|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 12 (December 15), 1999:
pp. 4255-4262
c-myb Transactivates the Human Cyclin A1 Promoter and Induces Cyclin
A1 Gene Expression
By
Carsten Müller,
Rong Yang,
Gregory Idos,
Nicola Tidow,
Sven Diederichs,
Olaf M. Koch,
Walter Verbeek,
Timothy P. Bender, and
H.
Phillip Koeffler
From the Division of Hematology/Oncology, Cedars-Sinai Research
Institute/UCLA School of Medicine, Los Angeles, CA; the Department of
Microbiology, University of Virginia, Charlottesville, VA; and the
Department of Hematology/Oncology, University of Muenster, Muenster,
Germany.
 |
ABSTRACT |
Cyclin A1 differs from other cyclins in its highly restricted
expression pattern. Besides its expression during spermatogenesis, cyclin A1 is also expressed in hematopoietic progenitor cells and in
acute myeloid leukemia. We investigated mechanisms that might
contribute to cyclin A1 expression in hematopoietic cells. Comparison
of cyclin A1 and cyclin A promoter activity in adherent and myeloid
leukemia cell lines showed that the cyclin A1 promoter is
preferentially active in myeloid cell lines. This preferential activity
was present in a small, 335-bp cyclin A1 promoter fragment that
contained several potential c-myb binding sites. Coexpression of a
c-myb expression vector with the cyclin A1 promoter constructs significantly increased the reporter activity in adherent CV-1 as well
as in myeloid U937 cells. Gel-shift assays demonstrated that c-myb
could bind to the cyclin A1 promoter at a binding site located near the
transcription start site. Site-directed mutagenesis of this site
decreased promoter transactivation by 50% in both KCL22 cells that
express high levels of c-myb and in CV-1 cells that were transfected
with c-myb. In addition, transfection of primary human embryonic
fibroblasts with a c-myb expression vector led to induction of the
endogenous cyclin A1 gene. Taken together, c-myb can directly
transactivate the promoter of cyclin A1, and c-myb might be involved in
the high-level expression of cyclin A1 observed in acute myeloid
leukemia. These findings suggest that c-myb induces
hematopoiesis-specific mechanisms of cell cycle regulation.
© 1999 by The American Society of Hematology.
 |
INTRODUCTION |
EXPRESSION OF THE human cyclin A1 gene is
restricted to very few tissues.1 Under physiological
conditions, the highest concentrations of cyclin A1 are found in testis
and lower levels are found in hematopoietic tissue.1 Very
high levels can also be detected in several leukemic cell lines and in
leukemic blast cells from the majority of patients with acute myeloid
leukemia.2 Cyclin A1 is thought to play an important role
in the first meiotic cell division in testis and impaired
spermatogenesis occurs in mice with cyclin A1 deletion.3
The relevance of cyclin A1 for the cell cycle in somatic cells is
unclear.4 However, we have recently demonstrated that
cyclin A1 associates with the retinoblastoma gene product (Rb) and
E2F-1 in leukemia cells in vivo and the interaction can change
functional properties of the involved proteins.5 The reason
for the high-level expression in leukemic blasts is as yet unknown. In
addition, the mechanisms that define the limited expression pattern in
vivo have not been elucidated.
The myb family of transcription factors regulates tissue-specific gene
expression in the hematopoietic system, as well as in the testis. The
v-myb oncogene causes myeloblastosis in chickens.6 The
human counterpart, c-myb, was cloned and has been demonstrated to play
an essential role in hematopoiesis.7-9 Acute myeloid leukemia is frequently associated with high levels of c-myb expression, and it has been suggested that c-myb might play a role in the pathogenesis of leukemia.10 However, the target genes for
c-myb in normal hematopoiesis and in leukemic cells are not yet clearly defined. In addition, why v-myb and deletional mutants of c-myb are
oncogenic in hematopoietic cells but not in other tissues is unknown.
During hematopoiesis, c-myb is expressed during the stages of
differentiation associated with high cellular proliferation, and it may
act at least partially by driving expression of genes involved in
regulation of the cell cycle. Binding sites for c-myb have been
demonstrated in several genes involved in hematopoiesis and cellular
proliferation (eg, Brandt et al11 and Ku et
al12), although it is unclear which ones are actual target
genes for c-myb in vivo.13 The cell cycle-dependent
phosphorylation of c-myb further links the protein to the cell cycle
machinery.14 Nevertheless, target genes of c-myb that are
myelo-specific and are linked to the cell cycle and proliferation
remain unknown. Recently, we cloned the promoter of the cyclin A1 gene
to elucidate the mechanisms of expression of this gene.15
We show here that the cyclin A1 promoter is preferentially active in
myeloid leukemia cell lines and is transactivated by c-myb. In
addition, forced expression of c-myb in human embryonic fibroblasts
induces the endogenous cyclin A1 gene. The high-level expression of
cyclin A1 in acute myeloid leukemia might be caused by c-myb, and these findings suggest a specific involvement of c-myb in the cell cycle of
hematopoietic cells.
 |
MATERIALS AND METHODS |
Constructs and plasmids.
The cloning of the cyclin A1 promoter and the generation of the cyclin
A1 promoter-luciferase constructs have been described previously.15 For generating the cyclin A
promoter-luciferase construct, a 452-bp fragment of the cyclin A
promoter was cloned into the Sac I and Xho I sites of
PGL3-Basic after Pfu-PCR amplification of KG-1 genomic DNA and
digestion of the product with Sac I and Xho I at the
internal sites of the cyclin A promoter. The PGL3-promoter plasmid
containing the enhancerless early SV40 promoter upstream of the firefly
luciferase gene, the CMV- -galactosidase, and the pRL-SV40 plasmid
were purchased from Promega (Madison, WI). The 2 c-myb expression
vectors that were used have been described in detail
elsewhere.16,17
Cell culture and transfection.
