCR/ABL blocks a very proximal CXCR-4 signaling
event, calcium flux, and also blocks a downstream event,
phosphorylation of S6 kinase. We have also determined that there is
phosphorylation of paxillin in response to SDF-1 in Ba/F3 cells, but
not in Ba/F3.p210 cells (data not shown).
View larger version (28K):
[in this window]
[in a new window]
| Fig 9.
Phosphorylation status of p70 S6 kinase in response to
SDF-1. Immunoblot analysis of p70 S6 kinase phosphorylation of Ba/F3
and Ba/F3.p210 in response to SDF-1. SDF-1 induces serine
421/threonine 424 phosphorylation of p70 S6 kinase in normal Ba/F3
cells, but not in BCR/ABL-transformed cell lines. The same blot was
stripped and probed with anti-S6 kinase showing that the amount of p70
S6 kinase is equivalent in all lanes.
|
|
| |
DISCUSSION |
Chronic myelogenous leukemia is caused by the t(9,22)(q34.1;q11.21)
translocation that generates the BCR/ABL oncogene.20 p210BCR/ABL is an active tyrosine kinase, and this
increased kinase activity has been shown to be required for cell
transformation. For normal hematopoietic cells, migration of myeloid
cells from the marrow to the blood is tightly linked to
differentiation, and in the absence of inflammation or infection
myeloid cells stay in the marrow until they have fully matured to
neutrophils. In contrast, CML myeloid cells circulate in large numbers
in the blood at virtually all stages of differentiation, and it is
clear that one of the defining characteristics of this illness is the
uncoupling of differentiation from the ability to leave the
marrow.21 In a variety of model systems, transformation of
myeloid cells by BCR/ABL results in abnormal adhesion to the
extracellular matrix component fibronectin, growth factor independence,
decreased apoptosis, and cytoskeletal abnormalities (not in model
systems).1 It is likely that the effects of BCR/ABL on
cytoskeletal function, including altered adhesion and increased
motility, contribute to early marrow exit and the subsequent myeloproliferation.
Recently, the chemokine SDF-1 has generated considerable interest
because of its potential role in progenitor cell homing to the marrow
and in regulating marrow egress.22 In vitro, SDF-1 is
one of the few known cytokines that has chemotactic activity for
hematopoietic progenitor cells and, in vivo, ectopic injection of
SDF-1 can temporarily attract immature hematopoietic cells to the
injection site.8 Homozygous deletion of the SDF-1 gene results in a lack of myelopoiesis and lymphopoiesis in the developing fetal liver and marrow.11 It is not known if this is due to impaired migration of cells from one developing hematopoietic site to
another or to impaired expansion. More recently, it was shown that
homozygous deletion of CXCR-4 results in an identical phenotype.12,13 In addition, defects in vascularization,
cardiac septal development and cerebellar development were found. It is now believed that CXCR-4 is the primary physiological receptor for
SDF-1. CXCR-4 is expressed in the endothelium of developing blood
vessels within the embryo proper, and its absence results in a lack of
branching of the mesenteric vessels at day 13.5 of gestation. By day
16.5, hemorrhages and/or areas of congestion were found in the small
intestine of mutant embryos. Overall, the available evidence suggests
that SDF-1 and CXCR-4 play important roles in establishing and
maintaining cellular homeostasis in the marrow, and disruption of this
pathway can lead to aberrant homing and/or retention of progenitor cells.
In this study, we show that 3 nontransformed hematopoietic cell lines
express CXCR-4 and respond to SDF-1 with increased cell motility,
adhesion, and chemotaxis. In contrast, after BCR/ABL-transformation, the response to SDF-1 is significantly diminished. It would be quite
interesting to perform the same studies of transwell migration after
coating the membranes with other extracellular matrix components as
well as transendothelial and trans-stromal migration on the various
cells tested. There is decreased calcium flux in response to SDF-1
in BCR/ABL-transformed cells, suggesting that CXCR-4 signaling may be
blocked at a very proximal level. The decrease in calcium flux is
greater than the inhibition of chemotaxis in BCR/ABL-containing cells.
However, the association between calcium flux and chemotaxis is not
well understood because there are cells that migrate in response to
chemokines without a calcium flux. We show here that distal signaling
molecules such as S6 kinase involved in signal transduction by SDF-1
are also affected by BCR/ABL. The results presented here significantly
expand the range of cytoskeletal abnormalities already associated with CML.