HeLa, CV-1, and PC3 cells were cultured in Dulbecco's modified
Eagle's medium (DMEM) supplemented with 10% fetal calf serum (FCS)
containing 100 U/mL penicillin and 100 µg/mL streptomycin. U937 and
KCL22 cells were grown in RPMI containing 10% FCS as well as
penicillin and streptomycin. Primary human embryonic fibroblasts were
obtained by amniocentesis and chorion villi biopsies for diagnostic
reasons and used for experimentation after conclusion of the diagnostic
procedures. Human embryonic fibroblasts were grown in RPMI medium
supplemented with 20% FCS, penicillin, and streptomycin. For HeLa
transfection, 5 × 105 cells were seeded into 60-mm
plates 16 hours before transfection. Transfection was performed using
lipofectAMINE (GIBCO, Life Technology, Grand Island, NY)
according to the manufacturer's protocol. Two micrograms of luciferase
reporter plasmid was transfected together with 300 ng of a CMV- -gal
expression vector that was used for standardization. Cells were
harvested and assayed for luciferase and -galactosidase activity
after 48 hours. PC3 and CV-1 cells were transfected using Superfect
following the protocol of the manufacturer. For PC3 cells, a total of
3.5 µg of DNA was transfected, with 2.5 µg being reporter plasmid
and 1 µg being CMV- -gal. In the c-myb coexpression experiments in
CV-1 cells, 0.5 µg of reporter and 1 µg of CMV- -gal expression
vector were used along with the indicated amount of c-myb expression
plasmid supplemented with empty expression vector to yield 6.5 µg of
total DNA. For analyses of c-myb transactivation effects on the mutant
cyclin A1 promoter construct in CV-1 cells, we used the Dual Luciferase
Assay system (Promega). A Renilla luciferase plasmid driven by a SV40
promoter (200 ng) was cotransfected with the indicated amounts of
luciferase reporter and expression constructs. The myeloid cell lines
were transfected by electroporation using a square wave electroporator (BTX-820). A total of 15 µg of DNA (10 µg luciferase reporter and 5 µg of CMV- -gal expression vector) was added to 8 × 106 cells in a total of 400 µL of DMEM containing 10%
FCS in a 4-mm cuvette. One pulse of 340 V was applied for 30 milliseconds on low-voltage setting. After electroporation, the
cuvettes were placed on ice for 10 minutes followed by the addition of
3 mL of DMEM containing 10% FCS. Cells were harvested 16 hours after electroporation. In the c-myb cotransfection experiments, a total of 5 µg of plasmid consisting of either the c-myb expression vector, an
empty expression vector, or a combination of both was added to the DNA
mixture. DNA for transfection experiments was quantified by
densitometry after linearization, gel electrophoresis, and ethidium
bromide staining. All experiments were performed in duplicate and were
independently performed at least 3 times. Data of luciferase assays are
shown as the mean ± SEM of 3 independent experiments.
Human embryonic fibroblasts (1 × 106) were seeded
into 100-mm cell culture dishes 1 day before transfection. Cells were
transfected with 2 µg of either the c-myb expression vector or
control vector supplemented with 200 ng of an enhanced green
fluorescent protein (EGFP)-expressing plasmid. The transfection was
performed using Effectene (Qiagen, Valencia, CA) according
to the recommendations of the manufacturer. After 48 hours, cells were
harvested by trypsination and transfected, EGFP-expressing cells were
enriched by fluorescent-activated cells sorting (FACS). As a control,
nontransfected (EGFP-negative) cells were sorted as well.
Reverse transcriptase-polymerase chain reaction
(RT-PCR) and Southern blotting.
RNA was prepared from the sorted human embryonic fibroblast populations
(~1 × 105 cells each) using Trizol (GIBCO, Life
Technology). The RNA samples were reverse transcribed using Superscript
II (GIBCO, Life Technology) and random hexamers following the
recommendations of the manufacturer. The cyclin A1 PCR was performed
for 28 cycles using primers 5'-CTCCTGTCTGGTGGGAGGA and
5'-CTGATCCAGAATAACACCTGA (382-bp fragment) and -actin (218-bp fragment) was amplified for 20 cycles using the primer pair:
5'-TACATGGCT GGGGTGTTGAA and 5'-AAGAGAGGCATCCTCACCCT.
PCR products were run on a 1.5% agarose gel and blotted on a
positively charged nylon membrane. After cross-linking, the blots were
hybridized with internal oligonucleotides for cyclin A1
(5'-AGAGTGGAGTTGTGCTGGCT) and -actin
(5'-ATCGAGCACGGCATCGTCAC). Both were labeled with digoxigenin
that was nonradioactively detected using digoxigenin antibodies coupled
to alkaline phosphatase (Boehringer Mannheim, Mannheim,
Germany). A subsequent chemiluminescence reaction
(CDP-Star; Tropix, Bedford, MA) was visualized on a film.
Northern blotting.
Expression of cyclin A1 in human tumor cell lines was analyzed by
Northern blotting as previously described using 10 µg of total RNA
and hybridization with a 32P-random labeled cyclin A1 cDNA
probe.1
Electrophoretic mobility shift assays.
Nuclear extracts from Cos-7 cells transfected with either c-myb or
empty expression vector were prepared as described.18 For
gel retardation experiments, 2 ng of 32P-labeled
double-stranded oligonucleotide containing a c-myb consensus binding
site (5'-GGGATGGCAGTTGGTGACTC) or the presumed myb binding sites
myb-1 (5'-CACTTGCCAGTTGTTCCGGAC), myb-2
(5'-GGCCACCTCTTAACCGCGATCCTCC), or myb-3
(5'-CGGCCCTGCCCAACCCTG CCCCGC) were incubated for 20 minutes
on ice with 5 µg of Cos-7 nuclear extract. The final reaction contained the following: 10 mmol/L Tris-HCl, pH 7.5, 5% glycerol, 1 mmol/L MgCl2, 0.5 mmol/L EDTA, 0.5 mmol/L dithiothreitol
(DTT), 100 mmol/L NaCl, and 0.4 µg poly
(dI-dC) poly(dI-dC). For competition experiments, 100 ng of
double-stranded oligonucleotide containing either the oligonucleotide
used for gel retardation (see above) or a nonspecific oligonucleotide
was preincubated for 15 minutes at room temperature with the nuclear
extracts before the addition of the labeled oligonucleotide. For
antibody experiments, 2 µg of monoclonal antibody against c-myb
(Upstate Biotechnology, Lake Placid, NY) or an isotype control antibody
was added for 30 minutes on ice before reactions were loaded on a
0.5× TBE/6% nondenaturing polyacrylamide gel and run for 2 hours
at 10 V/cm. Gels were dried and autoradiographed.
Site-directed mutagenesis.
Site-directed mutagenesis was performed according to the method from
Deng and Nickoloff19 with modifications as
described.15 All oligonucleotides used in these experiments
were 5' phosphorylated. The following oligonucleotides were used
(mutated bases underlined): myb site 1, GCACTTGCCAGAACTTCCGGACACA; myb site 2, GCCACCTCTTCTACGCGATCCTCC; and ets site 1, AACCGCGATCCGAAAGTGCACTT GC.
 |
RESULTS |
Cyclin A1 expression and promoter activity in cell lines.
The human cyclin A1 gene is expressed in a highly restricted number of
tissues in vivo and cyclin A1 expression in cell lines markedly differs
between myeloid and nonmyeloid cell lines.1 To analyze
further the differences in expression, we chose 4 human cell lines that
differed in the degree of cyclin A1 expression. Two were derived from
myeloid cells (U937 and KCL22) and 2 others were derived from solid
carcinomas (PC3 from prostate cancer and HeLa from cervical carcinoma).
Expression of cyclin A1 was analyzed by Northern blotting,
demonstrating that cyclin A1 expression was found in the hematopoietic
U937 and KCL22 cell lines, but expression was undetectable in the solid
tumor-derived PC3 and HeLa cells (Fig 1).

View larger version (69K):
[in this window]
[in a new window]
| Fig 1.
Expression of cyclin A1 in different cell lines.
Expression of human cyclin A1 mRNA in human tumor cell lines was
analyzed by Northern blotting of 10 µg of total RNA and hybridization
with a 32P-labeled cyclin A1-specific probe. The levels of
28S RNA show that equal amounts of RNA were loaded. HeLa (cervical
carcinoma) and PC3 (prostate cancer) cell lines were derived from solid
tumors, and U937 and Kcl22 were established from leukemic blasts.
|
|
To analyze whether differences in RNA levels could be related to
promoter activity, we transiently transfected the cyclin A1 promoter
into several myeloid and adherent cell lines
(Fig 2). Both cyclin A1 promoter luciferase
constructs ranging from 1299 to +145 and from 190 to +145
showed activity in all 4 cell lines (Fig 2). The reporter activity of
the shorter (335 bp) promoter fragment was always higher than the
activity of the longer fragment. In addition, the activity of the
cyclin A1 promoter was higher than that of the SV40 promoter (without
enhancer) in all 4 cell lines.

View larger version (27K):
[in this window]
[in a new window]
| Fig 2.
Reporter gene expression of different promoters in cell
lines from various tissues. Two fragments (1,444 and 335 bp) of the
cyclin A1 promoter, a 452-bp fragment of the cyclin A promoter, and the
enhancerless SV40 promoter were transfected into 4 cell lines derived
from myeloid cells (U937 and KCL22) or from solid carcinomas (PC3 and
HeLa). The cyclin A1 promoter is active in each cell line, and its
activity is inversely related to that of the cyclin A promoter. All
experiments were performed in duplicates and independently performed at
least 3 times.
|
|
The cyclin A promoter is tightly cell cycle regulated and is assumed to
be transactivated in all cycling mammalian cells. Activity of the
cyclin A promoter was detectable in all 4 cell lines, but the degree of
activity was inversely correlated with the cyclin A1 promoter activity.
Cyclin A promoter activity was higher in PC3 and HeLa cells and was
lower in the myeloid cell lines as compared with the cyclin A1 promoter
activity. Preferential activity of the cyclin A1 promoter in myeloid
cells (compared with the cyclin A promoter) was evident for both
promoter constructs. The inverse relationship between cyclin A and
cyclin A1 was also present at the RNA level in samples from patients
with acute myeloid leukemia.2 However, activity of the
cyclin A1 promoter by transient transfection was not limited to the
myeloid cell lines, but was also present in PC3 and HeLa cells. The
tissues from which these cell lines were derived expressed very low
levels of cyclin A1. An explanation could be that transcription factors
expressed in the cell lines, but not expressed in the normal tissue,
lead to aberrant promoter activity. One transcription factor expressed in a wide variety of cell lines is c-myb. Western blot analysis demonstrated expression of c-myb in all 4 cell lines as well as in
ML-1, another myeloid cell line that expresses high levels of cyclin A1
(Fig 3).1 The nonmyeloid cell
lines appeared to have only a high molecular weight form, whereas the
myeloid lines had both a high and a low molecular weight form. This may
reflect a phosphorylated and a nonphosphorylated myb protein.

View larger version (23K):
[in this window]
[in a new window]
| Fig 3.