BCR/ABL is partially localized to the cytoskeleton and phosphorylates
several cytoskeletal proteins, including paxillin, CRKL, vinculin, FAK,
and tensin. Primary CML cells and cell lines transformed by BCR/ABL
have altered adhesion to fibronectin and have abnormal adhesion to
stromal cells. These effects are believed to be related to abnormal
integrin function, and can be partially reversed by exposure to
-interferon.4 Furthermore, we have shown that CML cells
have increased spontaneous motility on fibronectin coated surfaces in
vitro, and an increased rate of ruffling and formation of
pseudopods.7 The cell motility of CML cells is strikingly increased with an increased adhesiveness to fibronectin. The increased cell motility may aid in the release of progenitors from the stroma. These results also suggest that BCR/ABL has profound effects on the
cytoskeleton. In the case of SDF-1, reduced response may be due to
both inhibition of specific signaling from the SDF-1 receptor and
more global defects in the cell's ability to regulate cytoskeletal functions.
In contrast to progenitor cells, neutrophils from CML patients have
relatively normal function and can clearly accumulate appropriately at
sites of inflammation or infection.23 However, the
expression of BCR/ABL protein in CML neutrophils is relatively low
compared with that in progenitor cells, and the ability to follow a
chemotactic gradient of formylated peptides, for example, may represent
a different biological event than after a SDF-1 gradient. In this
regard, it is interesting that CML neutrophils fail to respond to at
least 2 other chemokines, MIP-1 and MCP-1.24 These
effects are minimal or absent in CML progenitor cells.
MIP-1-mediated increases in cytosolic calcium levels have also been
shown to be abrogated by BCR/ABL.25 MIP-1 binds to a
different chemokine receptor than does SDF-1. MIP-1 null mutant
mice, however, do not have viability or bone marrow defects. The
results presented show that CXCR-4 is the second chemokine receptor
whose function is altered by BCR/ABL.
Recently, Lapidot et al26 presented data that SDF-1 and
CXCR-4 were required for bone marrow engraftment by human
CD34+ progenitor cells in NOD/SCID mice. They further
defined the phenotype of engrafting cells as
CD34+/CD38-/low /CXCR-4+, and
showed that stem-cell factor induced surface expression of CXCR-4 on
CD34+ cells. Integrins such as LFA-1, VLA-4, and VLA-5 were
also required for marrow homing.27
Additional studies suggest that SDF-1 is involved in retention of
B-lymphoid and granulocytic progenitors within normal mouse marrow.28 Ma et al28 reconstituted irradiated
wild-type mice with fetal liver cells from CXCR-4-deficient mice. They
found reduced numbers of granulocytes in BM, but elevated and less
mature myeloid cells in the periphery. These findings correlate well with the hypothesis that reduced responsiveness to SDF-1 contributes to the release of CML progenitors from the BM. Our results with CML
samples are unlikely to be due to diminished proliferative capacity of
CFU-GM progenitors, as CML progenitors have the same proliferative
capacity as normal progenitors.29
From our data we can generate a hypothesis to explain why CML cells
fail to be retained in the marrow, unlike normal cells, and thereby
circulate in high numbers in the blood and accumulate in other tissues.
SDF-1 is constitutively expressed by bone marrow stroma,30 where it may regulate the adherence of
progenitors to stromal layers by activating adhesion
molecules.31 Oncogenic transformation by BCR/ABL may then
accelerate proliferation, increase spontaneous motility, and reduce
long-term adhesiveness to stromal cells by reducing the number,
accessibility, or function of adhesion-related molecules, such as
CXCR-4. These changes may then aid progenitors in their exit from the
marrow as the cellularity increases. We also have preliminary evidence
that egress of cells from intact newborn murine femurs can occur, in
vitro, under the influence of distally located MS-5 adherent cells
(data not shown), suggesting that even in the absence of blood flow,
bone marrow cells are capable of releasing themselves from normal
intact stroma in response to a chemotactic gradient. In summary, the
defect in migration to SDF-1 may represent 1 step in the complex
pathway of events that are needed to transform cells by BCR/ABL and
result in CML. Also, because at least 2 chemokine receptors are now
shown to be inhibited by BCR/ABL, this suggests that BCR/ABL blocks a
signaling step common to general chemokine receptors.
| |
ACKNOWLEDGMENT |
The authors thank Ms Li Zhang and Dr Yuhui Xu of the Core EM Facility
at the Dana-Farber Cancer Institute for their help in scanning electron
microscopy. Also, we thank Herb Levine, FACS Core Facility, DFCI for
his help in calcium flux assays.
| |
FOOTNOTES |
Submitted January 25, 1999; accepted August 10, 1999.
R.S. and E.Q. contributed equally to this work.
Supported by National Institutes of Health Grants No. CA 75348 (R.S.),
DK 560654 (J.D.G.), Jose Carreras International Leukemia Foundation
fellowship FIJC-95/INT (M.S.), and the Pfizer Scholars Grant for new
faculty (E.Q.)
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address correspondence to Ravi Salgia, MD, PhD, Department
of Adult Oncology, Dana 530C, Dana-Farber Cancer Institute, 44 Binney
St, Boston, MA 02115; e-mail: ravi_salgia{at}dfci.harvard.edu.
| |
REFERENCES |
1.
Sattler M, Salgia R:
Dysregulation of hematopoietic growth factor signal transduction by the oncogene BCR/ABL.
Cytokine Growth Factor Rev
8:63, 1997
[Medline]
[Order article via Infotrieve]
2.
Gordon MY, Dowding CR, Riley GP, Goldman JM, Greaves MF:
Altered adhesive interactions with marrow stroma of haematopoietic progenitor cells in chronic myeloid leukaemia.
Nature
328:342, 1987
[Medline]
[Order article via Infotrieve]
3.
Verfaillie CM, McCarthy JB, McGlave PB:
Mechanisms underlying abnormal trafficking of malignant progenitors in chronic myelogenous leukemia.
J Clin Invest
90:1232, 1992
4.
Bhatia R, McCarthy J, Verfaillie C:
Interferon- restores normal 1 integrin-mediated inhibition of hematopoietic progenitor proliferation by the marrow microenvironment in chronic myelogenous leukemia.
Blood
87:3883, 1996
[Abstract/Free Full Text]
5.
Salgia R, Brunkhorst B, Pisick E, Li J-L, Lo SH, Chen LB, Griffin JD:
Increased tyrosine phosphorylation of focal adhesion proteins in myeloid cell lines expressing p210BCR/ABL.
Oncogene
11:1149, 1995
[Medline]
[Order article via Infotrieve]
6.
Salgia R, Uemura N, Okuda K, Li J-L, Pisick E, Sattler M, deJong R, Druker B, Heisterkamp N, Chen L, Groffen J, Griffin J:
CRKL links p210BCR/ABL with paxillin in chronic myelogenous leukemia cells.
J Biol Chem
270:29145, 1995
[Abstract/Free Full Text]
7.
Salgia R, Li J-L, Ewaniuk D, Pear W, Pisick E, Burky S, Ernst T, Sattler M, Chen L, Griffin J:
BCR/ABL induces multiple abnormalities of cytoskeletal function.
J Clin Invest
100:46, 1997
[Medline]
[Order article via Infotrieve]
8.
Aiuti A, Webb IJ, Bleul C, Springer T, Gutierrez-Ramos JC:
The chemokine SDF-1 is a chemoattractant for human CD34+ hematopoietic progenitor cells and provides a new mechanism to explain the mobilization of CD34+ progenitors to peripheral blood.
J Exp Med
185:111, 1997
[Abstract/Free Full Text]
9.
Nagasawa T, Nakajima T, Tachibana K, Iizasa H, Bleul CC, Yoshie O, Matsushima K, Yoshida N, Springer TA, Kishimoto T:
Molecular cloning and characterization of a murine pre-B-cell growth-stimulating factor/stromal cell-derived factor 1 receptor, a murine homolog of the human immunodeficiency virus 1 entry coreceptor fusin.
Proc Natl Acad Sci USA
93:14726, 1996
[Abstract/Free Full Text]
10.
Kim CH, Broxmeyer HE:
In vitro behavior of hematopoietic progenitor cells under the influence of chemoattractants: Stromal derived factor-1, steel factor, and the bone marrow enviroment.
Blood
91:100, 1998
[Abstract/Free Full Text]
11.
Nagasawa T, Hirota S, Tachibana K, Takakura N, Nishikawa S, Kitamura Y, Yoshida N, Kikutani H, Kishimoto T:
Defects of b-cell lymphopoiesis and bone-marrow myelopoiesis in mice lacking the cxc chemokine pbsf/sdf-1.