Expression of c-myb in nuclear extracts of cell lines
from various tissues. Protein (10 µg) from nuclear extract of the
indicated cell lines was loaded in SDS sample buffer on a 7.5%
Tris-HCl gel. After blotting, c-myb was detected using a monoclonal
antibody (Upstate Biotechnology). Nuclear extract from Cos-7 cells
transfected with a c-myb expression vector served as a positive
control. A single band with a molecular weight of approximately 80 kD
was detected for the nonmyeloid cell lines (PC3 and HeLa), whereas
double bands were seen for the myeloid cell lines (U937 and KCL 22).
This might indicate differences in the phosphorylation status or the
presence of different splice variants.
|
|
Analysis of the cyclin A1 promoter sequence shows potential binding
sites for c-myb within the 335-bp fragment
(Fig 4). The finding of c-myb expression in
all 4 cell lines and the potential myb binding sites in the cyclin A1
promoter led to the hypothesis that c-myb could be involved in
transactivation of the cyclin A1 promoter.

View larger version (16K):
[in this window]
[in a new window]
| Fig 4.
Potential myb binding sites in the cyclin A1 promoter.
The 3 potential myb binding sites are shown along with the important
Sp1 binding sites and the transcription start sites (marked in bold).
|
|
c-myb transactivates and binds to the cyclin A1 promoter.
To analyze promoter transactivation by c-myb, a c-myb expression vector
was transfected along with the 335-bp cyclin A1 promoter construct into
CV-1 cells that do not express c-myb. A dose-dependent increase in
cyclin A1 promoter activity occurred (Fig
5). No increase in activity was observed when c-myb was cotransfected
with the empty reporter plasmid (data not shown). The same experiments were repeated using U937 myeloid cells, which express rather low levels
of c-myb. Again, c-myb clearly transactivated the promoter, with
maximal activity occurring when 3 µg of c-myb were cotransfected (Fig
5). These findings indicate that the cyclin A1 promoter can be
transactivated by c-myb in adherent as well as in myeloid cell lines.

View larger version (20K):
[in this window]
[in a new window]
| Fig 5.
Transactivation of the cyclin A1 promoter by c-myb.
Different amounts of c-myb were coexpressed with a cyclin A1 promoter
construct (335-bp fragment). Empty vector was used to reach the same
total amount of DNA in all experiments. The mean and standard error for
3 independent experiments are shown.
|
|
To analyze whether c-myb directly affected the cyclin A1 promoter, we
examined whether the c-myb protein bound the predicted myb binding
sites in the promoter region. Cos-7 cells were transfected with either
empty vector control or a c-myb expression vector. High expression of
c-myb was confirmed by Western blotting of nuclear extracts
(Fig 6A). Gel-shift experiments were
performed using these nuclear extracts and 32P-labeled
oligonucleotides constituting a myb consensus site and the different
myb-binding sites of the cyclin A1 promoter. The gel-shift binding
reaction with c-myb expressing nuclear extract led to the appearance of
a new band for the myb consensus site (Fig 6B). A band at a similar
position was obtained for the cyclin A1 promoter myb site at +2.
Specificity of the binding to the +2 site was confirmed using
competitor oligonucleotides and c-myb specific antibody (Fig 6B). In
contrast, only weak binding, which could not be confirmed to be c-myb,
was seen at the potential myb site at 27, and no specific
binding at the site at position 66 could be detected (data not
shown).


View larger version (7294K):
[in this window]
[in a new window]
| Fig 6.
Binding of c-myb to myb binding sites in the cyclin A1
promoter (EMSA). (A) Expression of c-myb in nuclear extracts of Cos-7
cells either transfected with empty vector (Cos) or with a c-myb
expression vector (Cos-myb). Western blot analysis was performed
similar to the experiment shown in Fig 3. (B) Binding of the different
nuclear extracts to a c-myb consensus binding site and to the cyclin A1
promoter myb binding site at position +2. The nuclear extract
containing c-myb protein led to a c-myb containing band at the
consensus site as well as at the cyclin A1 promoter myb site. This band
was successfully competed away by a 50-fold excess of the nonlabeled
oligonucleotide encompassing the cyclin A1 myb site but not by a
50-fold excess of a nonspecific oligonucleotide. Also, the addition of
2 µg of a murine isotype control antibody did not alter the
appearance of the band. However, an anti-c-myb antibody led to a
supershift of the band.
|
|
Mutations in a myb site decrease myb transactivation of the cyclin A1
promoter.
To test whether c-myb activation of the promoter was affected by
alteration of the myb binding sites, different sites were mutated and
the resulting constructs were transfected in KCL22 cells. These cells
showed the highest c-myb expression of all the cell lines (Fig 3).
Abrogation of the myb site at +2 clearly diminished promoter activity
by 50%, whereas a mutation at either 27 or of the ets site at
15 did not lead to a decrease in promoter activity
(Fig 7A). The myb site at +2 is close to
the transcriptional start site and the basepairs surrounding the
transcriptional start site could function as an Initiator (Inr). To
rule out that our observed effects of the mutation at +2 depended on
the loss of binding of the basal transcriptional machinery, we
transfected the mutated reporter construct together with either the
c-myb expression plasmid or an empty vector control into CV-1 cells and
compared the results with transfections using the wild-type promoter
plasmid (Fig 7B). The mutation at +2 led to a minor reduction in
promoter activity when transfected with the empty vector control. However, transactivation of the mutated reporter plasmid by c-myb was
reduced by more than 50%, indicating that c-myb can transactivate the
cyclin A1 promoter through this site. Other sites or indirect effects
may contribute to the cyclin A1 promoter activation, because the
mutation at +2 did not abolish the increase in promoter activity entirely.


View larger version (2122K):
[in this window]
[in a new window]
| Fig 7.