Nature
382:635, 1996
[Medline]
[Order article via Infotrieve]
12.
Tachibana K, Hirota S, Iizasa H, Yoshida H, Kawabata K, Kataoka Y, Kitamura Y, Matsushima K, Yoshida N, Nishikawa S, Kishimoto T, Nagasawa T:
The chemokine receptor CXCR4 is essential for vascularization of the gastrointestinal tract.
Nature
393:591, 1998
[Medline]
[Order article via Infotrieve]
13.
Zou YR, Kottmann AH, Kuroda M, Taniuchi I, Littman DR:
Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar development.
Nature
393:595, 1998
[Medline]
[Order article via Infotrieve]
14.
Matulonis U, Salgia R, Okuda K, Druker B, Griffin J:
Interleukin-3 and p210 BCR/ABL activate both unique and overlapping pathways of signal transduction in a factor-dependent myeloid cell line.
Exp Hematol
21:1460, 1993
[Medline]
[Order article via Infotrieve]
15.
Klucher K, Lopez D, Daley G:
Secondary mutation maintains the transformed state in BaF3 cells with inducible BCR/ABL expression.
Blood
91:3927, 1998
[Abstract/Free Full Text]
16.
Bazzoni G, Carlesso N, Griffin J, Hemler M:
BCR/ABL expression stimulates integrin function in hematopoietic cell lines.
J Clin Invest
98:521, 1996
[Medline]
[Order article via Infotrieve]
17.
Salgia R, Li J, Lo SH, Brunkhorst B, Kansas GS, Sobhany ES, Sun YP, Pisick E, Hallek M, Ernst T, Tantravahi R, Chen LB, Griffin JD:
Molecular cloning of human paxillin, a focal adhesion protein phosphorylated by p210(bcr/abl).
J Biol Chem
270:5039, 1995
[Abstract/Free Full Text]
18.
Quackenbush E, Wershil B, Aguirre V, Gutierrez-Ramos J-C:
Eotaxin modulates myelopoiesis and mast cell development from embryonic hematopoietic progenitors.
Blood
92:1, 1998
[Free Full Text]
19.
Stockton B, Cheng G, Manjunath N, Ardman B, von Andrian U:
Negative regulation of T cell homing by CD43.
Immunity
8:373, 1998
[Medline]
[Order article via Infotrieve]
20.
Chissoe SL, Bodenteich A, Wang YF, Wang YP, Burian D, Clifton SW, Crabtree J, Freeman A, Iyer K, Li JA, Ma YC, Mclaury HJ, Pan HQ, Sarhan OH, Toth S, Wang ZL, Zhang GZ, Heisterkamp N, Groffen J, Roe BA:
Sequence and analysis of the human abl gene, the bcr gene, and regions involved in the Philadelphia chromosomal translocation.
Genomics
27:67, 1995
[Medline]
[Order article via Infotrieve]
21.
Galbraith P, Abu-Zahra H:
Granulopoiesis in chronic granulocytic leukaemia.
Br J Hematol
22:135, 1972
[Medline]
[Order article via Infotrieve]
22.
Baggiolini M:
Chemokines and leukocyte traffic.
Nature
392:565, 1998
[Medline]
[Order article via Infotrieve]
23.
Cramer E, Auclair C, Hakim J:
Metabolic activity of phagocytosis granulocytes in chronic granulocytic leukemia.
Blood
50:93, 1977
[Abstract/Free Full Text]
24.
Eaves C, Cashman J, Wolpe S, Eaves A:
Unresponsiveness of primitive chronic myeloid leukemia cells to macrophage inflammatory protein 1 alpha, an inhibitor of primitive normal hematopoietic cells.
Proc Natl Acad Sci USA
90:12015, 1993
[Abstract/Free Full Text]
25.
Wark G, Heyworth C, Spooncer E, Czaplewski L, Francis J, Dexter T, Whetton A:
Abl protein kinase abrogates the response of multipotent haemopoietic cells to the growth inhibitor macrophage inflammatory protein-1 alpha.
Oncogene
16:1319, 1998
[Medline]
[Order article via Infotrieve]
26.
Lapidot T, Peled A, Petit I, Kollet O, Magid M, Ponomaryov T, Franitza S, Grabovsky V, Nagler A, Lider O, Alon R:
Ex-vivo expansion of migrating human CXCR4+-SCID repopulating cells by upregulation of surface CXCR-4 expression in response to stimulation with SCF or IL-6.
Blood
92:717a, 1998
(abstr, suppl 1)
27.
Lapidot T, Peled A, Petit I, Kollet O, Magid M, Ponomaryov T, Franitza S, Grabovsky V, Nagler A, Lider R, Alon R, Zipori D:
The chemokine SDF-1a and the cytokine SCF mediate CXCR-4 dependent homing of human CD34+/CD38- stem cells to the bone marrow of nod/scid mice.
Blood
92:504a, 1998
(abstr, suppl 1)
28.
Ma Q, Jones D, Springer T:
The chemokine receptor CXCR4 is required for the retention of B lineage and granulocytic precursors within the bone marrow microenvironment.
Immunity
10:1, 1999
[Medline]
[Order article via Infotrieve]
29.
Cannistra S:
Chronic myelogenous leukemia as a model for the genetic basis of cancer.
Hematol Oncol Clin North Am
4:337, 1990
[Medline]
[Order article via Infotrieve]
30.
Bleul CC, Fuhlbrigge RC, Casasnovas JM, Aiuti A, Springer TA:
A highly efficacious lymphocyte chemoattractant, stromal cell-derived factor 1 (SDF-1).
J Exp Med
184:1101, 1996
[Abstract/Free Full Text]
31.
Luster AD:
Chemokines-Chemotactic cytokines that mediate inflammation.
N Engl J Med
338:436, 1998
[Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
S. Mumprecht, C. Claus, C. Schurch, V. Pavelic, M. S. Matter, and A. F. Ochsenbein
Defective homing and impaired induction of cytotoxic T cells by BCR/ABL-expressing dendritic cells
Blood,
May 7, 2009;
113(19):
4681 - 4689.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W. Yu, X. Sun, N. Clough, E. Cobos, Y. Tao, and Z. Dai
Abi1 gene silencing by short hairpin RNA impairs Bcr-Abl-induced cell adhesion and migration in vitro and leukemogenesis in vivo
Carcinogenesis,
September 1, 2008;
29(9):
1717 - 1724.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y.-Y. Chen, M. Malik, B. E. Tomkowicz, R. G. Collman, and A. Ptasznik
BCR-ABL1 alters SDF-1{alpha}-mediated adhesive responses through the {beta}2 integrin LFA-1 in leukemia cells
Blood,
May 15, 2008;
111(10):
5182 - 5186.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Jin, Y. Tabe, S. Konoplev, Y. Xu, C. E. Leysath, H. Lu, S. Kimura, A. Ohsaka, M.-B. Rios, L. Calvert, et al.
CXCR4 up-regulation by imatinib induces chronic myelogenous leukemia (CML) cell migration to bone marrow stroma and promotes survival of quiescent CML cells
Mol. Cancer Ther.,
January 1, 2008;
7(1):
48 - 58.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Chu, L. Li, H. Singh, and R. Bhatia
BCR-Tyrosine 177 Plays an Essential Role in Ras and Akt Activation and in Human Hematopoietic Progenitor Transformation in Chronic Myelogenous Leukemia
Cancer Res.,
July 15, 2007;
67(14):
7045 - 7053.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Li, N. Clough, X. Sun, W. Yu, B. L. Abbott, C. J. Hogan, and Z. Dai
Bcr-Abl induces abnormal cytoskeleton remodeling, beta1 integrin clustering and increased cell adhesion to fibronectin through the Abl interactor 1 pathway
J. Cell Sci.,
April 15, 2007;
120(8):
1436 - 1446.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J.-F. Geay, D. Buet, Y. Zhang, A. Foudi, P. Jarrier, M. Berthebaud, A. G. Turhan, W. Vainchenker, and F. Louache
p210BCR-ABL inhibits SDF-1 Chemotactic Response via Alteration of CXCR4 Signaling and Down-regulation of CXCR4 Expression
Cancer Res.,
April 1, 2005;
65(7):
2676 - 2683.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. D. Unwin, D. W. Sternberg, Y. Lu, A. Pierce, D. G. Gilliland, and A. D. Whetton
Global Effects of BCR/ABL and TEL/PDGFR{beta} Expression on the Proteome and Phosphoproteome: IDENTIFICATION OF THE RHO PATHWAY AS A TARGET OF BCR/ABL
J. Biol. Chem.,
February 25, 2005;
280(8):
6316 - 6326.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Ramaraj, H. Singh, N. Niu, S. Chu, M. Holtz, J. K. Yee, and R. Bhatia
Effect of Mutational Inactivation of Tyrosine Kinase Activity on BCR/ABL-Induced Abnormalities in Cell Growth and Adhesion in Human Hematopoietic Progenitors