Effect of point mutations on the activity of the cyclin
A1 promoter. (A) After introducing mutations into potential
transcription factor binding sites of the cyclin A1 promoter (335-bp
fragment), luciferase constructs were transfected into KCL 22 cells
that express high levels of c-myb (Fig 3). Bars represent the mean and
SEM of at least 3 independent experiments. (B) The wild-type cyclin A1
reporter construct or the myb 1 site mutation of the cyclin A1 promoter
was cotransfected with either c-myb or empty vector into CV-1 cells.
These experiments were performed using the Dual Luciferase Assay system
and the pRL-SV40 vector for standardization.
|
|
c-myb can induce cyclin A1 expression in primary human fibroblasts.
To examine whether c-myb could regulate the endogenous cyclin A1 gene,
we transfected primary human embryonic fibroblasts with a c-myb
expression vector. An EGFP-expressing plasmid was cotransfected with
the c-myb expression vector at a ratio of 1:10, respectively.
Forty-eight hours later, the EGFP-expressing cells (~3% to 5%) were
enriched using flow cytometric cell sorting. RNA was extracted and
reverse transcribed before PCR was performed to analyze cyclin A1
expression in the different cell populations. As a negative control, we
also sorted and analyzed the nontransfected cell population
(Fig 8). As a second control, we used the
RNA derived from sorted human embryonic fibroblasts that were
transfected with an empty control vector instead of the c-myb
expression vector. No expression of cyclin A1 was detected in both of
the control cell populations. However, strong expression of cyclin A1
was observed in the c-myb-transfected cell population, indicating that
the exogenous c-myb expression had induced cyclin A1 expression (Fig
8).

View larger version (54K):
[in this window]
[in a new window]
| Fig 8.
c-myb induces endogenous cyclin A1 expression in human
embryonic fibroblasts (HEF). Primary human embryonic fibroblasts were
transfected, and after 48 hours, they were sorted by flow cytometry
using EGFP expression as a marker of transfection (see Materials and
Methods). HEF were transfected either with empty vector alone (HEF + vector) or with a c-myb expression vector (HEF + c-myb).
Nontransfected cells of the latter transfection were also sorted and
served as an additional control (HEF control). Finally, a sample with
ddH2O instead of RNA for the reverse transcription reaction
served as a negative control (negative control). After the PCR
reactions for cyclin A1 (28 cycles, 382 bp) and -actin (20 cycles,
210 bp), products were run on agarose gels, blotted, and hybridized
with digoxigenin-labeled internal oligonucleotides. Detection was
performed using antidigoxigenin antibody and a chemiluminescence
reaction. The digoxigenin-labeled marker VI (Boehringer Mannheim) was
run in parallel: 154, 220/234, 298, 394, 453, 517, 653, and 1,033 bp.
The 154-bp band of the marker is too weak to be seen on the -actin
blot.
|
|
 |
DISCUSSION |
The cyclin A1 gene differs from other human cyclin genes in several
ways. Cyclin A1 is not related to cellular proliferation and division
in general.1,4 But it is robustly expressed in testis and
moderately expressed in bone marrow, 2 tissues with an extraordinarily
high proliferative potential. Also, high-level expression is found in
myeloid leukemia cell lines and in blasts of patients with acute
myeloid leukemia.2 Cyclin A1 interacts with RB family
members and E2F in vivo.5 The reason for the prominent
expression of cyclin A1 in myeloid leukemia cells is unclear; the
cyclin A1 gene is not amplified in myeloid leukemia cell
lines.1
Recently, we cloned the promoter of the cyclin A1 gene and started to
analyze its promoter region.15 The cyclin A1 promoter is
TATA-less and starts transcription from a major site around 150 bp
upstream of the initiating ATG. A 335-bp cyclin A1 promoter fragment
( 190 to +145) showed the highest activity of all constructs upon
transient transfection into HeLa cells.15 This fragment contains several GC boxes (Sp1 sites), and promoter activity critically depends on 4 of these sites. The GC boxes are periodically repressed during the G1 phase of the cell cycle and play a major role in the cell
cycle regulation of promoter activity.15 After establishing the elements that are relevant for the basic activity of the promoter, we analyzed mechanisms that could provide insight into the high cyclin
A1 expression levels observed in acute myeloid leukemia. Transient
transfections of the cyclin A1 promoter constructs demonstrated promoter activity in each of the tested cell lines. Also, the construct
with the shorter cyclin A1 fragment ( 190 to +145) showed stronger activity than the longer fragment in all the cell lines. Interestingly, we detected an inverse correlation for the degree of
promoter activity between the cyclin A1 and the cyclin A promoter constructs in adherent and myeloid cell lines. The cyclin A1 promoter was particularly active in myeloid cells, whereas cyclin A promoter activity was strong in the nonmyeloid cell lines. In addition, we have
previously reported that RNA levels between cyclin A and cyclin A1 were
inversely correlated in samples from leukemia patients.2 Also, compared with the SV40 early promoter, the activity of the cyclin
A1 promoter constructs was especially high in the 2 myeloid cell lines
tested. This indicates that the cyclin A1 promoter is preferentially
active in myeloid cells. Nevertheless, the finding that the promoter
was active in all the cell lines was initially surprising given the
highly restricted expression pattern of cyclin A1 RNA in most
nonmyeloid cell types in vivo. Several genes, including transcription
factors that are tissue specific in the healthy organism, have been
shown to be consistently unregulated in a variety of cell lines. This
has long been known for c-myb, and Western blotting confirmed that
c-myb is expressed in all 4 human cell lines under investigation. This
and the presumed presence of several c-myb binding sites near the
transcriptional start site of cyclin A1 led us to analyze the role of
c-myb in transactivation of the cyclin A1 promoter.
Our data provide evidence that c-myb can transactivate the cyclin A1
promoter. The transactivation by c-myb leads to a strong increase in
cyclin A1 promoter activity in CV-1 cells that do not express c-myb. In
U937 cells, the transactivation of the cyclin A1 promoter by extrinsic
c-myb expression was approximately 3-fold compared with expression of
an empty expression vector. One of the reasons for the weaker
transactivation capacity of c-myb in U937 cells might be that U937
already expresses c-myb. Also, the full transactivation potential of
c-myb is usually reached in synergy with other transcription factors
such as c-ets or NFM.20 A potential c-ets site is present
at position 13 of the cyclin A1 promoter, but cotransfection of
c-myb with ets-2 did not lead to an increase in promoter
transactivation (data not shown), and mutations introduced into the
presumed ets binding site did not decrease cyclin A1 promoter activity
in KCL22 cells. In addition to transactivating the cyclin A1 promoter
in transient transfections, expression of c-myb in primary human
embryonic fibroblasts induced endogenous cyclin A1 mRNA, suggesting
that c-myb can regulate cyclin A1 expression in vivo.
The proto-oncoprotein c-myb plays an essential role in the
proliferation of hematopoietic cells. Knockout mice deficient of c-myb
die at day 14.5 of embryogenesis because of the failure of liver
hematopoiesis.21 A large body of evidence confirms that
c-myb has a crucial role in hematopoiesis, and its expression is high
in the proliferating fraction of normal bone marrow cells.7 It is also thought to play a role in the pathogenesis of acute myeloid
leukemia.22 Some of the genes induced by c-myb appear to be
rather specific for hematopoietic cells, whereas others are involved in
cell cycle regulation in general, providing a direct link between c-myb
expression and cell cycle progression. Cyclin A1 clearly falls into
both categories by its expression in myeloid cells and because it is a
member of the cell cycle machinery. The finding that c-myb
transactivates the cyclin A1 promoter could provide a link to
tissue-specific regulation of cell cycle events. In the G1 phase,
D-type cyclins integrate signals from cell surface signaling and
activated nuclear hormone receptors and drive the cell towards the G1/S
boundary.23 The D-type cyclins show tissue specificity and
their involvement in tissue specific tumors such as high expression of
cyclin D1 in some breast cancers shows the different roles that they
might have in distinct tissues.24 Much less is known about
tissue-specific influences on cell cycle progression beyond the G1/S
boundary. Our finding that c-myb directly transactivates the cyclin A1
promoter links the expression of myeloid-specific genes (eg, c-myb) to
tissue-specific cell cycle events that are not related to G1 cyclins.
This might imply that tissue-specific mechanisms play a role in cell
cycle regulation not only in the G0/G1 phase, but also in the S and
G2/M phases.
Transactivation by c-myb could explain why the cyclin A1 promoter
constructs are active in a variety of cell lines. However, it does not
explain the very low levels of cyclin A1 RNA found in some of these
cell lines (eg, PC3 and Hela). The Cyclin A1 promoter is highly GC rich
and shows a CpG island that reaches up to 70 bp upstream of the
transcription start site. We have started to analyze the potential role
of methylation in modulating cyclin A1 expression, and preliminary data
show that the cyclin A1 promoter is methylated in nonexpressing
adherent cell lines such as PC3 and HeLa (Müller et al,
manuscript submitted). Methylation and chromatin
remodeling are likely to influence cyclin A1 gene expression in vivo,
and studies have shown that the binding of c-myb to its binding sites
is prevented by CpG methylation.25
Taken together, we have found that the cyclin A1 promoter is
preferentially active in myeloid leukemia cell lines. The finding that
c-myb transactivates this promoter through a specific binding site
provides an important link between c-myb and cell cycle regulation in
hematopoietic cells. The exact role of cyclin A1 in the hematopoietic cell cycle and in the pathogenesis of acute myeloid leukemia awaits further analysis.
 |
ACKNOWLEDGMENT |
The authors are grateful to Dr Rhona Schreck for providing the human
embryonic fibroblasts.
 |
FOOTNOTES |
Submitted February 17, 1999; accepted August 13, 1999.
Supported by grants from the National Institutes of Health (NIH); by US
Defense Grants; by the Parker Hughes, C. and H. Koeffler Funds; and by
the Gladys Lichtenstein Trust. C.M. is recipient of a fellowship of the
German Research foundation (DFG). G.I. is supported by the Howard
Hughes Institute Undergraduate Program. H.P.K. holds the Mark Goodson
Chair in Oncology Research and is a member of the Jonson Cancer Center.
T.P.B.'s work is supported by NIH Grant No. GM55985.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Carsten Müller, MD, ICP-Labor,
Department of Hematology/Oncology, University of Münster,
Domagkstr. 3, 48149 Münster, Germany; e-mail:
muellerc{at}uni-muenster.de.
 |
REFERENCES |
1.
Yang R, Morosetti R, Koeffler HP:
Characterization of a second human cyclin A that is highly expressed in testis and in several leukemia cell lines.
Cancer Res
57:913, 1997
[Abstract/Free Full Text]
2.
Yang R, Nakamaki T, Lubbert M, Said J, Sakashita A, Freyaldenhoven BS, Spira S, Huynh V, Müller C, Koeffler HP:
Cyclin A1 is expressed in blasts of leukemic patients and during normal hematopoiesis.
Blood
93:2067, 1999
[Abstract/Free Full Text]
3.
Liu D, Matzuk MM, Sung WK, Guo Q, Wang P, Wolgemuth DJ:
Cyclin A1 is required for meiosis in the male mouse.
Nat Genet
20:377, 1998
[Medline]
[Order article via Infotrieve]
4.
Sweeney C, Murphy M, Kubelka M, Ravnik SE, Hawkins CF, Wolgemuth DJ, Carrington M:
A distinct cyclin A is expressed in germ cells in the mouse.
Development
122:53, 1996
[Abstract]
5.
Yang R, Müller C, Huynh V, Fung YK, Yee AS, Koeffler HP:
Functions of cyclin A1 in the cell cycle and its interactions with transcription factor E2F-1 and the Rb family of proteins.
Mol Cell Biol
19:2400, 1999
[Abstract/Free Full Text]
6.
Engelke U, Lipsick JS:
Transformation of myelomonocytic cells by the avian myeloblastosis virus is determined by the v-myb oncogene, not by the unique long terminal repeats of the virus.
J Virol
68:2752, 1994
[Abstract/Free Full Text]
7.
Golay J, Capucci A, Arsura M, Castellano M, Rizzo V, Introna M:
Expression of c-myb and B-myb, but not A-myb, correlates with proliferation in human hematopoietic cells.
Blood
77:149, 1991
[Abstract/Free Full Text]
8.
Calabretta B, Venturelli D, Gewirtz AM:
Functional significance of c-myb expression in normal and leukemic hematopoiesis.
Cancer Invest
11:191, 1993
[Medline]
[Order article via Infotrieve]
9.
Gewirtz AM, Calabretta B:
A c-myb antisense oligodeoxynucleotide inhibits normal human hematopoiesis in vitro.
Science
242:1303, 1988
[Abstract/Free Full Text]
10.
Gopal V, Hulette B, Li YQ, Kuvelkar R, Raza A, Larson R, Goldberg J, Tricot G, Bennett J, Preisler H:
c-myc and c-myb expression in acute myelogenous leukemia.
Leuk Res
16:1003, 1992
[Medline]
[Order article via Infotrieve]
11.
Brandt TL, Fraser DJ, Leal S, Halandras PM, Kroll AR, Kroll DJ:
c-Myb trans-activates the human DNA topoisomerase II alpha gene promoter.
J Biol Chem
272:6278, 1997
[Abstract/Free Full Text]
12.
Ku DH, Wen SC, Engelhard A, Nicolaides NC, Lipson KE, Marino TA, Calabretta B:
c-myb transactivates cdc2 expression via Myb binding sites in the 5'-flanking region of the human cdc2 gene.
J Biol Chem
268:2255, 1993
[Abstract/Free Full Text]
13.
Hogg A, Schirm S, Nakagoshi H, Bartley P, Ishii S, Bishop JM, Gonda TJ:
Inactivation of a c-Myb/estrogen receptor fusion protein in transformed primary cells leads to granulocyte/macrophage differentiation and down regulation of c-kit but not c-myc or cdc2.
Oncogene
15:2885, 1997
[Medline]
[Order article via Infotrieve]
14.
Luscher B, Eisenman RN:
Mitosis-specific phosphorylation of the nuclear oncoproteins Myc and Myb.
J Cell Biol
118:775, 1992
[Abstract/Free Full Text]
15.
Müller C, Yang R, Beck-von-Peccoz L, Idos G, Verbeek W, Koeffler HP:
GC boxes are required for cell cycle regulated activation of the cyclin A1 promoter. Cloning of the gene and characterization of the promoter region.
J Biol Chem
274:11220, 1999
[Abstract/Free Full Text]
16.
Williamson EA, Xu HN, Gombart AF, Verbeek W, Chumakov AM, Friedman AD, Koeffler HP:
Identification of transcriptional activation and repression domains in human CCAAT/enhancer-binding protein epsilon.
J Biol Chem
273:14796, 1998
[Abstract/Free Full Text]
17.
Miglarese MR, Richardson AF, Aziz N, Bender TP:
Differential regulation of c-myb-induced transcription activation by a phosphorylation site in the negative regulatory domain.
J Biol Chem
271:22697, 1998
[Abstract/Free Full Text]
18.
Chumakov AM, Miller CW, Chen DL, Koeffler HP:
Analysis of p53 transactivation through high-affinity binding sites.
Oncogene
8:3005, 1993
[Medline]
[Order article via Infotrieve]
19.
Deng WP, Nickoloff JA:
Site-directed mutagenesis of virtually any plasmid by eliminating a unique site.
Anal Biochem
200:81, 1992
[Medline]
[Order article via Infotrieve]
20.
Ness SA, Kowenz-Leutz E, Casini T, Graf T, Leutz A:
Myb and NF-M: Combinatorial activators of myeloid genes in heterologous cell types.
Genes Dev
7:749, 1993
[Abstract/Free Full Text]
21.
Mucenski ML, McLain K, Kier AB, Swerdlow SH, Schreiner CM, Miller TA, Pietryga DW, Scott WJ Jr, Potter SS:
A functional c-myb gene is required for normal murine fetal hepatic hematopoiesis.
Cell
65:677, 1991
[Medline]
[Order article via Infotrieve]
22.
Nason-Burchenal K, Wolff L:
Activation of c-myb is an early bone-marrow event in a murine model for acute promonocytic leukemia.
Proc Natl Acad Sci USA
90:1619, 1993
[Abstract/Free Full Text]
23.
Sherr CJ:
D-type cyclins.
Trends Biochem Sci
20:187, 1995
[Medline]
[Order article via Infotrieve]
24.
Gilett C, Fantl V, Smith R, Fisher C, Bartek J, Dickson C, Barnes D, Peters G:
Amplification and overexpression of cyclin D1 in breast cancer detected by immunohistochemical staining.
Cancer Res
54:1812, 1994
[Abstract/Free Full Text]
25.
Klempnauer KH:
Methylation-sensitive DNA binding by v-myb and c-myb proteins.
Oncogene
8:111, 1993
[Medline]
[Order article via Infotrieve]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. Restle, M. Farber, C. Baumann, M. Bohringer, K. H. Scheidtmann, C. Muller-Tidow, and L. Wiesmuller
Dissecting the role of p53 phosphorylation in homologous recombination provides new clues for gain-of-function mutants
Nucleic Acids Res.,
September 1, 2008;
36(16):
5362 - 5375.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-W. Jang, S.-j. Yang, A. Ehlen, S. Dong, H. Khoury, J. Chen, J. L. Persson, and K. Ye
Serine/Arginine Protein-Specific Kinase 2 Promotes Leukemia Cell Proliferation by Phosphorylating Acinus and Regulating Cyclin A1
Cancer Res.,
June 15, 2008;
68(12):
4559 - 4570.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Drabsch, H. Hugo, R. Zhang, D. H. Dowhan, Y. R. Miao, A. M. Gewirtz, S. C. Barry, R. G. Ramsay, and T. J. Gonda
Mechanism of and requirement for estrogen-regulated MYB expression in estrogen-receptor-positive breast cancer cells
PNAS,
August 21, 2007;
104(34):
13762 - 13767.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Afroze, A. M. Sadi, M. A. Momen, S. Gu, S. Heximer, and M. Husain
c-Myb-Dependent Inositol 1,4,5-Trisphosphate Receptor Type-1 Expression in Vascular Smooth Muscle Cells
Arterioscler. Thromb. Vasc. Biol.,
June 1, 2007;
27(6):
1305 - 1311.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Katabami, H. Donninger, F. Hommura, V. D. Leaner, I. Kinoshita, J. F. B. Chick, and M. J. Birrer
Cyclin A Is a c-Jun Target Gene and Is Necessary for c-Jun-induced Anchorage-independent Growth in RAT1a Cells
J. Biol. Chem.,
April 29, 2005;
280(17):
16728 - 16738.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Muller-Tidow, P. Ji, S. Diederichs, J. Potratz, N. Baumer, G. Kohler, T. Cauvet, C. Choudary, T. van der Meer, W.-Y. I. Chan, et al.
The Cyclin A1-CDK2 Complex Regulates DNA Double-Strand Break Repair
Mol. Cell. Biol.,
October 15, 2004;
24(20):
8917 - 8928.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. M. Lele and D. J. Wolgemuth
Distinct Regions of the Mouse Cyclin A1 Gene, Ccna1, Confer Male Germ-Cell Specific Expression and Enhancer Function
Biol Reprod,
October 1, 2004;
71(4):
1340 - 1347.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Araki, M. Ito, T. Soyano, R. Nishihama, and Y. Machida
Mitotic Cyclins Stimulate the Activity of c-Myb-like Factors for Transactivation of G2/M Phase-specific Genes in Tobacco
J. Biol. Chem.,
July 30, 2004;
279(31):
32979 - 32988.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Steffen, H. Serve, W. E. Berdel, S. Agrawal, B. Linggi, T. Buchner, S. W. Hiebert, and C. Muller-Tidow
Specific protein redirection as a transcriptional therapy approach for t(8;21) leukemia
PNAS,
July 8, 2003;
100(14):
8448 - 8453.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Cammenga, J. C. Mulloy, F. J. Berguido, D. MacGrogan, A. Viale, and S. D. Nimer
Induction of C/EBPalpha activity alters gene expression and differentiation of human CD34+ cells
Blood,
March 15, 2003;
101(6):
2206 - 2214.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Roudier, E. Fedorova, M. Lebris, P. Lecomte, J. Gyorgyey, D. Vaubert, G. Horvath, P. Abad, A. Kondorosi, and E. Kondorosi
The Medicago Species A2-Type Cyclin Is Auxin Regulated and Involved in Meristem Formation But Dispensable for Endoreduplication-Associated Developmental Programs
Plant Physiology,
March 1, 2003;
131(3):
1091 - 1103.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Luger, S. G. O'Brien, J. Ratajczak, M. Z. Ratajczak, R. Mick, E. A. Stadtmauer, P. C. Nowell, J. M. Goldman, and A. M. Gewirtz
Oligodeoxynucleotide-mediated inhibition of c-myb gene expression in autografted bone marrow: a pilot study
Blood,
February 15, 2002;
99(4):
1150 - 1158.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ito, S. Araki, S. Matsunaga, T. Itoh, R. Nishihama, Y. Machida, J. H. Doonan, and A. Watanabe
G2/M-Phase-Specific Transcription during the Plant Cell Cycle Is Mediated by c-Myb-Like Transcription Factors
PLANT CELL,
August 1, 2001;
13(8):
1891 - 1905.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Muller-Tidow, W. Wang, G. E. Idos, S. Diederichs, R. Yang, C. Readhead, W. E. Berdel, H. Serve, M. Saville, R. Watson, et al.
Cyclin A1 directly interacts with B-myb and cyclin A1/cdk2 phosphorylate B-myb at functionally important serine and threonine residues: tissue-specific regulation of B-myb function
Blood,
April 1, 2001;
97(7):
2091 - 2097.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Muller, R. Yang, D. J. Park, H. Serve, W. E. Berdel, and H. P. Koeffler
The aberrant fusion proteins PML-RARalpha and PLZF-RARalpha contribute to the overexpression of cyclin A1 in acute promyelocytic leukemia
Blood,
December 1, 2000;
96(12):
3894 - 3899.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Müller, C. Readhead, S. Diederichs, G. Idos, R. Yang, N. Tidow, H. Serve, W. E. Berdel, and H. P. Koeffler
Methylation of the Cyclin A1 Promoter Correlates with Gene Silencing in Somatic Cell Lines, while Tissue-Specific Expression of Cyclin A1 Is Methylation Independent
Mol. Cell. Biol.,
May 1, 2000;
20(9):
3316 - 3329.
[Abstract]
[Full Text]
|
 |
|
|
|