Cancer Res.,
August 1, 2004;
64(15):
5322 - 5331.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Kijima, G. Maulik, P. C. Ma, E. V. Tibaldi, R. E. Turner, B. Rollins, M. Sattler, B. E. Johnson, and R. Salgia
Regulation of Cellular Proliferation, Cytoskeletal Function, and Signal Transduction through CXCR4 and c-Kit in Small Cell Lung Cancer Cells
Cancer Res.,
November 1, 2002;
62(21):
6304 - 6311.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Ptasznik, E. Urbanowska, S. Chinta, M. A. Costa, B. A. Katz, M. A. Stanislaus, G. Demir, D. Linnekin, Z. K. Pan, and A. M. Gewirtz
Crosstalk Between BCR/ABL Oncoprotein and CXCR4 Signaling through a Src Family Kinase in Human Leukemia Cells
J. Exp. Med.,
September 2, 2002;
196(5):
667 - 678.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. K. Kassenbrock, S. Hunter, P. Garl, G. L. Johnson, and S. M. Anderson
Inhibition of Src Family Kinases Blocks Epidermal Growth Factor (EGF)-induced Activation of Akt, Phosphorylation of c-Cbl, and Ubiquitination of the EGF Receptor
J. Biol. Chem.,
July 5, 2002;
277(28):
24967 - 24975.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Fruehauf, K. Srbic, R. Seggewiss, J. Topaly, and A. D. Ho
Functional characterization of podia formation in normal and malignant hematopoietic cells
J. Leukoc. Biol.,
March 1, 2002;
71(3):
425 - 432.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Maulik, T. Kijima, P. C. Ma, S. K. Ghosh, J. Lin, G. I. Shapiro, E. Schaefer, E. Tibaldi, B. E. Johnson, and R. Salgia
Modulation of the c-Met/Hepatocyte Growth Factor Pathway in Small Cell Lung Cancer
Clin. Cancer Res.,
February 1, 2002;
8(2):
620 - 627.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Cashman, I. Clark-Lewis, A. Eaves, and C. Eaves
Stromal-derived factor 1 inhibits the cycling of very primitive human hematopoietic cells in vitro and in NOD/SCID mice
Blood,
February 1, 2002;
99(3):
792 - 799.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Balabanian, A. Foussat, L. Bouchet-Delbos, J. Couderc, R. Krzysiek, A. Amara, F. Baleux, A. Portier, P. Galanaud, and D. Emilie
Interleukin-10 modulates the sensitivity of peritoneal B lymphocytes to chemokines with opposite effects on stromal cell-derived factor-1 and B-lymphocyte chemoattractant
Blood,
January 15, 2002;
99(2):
427 - 436.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. C. Zhao, Y. Jiang, and C. M. Verfaillie
A model of human p210bcr/ABL-mediated chronic myelogenous leukemia by transduction of primary normal human CD34+ cells with a BCR/ABL-containing retroviral vector
Blood,
April 15, 2001;
97(8):
2406 - 2412.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Prosper and C. M. Verfaillie
Regulation of hematopoiesis through adhesion receptors
J. Leukoc. Biol.,
March 1, 2001;
69(3):
307 - 316.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
G. Venkatakrishnan, R. Salgia, and J. E. Groopman
Chemokine Receptors CXCR-1/2 Activate Mitogen-activated Protein Kinase via the Epidermal Growth Factor Receptor in Ovarian Cancer Cells
J. Biol. Chem.,
March 15, 2000;
275(10):
6868 - 6875.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. H. Kain and R. L. Klemke
Inhibition of Cell Migration by Abl Family Tyrosine Kinases through Uncoupling of Crk-CAS Complexes
J. Biol. Chem.,
May 4, 2001;
276(19):
16185 - 16192.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Z. Dai, P. Kerzic, W. G. Schroeder, and I. K. McNiece
Deletion of the Src Homology 3 Domain and C-terminal Proline-rich Sequences in Bcr-Abl Prevents Abl Interactor 2 Degradation and Spontaneous Cell Migration and Impairs Leukemogenesis
J. Biol. Chem.,
July 27, 2001;
276(31):
28954 - 28960.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION