|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 12 (December 15), 1999:
pp. 4274-4281
Interferon Consensus Sequence Binding Protein and
Interferon Regulatory Factor-4/Pip Form a Complex That
Represses the Expression of the Interferon-Stimulated Gene-15 in
Macrophages
By
Frank Rosenbauer,
Jeffrey F. Waring,
John Foerster,
Marcus Wietstruk,
Dieter Philipp, and
Ivan Horak
From the Department of Molecular Genetics, Research Institute of
Molecular Pharmacology, and University Hospital Benjamin Franklin, Free
University of Berlin, Berlin, Germany.
 |
ABSTRACT |
Interferon consensus sequence binding protein (ICSBP), a
transcription factor of the interferon (IFN) regulatory factor (IRF) family, binds to the IFN-stimulated response element (ISRE) in the
regulatory region of IFNs and IFN-stimulated genes (ISG). To identify
target genes, which are deregulated by an ICSBP null-mutation in mice
(ICSBP /), we have analyzed transcription of an ISRE-bearing gene,
ISG15. We have found that although ISG15 expression is unchanged in B
cells, it is upregulated in macrophages from ICSBP/ mice. Three
factors, ICSBP, IRF-2, and IRF-4/Pip interact with the ISRE in B cells,
however only ICSBP and IRF-4/Pip were found to bind this sequence in
macrophages of wild-type mice. Although IRF-4 was considered to be a
lymphoid-specific factor, we provide evidence for its role in
macrophage gene regulation. Our results suggest that the formation of
cell-type-specific heteromeric complexes between individual IRFs plays
a crucial role in regulating IFN responses.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
TRANSCRIPTION FACTORS of the interferon
regulatory factor (IRF) family are interferon primary response genes
regulate expression of a broad spectrum of secondary response
genes.1,2 The best characterized members of
this family, IRF-1, IRF-2,3 interferon-stimulated gene
factor 3 (ISGF3) ,4 interferon consensus sequence binding
protein (ICSBP),5 and IRF-4/Pip6-8 contain a
variable C-terminal domain and a conserved N-terminal DNA-binding domain and bind to an element known as the ISRE (interferon-stimulated response element), which has a consensus sequence GAAANN.9 The ISRE motif is present in the regulatory regions of interferons and
of interferon secondary response genes, named also
interferon-stimulated genes (ISG). The biological function of the
majority of ISGs is not yet well understood.1,2 Recently,
ISG15 was shown to be an  / -interferon-induced cytokine, which
stimulates natural killer (NK) cell proliferation and
augments -interferon production in lymphocytes.10
ICSBP is known as a negative regulator of IFN and IFN-induced
genes.11 We recently generated ICSBP-deficient mice
(ICSBP/) by gene targeting. These mice are immunodeficient and
develop disease symptoms similar to human chronic myelogenous leukemia (CML).12,13 The main alterations compared with wild-type
mice are higher counts of myeloid and B-lymphoid cells and an enhanced number of immature cells in the periphery and in hematopoietic organs.
Whether ICSBP also plays a role in human CML is not yet known.
Interestingly however, a lack or strongly reduced expression of ICSBP
was found in 79% of CML and 66% of AML patients.14
A critical role of ICSBP in macrophage-mediated host defense was
documented by a high sensitivity of ICSBP/ mice to
various pathogens.13,15,16 Thus, ICSBP seems to play 2 distinct roles, 1 during development of hematopoietic cells and a
second in regulating immune response. ICSBP might modulate gene
transcription by a direct binding to regulatory DNA sequences or by its
interaction with other transcription factors. In vitro, it has
been shown that ICSBP interacts with 2 other mem- bers of the
IRF family, IRF-1 and IRF-2,11 as well as with the ets
family factor PU.1.6 Similar to ICSBP, PU.1 has also been
shown to be crucial for early hematolymphoid development.17
In contrast to the ubiquitous expression of IRF-1 and IRF-2, the
expression of ICSBP and IRF-4/Pip is more restricted. ICSBP is
expressed in monocytic and lymphoid cells.9 The expression of the IRF-4/Pip gene was reported to be predominantly in B lymphocytes and only weakly in T cells.8,18 Of the IRF family members, IRF-4/Pip is the most closely related to ICSBP by sequence homology. Interestingly, both ICSBP and IRF-4/Pip bind only weakly to the ISRE
and only in the presence of other DNA binding proteins. IRF-4/Pip was
initially recognized as part of a ternary complex between PU.1 and a
domain of the immunoglobulin light chain enhancer.18,19 In
conjunction with PU.1, IRF-4/Pip specifically stimulates transcription of immunoglobulin light chains.20
In contrast to previously published results, we show here that
IRF-4/Pip is not only a lymphoid-restricted factor, but is also
expressed in macrophages. Furthermore, we provide evidence that in both
macrophages and B cells, IRF-4/Pip forms a complex with ICSBP, which
binds to the ISRE sequence. This complex negatively regulates the
expression of an IFN-inducible gene, ISG15, in a cell-specific manner.
| |
MATERIALS AND METHODS |
Mice and cells.
ICSBP mutant mice were generated as described.12 All
experiments were performed with 3-month old homozygous and
wild-type mice on a C57Bl/6 X 129/Sv F2 background. Peritoneal wash out cells were harvested from mice injected 4 days previously with thioglycollate medium.16 The cell suspension was allowed to adhere to plastic overnight in complete RPMI 1640 medium (10% fetal
calf serum, 1.5 mmol/L L-glutamine, 100 U/mL penicillin/streptomycin, nonessential amino acids (GIBCO-BRL, Gaithersburg, MD),
and 50 mmol/L 2-mercaptoethanol) at 37°C in 5% CO2,
and nonadherent cells were removed before further use. The macrophages
used in our preparations were checked for B-cell or other cell
contamination, and they were confirmed to be composed of over 95%
macrophages with no detectable lymphocytes. CD19+B
lymphocytes were isolated from mouse spleens using magnetic analyzed
cell sorting (MACS) as described.14 The K562 and A 20.2j
cell lines were maintained in complete RPMI 1640 medium.
Antibodies.
Generation of ICSBP antiserum (designated S 183): the peptide
ECGRSEIEELIKEPS corresponding to residues 137-151 of murine ICSBP (no
homology to any known IRF family member) was cysteine-conjugated to
keyhole limpet hemocyanin and injected into rabbits followed by booster
immunizations. Rabbits were bled sequentially and sera assayed for
specific Ig via Western blot. High-titer serum obtained 14 days after
the second boost was used in a routine immunoblot at a 1:2,000
dilution. The antiserum was affinity-purified by chromatography on
antigenic peptide immobilized to Sulfolink (Pierce, Rockford,
IL) according to the instructions of the manufacturer. Column-bound antibody was washed sequentially in buffers containing 150 mmol/L NaCl at pH 7.5, 6.0, and 5.0, and eluted at pH 3.0, followed by
immediate realkalinization. Specificity was documented by competition
with antigenic peptide. No ICSBP was detected in ICSBP/
cells. Antibodies against IRF-1, IRF-2, IRF-4/Pip, and horseradish-conjugated antigoat IgG were purchased from Santa Cruz
Biotechnology (Santa Cruz, CA).
Synthetic oligonucleotides.
The sequence of the ISG15 ISRE oligonucleotide used in binding assays
is 5'GATCCTCGGGAAAGGGAAACCGAAACTGAAGCC3'.11 The
sequences for the mutated ISRE oligonucleotides are:
M1-5'GATCCTCGGGAAAGGCGTACCGAAACTGAAGCC3'; M2-5'GATCCTCGGCGTAGGCGTACCGAAACTGAAGCC3';
M3-5'GATCCTCGGCGTAGGCGTACCCGTACTGAAGCC3'; M4-5'GATCCTCGGCGTAGGGAAACCGAAA- CTGAAGCC3';
M5-5'GATCCTCGGGAAAGGGAAACCCGTACTGAAGCC3'; GG1-5'GATCCTCGGGAAAGGGGGAAACCGAAACTGAAGCC3';
GG2-5'GATCCTCGGGAAAGGGAAACCGGGA- AACTGAAGCG3'.
The sequences of the murine IRF-4/Pip primers used for reverse
transcriptase-polymerase chain reaction (RT-PCR) are: upper strand-5'CTCAGAGTTCGGCATGAGCGCA3'; lower
strand-5'CTCCAGCTCCTGTCATGGGG3', whereas the sequences of
the human IRF-4/Pip primers are: upper strand-5'GCAACGACCGGCCCAACAAAC3'; lower
strand-5'GCAAGACCCCGTATCCCCGTATCA3'. These primers do not
cross-react with the ICSBP gene. The sequences of the ISG15 RT-PCR
primers are: upper strand-5'TGGCCTGGGACCTAAAGGTGAAGA3'; lower strand-5'TGCACTGGGGCTTTAGGCCATACT3'.
RT-PCR analysis.
RT-PCR analysis was performed according to the methods of Schmidt et
al.14 For the ISG15 gene analyses in B lymphocytes, 30 cycles were used, whereas in macrophages, 25 cycles of the following
parameters were used: 24 seconds, 94°C; 36 seconds, 60°C; 36 seconds, 72°C.
Gel electrophoretic mobility shift assay.
Nuclear extracts were harvested according to the method of Schreiber et
al.21 Mobility shift assays were performed by incubating 5 to 10 µg of nuclear extract in 6 mmol/L HEPES, pH 7.9, 30 mmol/L potassium chloride, 6% glycerol, 0.1 mmol/L EDTA, 0.3 mmol/L
dithiotreitol (DTT), 2 µg salmon sperm, and 20 µg
bovine serum albumin for 10 minutes on ice. After this, 2 ng of labeled
probe was added and the samples were incubated at room temperature for
10 minutes. One microgram of the antibody was added to the reactions
before the addition of the probe for the supershift reactions. To
exclude unspecific binding, a 200-fold excess of the unlabelled ISG15 oligonucleotide was used. After incubation, the reaction mixtures were
run on a 1X TBE gel at 4°C.
Transfections.
K562 cells were transfected by electroporation exactly according to the
conditions of Waring et al.22 K562 cells were transfected with 15 µg of pGL-ISG15p and 15 µg of pcDNA or pcDNA-ICSBP or pcDNA-IRF-4. In addition, cells were transfected with 3 µg of the
internal control pRL-TK. The relactive light units from the pGL-ISG15p
vector were standardized relative to the expression of pRL-TK. Vectors
pRL-TK, pcDNA, and pGL3-Promoter were purchased from Promega (Madison,
WI). The pGL3-Promoter vector had 150 bp of the ISG15
promoter cloned into the SmaI restriction site. The ICSBP expression
vector was made by inserting an EcoRI fragment of the ICSBP cDNA, which
includes all of the coding exons into the vector pcDNA. The IRF-4/Pip
expression vector was a gift from Drs H.-W. Mittrücker and Tak W. Mak (Department of Immunology, University of Toronto, Toronto, Ontario, Canada).
Western blotting and immunoprecipitation.
A total of 3 × 107 cells were washed twice with
phosphate-buffered saline (PBS) and lysed in 1 mL ristocetin-induced
platelet agglutination (RIPA) buffer (50 mmol/L Tris-HCl,
pH 7.4, 1% NP-40, 0.25% Na-deoxycholate, 150 mmol/L NaCl, 1 mmol/L
EDTA, 200 mmol/L Pefabloc SC, 1 mg/mL aprotinin, 1 mg/mL leupeptin, 1 mg/mL pepstatin) and were precleared for 1 hour with 40 µL agarose.
Immunoprecipitations were performed with 750 µg whole cell lysate in
500 µL RIPA buffer using 2 µg anti-ICSBP (rabbit) or anti-IRF-4/Pip
(goat) at 4°C overnight. Immunocomplexes were separated by 40 µL
A/G-Sepharose (2 hours, 4°C) and were analyzed by a 10% sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Proteins
were transferred to nitrocellulose membranes, and immunoblottings were
performed with anti-IRF-4/Pip (1:2,000) or anti-ICSBP (1:2,000)
followed by horseradish peroxidase-conjugated antigoat IgG (1:3,000) or
antirabbit IgG F(ab')2 fragment (1:3,000).
| |
RESULTS |
Cell type-specific disregulation of the ISG15 gene in
ICSBP/ mice.
To investigate whether the lack of ICSBP affects the expression of
ISRE-containing genes, we have analyzed the transcription of the ISG15
gene in primary B cells and peritoneal macrophages. Both cell types are
known to express ICSBP constitutively in wild-type mice. ISG15 is a
prototype gene containing an ISRE-sequence that has been used in
several previous studies.5,11
The results show that the expression level of the ISG15 gene was
consistently 3-fold to 5-fold higher in macrophages from ICSBP/ than in wild-type mice
(Fig 1A). In contrast to the situation in
macrophages, in B cells, the expression of ISG15 was essentially the
same in wild-type and ICSBP/ mice (Fig 1B). The results indicate that in the ICSBP/ mice, there is a cell
type-specific disregulation of the ISG15 gene.
View larger version (43K):
[in this window]
[in a new window]
| Fig 1.
ISG15 mRNA expression levels in macrophages and B
lymphocytes. Semiquantitative RT-PCR analysis showing the mRNA
expression levels of the ISG15 gene in primary macrophages (A) and B
lymphocytes (B) from wild-type and ICSBP-deficient mice. The PCR
protocols were standardized for both ISG15 and the internal control
-actin to ensure that PCR amplification was in the linear phase.
|
|
ICSBP and IRF-4/Pip form complexes that bind to the ISG15 ISRE in B
cells and macrophages.
We analyzed whether an altered formation of DNA protein complexes is
directly responsible for the observed disregulation of ISG15 expression
in ICSBP/ mice. Mobility shift assays were performed
using the ISRE sequence from the ISG15 gene promoter and protein
extracts from primary spleenic B cells and peritoneal macrophages
isolated from ICSBP+/+ and ICSBP/ mice.
Figure 2A shows the result of a mobility
shift assay obtained by incubating the ISG15 ISRE with nuclear extracts
from sorted B cells of wild-type and ICSBP-deficient mice. Two
complexes, designated B1 and B2, were seen in B-cell nuclear extracts
from wild-type mice (Fig 2, lane 2). When an antibody
against ICSBP was added to the binding reaction, the slower migrating
B1 complex disappeared completely, and a supershifted band could be
seen, indicating that ICSBP binds to the ISG15 ISRE in B-cell extracts (Fig 2, lane 3). The addition of an antibody against
IRF-2 resulted in a supershift of both B1 and B2 complexes (Fig
2, lane 4). It has been previously shown that IRF-2 can
bind to the ISRE by itself,23 and it is very likely that B2
represents IRF-2 binding alone to the ISRE, whereas the slower
migrating B1 complex is composed of IRF-2 complexed to ICSBP and/or
other ISRE binding factors. Remarkably, the addition of an antibody
against IRF-4/Pip also caused a complete supershift of the B1 complex,
which contained ICSBP and IRF-2 (Fig 2, lane 5). Our
results suggest that in B cells, ICSBP, IRF-2, and IRF-4/Pip form a
heteromeric complex that binds to the ISG15 ISRE, which is of interest
because it has not been shown previously that ICSBP complexes with
IRF-4/Pip.
View larger version (47K):
[in this window]
[in a new window]
| Fig 2.
ICSBP and IRF-4/Pip form a complex on the ISG15 ISRE. (A)
ICSBP, IRF-2, and IRF-4/Pip form a complex on the ISG15 ISRE in B
lymphocytes. Mobility shift assay with the ISG15 ISRE probe and
B-lymphocyte nuclear extracts from wild-type (lanes 1 to 5) and
ICSBP-deficient mice (lanes 6 to 10). Lanes 1 and 6, competition with
unlabelled ISG15 ISRE oligonucleotide; lanes 3 and 8, anti-ICSBP
antibody; lanes 4 and 9, anti-IRF-2 antibody; lanes 5 and 10, anti-IRF-4/Pip antibody. The position of the bands, B1, 2, and 3, formed on the ISG15 ISRE are indicated with arrows. (B) IRF-4/Pip is
present in macrophages and forms a complex with ICSBP. Mobility shift
assay showing complex formation of the ISG15 ISRE and proteins from
primary macrophage nuclear extracts from wild-type (lanes 1 to 3) or
ICSBP-deficient mice (lanes 4 to 6). Lanes 3 and 6, anti-ICSBP
antibody; lanes 2 and 5, anti-IRF-4/Pip antibody. The arrow shows the
specific complex binding to the ISG15 ISRE. The slowly migrating bands
seen in the ICSBP/ extracts are nonspecific bands. (C)
Western blot indicating the presence of IRF-2 in mouse macrophages.
|
|
Incubation of the ISG15 ISRE with B-cell nuclear extracts from
ICSBP-deficient mice also resulted in the formation of the 2 binding
complexes, B1 and B2, as well as a third faster migrating band labeled
B3, which has not yet been characterized (Fig 2A, lane 7). As seen in
Fig 2, lanes 9 and 10, IRF-2- and IRF-4/Pip-specific antibodies both gave rise to a complete supershift of the B1 complex, indicating that IRF-4/Pip and IRF-2 form a ternary complex with ISRE in
the absence of ICSBP. We did not detect the IRF-2 protein in spleen
cells from ICSBP/ mice in our previous
experiments.12 This difference is probably due to an
improved preparation of extracts from primary cells, which contain high
concentrations of proteases. Taken together, the above results show
that ICSBP, IRF-2, and IRF-4/Pip all bind to the ISG15 ISRE in B-cell
nuclear extracts and suggest a complex formation between all 3 proteins.
Different protein-DNA complexes were observed in nuclear extracts from
macrophages. Only 1 ISRE-binding complex, labeled M1, which migrates at
the same position as B1 in B-cell extracts, was detected in macrophage
extracts from wild-type mice. This complex was supershifted with the
ICSBP antibody (Fig 2, lane 3). Unlike the results in B
cells, despite its presence (Fig 3C), no
IRF-2 binding was seen in nuclear extracts from macrophages (data not
shown). However, the addition of an IRF-4/Pip-specific antibody did
result in a supershift of the M1 band, indicating that IRF-4/Pip binds
to the ISG15 ISRE in macrophages (Fig 2B, lane 2). Previous studies
using cell lines had suggested that IRF-4/Pip expression is limited to
lymphoid cells.6-8 The observation that IRF-4/Pip is
present in macrophages suggests that IRF-4/Pip expression is not as
restricted as previous results indicated. Similar to the results in B
cells, the results in macrophages suggest that a complex is formed
between ICSBP and IRF-4/Pip and implicate IRF-4/Pip as a new binding
partner for ICSBP. Analyses of protein DNA complexes in macrophage
nuclear extracts from ICSBP/ mice showed the absence of
the M1 complex. Antibodies against ICSBP and IRF-4/Pip did not result
in a supershift (Fig 2B, lanes 5 and 6). These results suggest a
cell-specific complex formation of the IRFs on the ISG15 promoter.
View larger version (43K):
[in this window]
[in a new window]
| Fig 3.
IRF-4/Pip protein and mRNA are expressed in mouse primary
macrophages. (A) IRF-4/Pip mRNA is expressed in mouse primary
macrophages and B lymphocytes. The expression levels of the IRF-4/Pip
gene was determined in primary macrophages and B lymphocytes from
wild-type and ICSBP-deficient mice. The arrows show the band for
IRF-4/Pip and for the -actin control. (B) The IRF-4/Pip protein is
present in mouse primary macrophages from wild-type and ICSBP-deficient
mice. The presence of the IRF-4/Pip protein in mouse macrophages in
wild-type and ICSBP/ mice was determined by a Western blotting
assay.
|
|
The IRF-4/Pip mRNA and protein is expressed in both wild-type and
ICSBP/ mouse macrophages.
The absence of IRF-4/Pip binding to the ISRE in ICSBP/
macrophages would suggest that either IRF-4/Pip is not present or that
in macrophages, it requires the presence of ICSBP to bind the ISRE. To
distinguish between these 2 possibilities, we analyzed IRF-4/Pip mRNA
and protein expression in macrophages by RT-PCR and by
immunoprecipitation followed by Western blotting. Figure 3A and B shows
that IRF-4/Pip mRNA and protein are present in wild-type and
ICSBP/ macrophages, suggesting that IRF-4/Pip requires
the presence of ICSBP to bind to the ISG15 ISRE.
ICSBP and IRF-4/Pip form stable complexes in vivo in the absence of
DNA.
Because IRF-4/Pip is unable to bind to the ISG15 ISRE in macrophages in
the absence of ICSBP, it is likely that these 2 proteins form a complex
in macrophages. However, in B cells, IRF-4/Pip binds to the ISG15 ISRE
in the absence of ICSBP; thus it is not clear if these 2 proteins
complex in B cells or if, as in the case with PU.1, ICSBP and IRF-4/Pip
compete for IRF-2 binding. To determine if ICSBP and IRF-4/Pip form a
complex in B cells, we depleted ICSBP from wild-type B-cell nuclear
extracts and used the depleted extracts in a mobility shift assay.
ICSBP, IRF-4/Pip, and IRF-2 bound to the ISG15 ISRE in mock-depleted
extracts (Fig 4A, lanes 1 to 4). However,
when ICSBP was depleted from the B-cell wild-type extracts, binding of
IRF-4/Pip to the ISG15 ISRE was abrogated, although IRF-2 binding is
still present (Fig 4A, lanes 7 and 8). In addition, the
slower migrating complex B1, which contains ICSBP, IRF-2, and
IRF-4/Pip, was no longer present (Fig 4A, compare lane 1 v lane 5). Because IRF-4/Pip was previously shown to bind to
the ISG15 ISRE in the absence of ICSBP in B cells (Fig 2A), this raised
the possibility that IRF-4/Pip was coimmunoprecipitated from the
wild-type B-cell extracts by the ICSBP antibody, suggesting the
existence of an ICSBP-IRF-4/Pip complex in the absence of DNA. The
existence of such a complex in both B cells and macrophages was
confirmed by coimmunoprecipitation, followed by Western blotting (Fig
4B and C).
View larger version (53K):
[in this window]
[in a new window]
| Fig 4.
ICSBP and IRF-4/Pip form a complex in B cells and
macrophages. (A) IRF-4/Pip is precipitated out of mouse B-lymphocyte
extracts with an antibody against ICSBP. (A) Shows a mobility shift
assay incubating the ISG15 ISRE oligonucleotide with wild-type mouse
B-lymphocyte extracts, either mock-depleted (lanes 1 to 4) or depleted
for the ICSBP protein (lanes 5 to 8). In lanes 2 and 6, the extracts
are incubated with antibody against ICSBP, lanes 3 and 7 are with
anti-IRF-4/Pip, and lanes 4 and 8 are with anti-IRF-2. (B and C)
Evidence for ICSBP and IRF-4/Pip complex by coimmunoprecipitation in
B-cell line, A20.2j (B) and in primary macrophages (C). The IRF-4/Pip
protein was precipitated with an antibody against ICSBP and vice versa
as described in Materials and Methods. Fluorographs of the
immunoprecipitated fractions (P) and the supernatants (S) are shown.
|
|
The number and spacing of the consensus ISRE sites within the ISG15
ISRE motif are critical for ICSBP and IRF-4/Pip binding.
As shown previously, the consensus binding site for the ISRE is
GAAANN.9 The ISG15 ISRE is somewhat unique in that it
contains 3 consensus binding sites next to each other with no spacing
in between. To determine if the number and spacing of the ISRE
consensus sites is important for IRF binding, we made a series of
mutations in the ISG15 ISRE, either mutating or inserting base pairs
between the consensus sites (Table 1).
These oligonucleotides were used for mobility shift assays with
macrophage and B-cell nuclear extracts from wild-type mice. When the
mutated ISG15 ISRE oligonucleotides GG1 or M4 (Table 1) were used in a
mobility shift assay, the binding of ICSBP, IRF-2, and IRF-4/Pip
strongly decreased. ICSBP, IRF-2, and IRF-4/Pip were unable to bind to
the oligonucleotides, M1-3, M5, and GG2, which have a disruption in the
middle or the 3' ISRE consensus sites, (Table 1). From these
results, one may conclude that the middle and 3' consensus ISRE
sites are more crucial for binding of the ICSBP protein complexes than
the 5' ISRE. Nonetheless, binding of the IRF family protein
complexes was significantly weaker when any of the ISRE consensus sites was mutated.
A similar result was seen in mobility shift assay with the mutated ISRE
oligonucleotides and macrophage nuclear extracts. Using the mutated
ISRE oligonucleotide, GG1 or M4, the binding of both ICSBP and
IRF-4/Pip was reduced. Similar to the results in B cells, the mutated
oligonucleotides, M1-3, M5, or GG2, were unable to bind ICSBP or
IRF-4/Pip (Table 1). The results in both B cells and macrophages show
that the number and spacing of the ISRE consensus sites are crucial for
generation of the ICSBP and IRF-4/Pip complexes.
ICSBP and IRF-4/Pip synergistically repress the activity of the ISG15
promoter.
Our results to this point show that ICSBP and IRF-4/Pip form a complex
and bind to the ISRE region of the ISG15 promoter in both macrophage
and B-cell nuclear extracts. Previous results have shown that both
ICSBP and IRF-4/Pip individually act as negative regulators of
ISRE-dependent transcription.9,20 To determine the function
of the ICSBP-IRF-4/Pip complex, we constructed a luciferase vector that
contained approximately 150 bp of the ISG15 promoter incuding the
ISRE-region. This construct was transfected into K562 cells, which
express endogenous IRF-2, but no IRF-4/Pip or ICSBP.8,24
The K562 cells were then transfected with an IRF-4/Pip or an ICSBP
expression vector or with both vectors. Mobility shift assays confirmed
the presence of the ICSBP and IRF-4/Pip proteins binding to the ISG15
ISRE in transfected K562 cells and its absence in control cells (data
not shown). The results of the luciferase assay are shown in
Fig 5. K562 cells transfected with the
ISG15 reporter plasmid showed high levels of luciferase activity.
Transfection of the ISG15 luciferase vector into K562 cells
cotransfected with the IRF-4/Pip or the ICSBP vector reduced the
expression approximatelly 15-fold. However, when the ISG15 luciferase
vector was transfected into K562 cells expressing both ICSBP and
IRF-4/Pip, the luciferase expression was reduced over 150-fold to background levels. These results confirm that a
complex of IRF-4/Pip and ICSBP synergisti- cally repress the
expression of the ISG15 gene promoter.
View larger version (17K):
[in this window]
[in a new window]
| Fig 5.
ICSBP and IRF-4 synergistically downregulate the
expression of the ISG15 promoter. K562 cells were transfected with the
luciferase expression vector pGL-ISG15p and pcDNA-IRF-4 and/or
pcDNA-ICSBP. The graph shows the results of 3 independent experiments.
The values were standardized relative to the internal control pRL-TK
(see Materials and Methods).
|
|
| |
DISCUSSION |
We have shown that the ISG15 gene promoter is a target for several IRFs
that form different heteromeric complexes in macrophages and in B
cells. While 3 IRF-members, ICSBP, IRF-2, and IRF-4/Pip, interact with
the ISRE in B cells, only ICSBP and IRF-4/Pip were found to bind this
sequence in macrophages from wild-type mice. The presence of IRF-4/Pip
in macrophages was surprising and suggests that IRF-4/Pip expression is
not as restricted as previously indicated.6-8
Mutational analyses of the ISRE indicated that the sequence
requirements for binding of the ICSBP and IRF-4/Pip complex are highly
specific. The strongest binding of the complex is seen with the native
ISG15 sequence, which is composed of 3 consensus ISRE sequences placed
together with no intervening base pairs. Therefore, it is likely that
only a limited number of genes with ISRE promoter elements are
regulated by the ICSBP and IRF-4/Pip complex.
Both ICSBP and IRF-4/Pip do not bind strongly to the ISRE, and it has
been reported that complex formation with other transcription factors
improves their binding significantly. Both ICSBP and IRF-4/Pip binding
to the ISRE of the lambda B site is dependent on the presence of the
ets family member, PU.1.6 In contrast, the other IRF proteins, IRF-1, IRF-2, and ISGF3, bind to the same site
independently from PU.1.20 The binding of ICSBP to the
ISG15 ISRE in vitro is enhanced by IRF-1 or IRF-2.11
Although ICSBP and IRF-4/Pip are closely related by sequence homology,
cooperative binding between IRF-4/Pip and IRF-1 or IRF-2 has not yet
been reported. Therefore, it was somewhat surprising to find IRF-4/Pip
complexing with 2 other IRF-members, ICSBP and IRF-2. The above results
extend previous observations indicating a high frequency of
heterocomplex formation within the IRF family.11
Our observations define novel interactions between IRF-4/Pip and ICSBP
and show that these 2 factors downregulate the transcription of an
ISRE-promoter from the ISG15 gene upon its transfection into monocytic
cells. The fact that the expression of ISG15 is enhanced in macrophages
from ICSBP/ mice, in which the ICSBP and IRF-4/Pip
complex binding to the ISRE is absent, strongly suggests that these
factors also regulate ISG15 expression in physiological conditions.
Thus, the transcriptional repressor ICSBP, which is strongly induced by
IFN, could mediate IFN responsiveness by interacting with a
variety of transcription factors, which by themselves do not respond to
IFN.
The identification of IRF-4/Pip as a new binding partner of ICSBP is of
considerable interest. Cotransfection experiments suggested that ICSBP
is a negative regulator of genes induced by interferons.9
IRF-4/Pip may function in controlling both the transcriptional activity
and the recombinational specificity of immunoglobulin light-chain genes
in B cells.20 Finally, the evidence that ICSBP and
IRF-4/Pip are important and nonredundant transcriptional regulators in
vivo was provided by analyses of knock-out mice. The lack of either of
the factors causes profound changes in the development and function of
the hematolymphoid system.12,25 Our finding of IRF-4/Pip
expression in macrophages and its cooperative interaction with ICSBP
provokes the question on the additional roles of IRF-4/Pip in
macrophages. Whether macrophage functions are altered in
IRF-4/Pip-deficient mice has not yet been investigated.
Interferons are pleiotropic regulators of defense mechanisms against
pathogens, immune responses, and cell growth.1,2,26 The
production of /-interferons is triggered by many external stimuli
(eg, viral infection). ISG15 has been described as an /-interferon-stimulated cytokine secreted by macrophages and lymphocytes that augments -interferon production in
lymphocytes.10 -Interferon is a key regulator of
inflammatory responses, and its uncontrolled activity may lead to
deleterious pathological changes.26 Previous observations
and results presented here suggested that 1 possible mechanism
terminating -interferon responses is the ICSBP and
IRF-4/Pip-mediated downregulation of ISG15.
| |
ACKNOWLEDGMENT |
The authors thank H.-W. Mittrücker and T. Mak for reagents.
| |
FOOTNOTES |
Submitted March 30, 1999; accepted August 9, 1999.
F.R. and J.F.W. contributed equally to this work.
Supported by the Deutsche Forschungsgemeinschaft (SFB 506) and by the
Wilhelm-Sander-Stiftung. J.F.W. was supported by A.v. Humboldt Foundation.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Ivan Horak, MD, Department of
Molecular Genetics, Research Institute of Molecular Pharmacology, and
University Hospital Benjamin Franklin, Free University of Berlin,
Krahmerstrasse 6, 12207 Berlin, Germany; e-mail: horak{at}fmp-berlin.de.
| |
REFERENCES |
1.
Stark GR, Kerr IM, Williams BRG, Silverman RH, Schreiber RD:
How cells respond to interferons.
Annu Rev Biochem
67:227, 1998
[Medline]
[Order article via Infotrieve]
2.
Boehm U, Klamp T, Groot M, Howard JC:
Cellular responses to interferon-.
Annu Rev Immunol
15:749, 1997
[Medline]
[Order article via Infotrieve]
3.
Harada H, Fujita T, Miyamoto M, Kimura Y, Maruyama M, Furia A, Miyata TA, Taniguchi T:
Structurally similar but functionally distinct factors, IRF-1 and IRF-2, bind to the same regulatory elements of IFN and IFN-inducible genes.
Cell
58:729, 1989
[Medline]
[Order article via Infotrieve]
4.
Pine R, Decker T, Kessler DS, Levy DE, Darnell JE Jr:
Purification and cloning of interferon-stimulated gene factor 2 (ISGF2): ISGF2 (IRF-1) can bind to the promoters of both beta interferon- and interferon-stimulated genes but is not a primary transcriptional activator of either.
Mol Cell Biol
10:2448, 1990
[Abstract/Free Full Text]
5.
Driggers PH, Ennist DL, Gleason SL, Mak W-H, Marks MS, Levi B-Z, Flanagan JR, Appella E, Ozato K:
An interferon--regulated protein that binds the interferon-inducible enhancer element of major histocompatibility complex class I genes.
Proc Natl Acad Sci USA
87:3743, 1990
[Abstract/Free Full Text]
6.
Eisenbeis CF, Singh H, Storb U:
Pip, a novel IRF family member, is a lymphoid-specific, PU.1-dependent transcriptional activator.
Genes Dev
9:1377, 1995
[Abstract/Free Full Text]
7.
Matsuyama T, Grossman A, Mittrücker H-W, Siderovski DP, Kiefer F, Kawakami T, Richardson CD, Taniguchi T, Yoshinaga SK, Mak TW:
Molecular cloning of LSIRF, a lymphoid-specific member of the interferon regulatory factor family that binds the interferon-stimulated response element (ISRE).
Nucleic Acids Res
23:2127, 1995
[Abstract/Free Full Text]
8.
Yamagata T, Nishida J, Tanaka T, Sakai R, Mitani K, Yoshida M, Taniguchi T, Yazaki Y, Hirai H:
A novel interferon regulatory factor family transcription factor, ICSAT/Pip/LSIRF, that negatively regulates the activity of interferon-regulated genes.
Mol Cell Biol
16:1283, 1996
[Abstract]
9.
Nelson N, Marks MS, Driggers PH, Ozato K:
Interferon consensus sequence-binding protein, a member of the interferon regulatory factor family, suppresses interferon-induced gene transcription.
Mol Cell Biol
13:588, 1993
[Abstract/Free Full Text]
10.
D'Cunha J, Knight E Jr, Haas AL, Truitt RL, Borden EC:
Immunoregulatory properties of ISG15, an interferon-induced cytokine.
Proc Natl Acad Sci USA
93:211, 1996
[Abstract/Free Full Text]
11.
Bovolenta C, Driggers PH, Marks MS, Medin JA, Politis AD, Vogel SN, Levy DE, Sakaguchi K, Appella E, Coligan JE, Ozato K:
Molecular interactions between interferon consensus sequence binding protein and members of the interferon regulatory factor family.
Proc Natl Acad Sci USA
91:5046, 1994
[Abstract/Free Full Text]
12.
Holtschke T, Löhler J, Kanno Y, Fehr T, Giese N, Rosenbauer F, Lou J, Knobeloch K-P, Gabriele L, Waring JF, Bachmann MF, Zingernagel RM, Morse HC III, Ozato K, Horak I:
Immunodeficiency and chronic myelogenous leukemia-like syndrome in mice with a targeted mutation of the ICSBP gene.
Cell
87:307, 1996
[Medline]
[Order article via Infotrieve]
13.
Fehr T, Schoedon G, Odermatt B, Holtschke T, Schneemann M, Bachmann MF, Mak TW, Horak I, Zinkernagel RM:
Crucial role of interferon consensus sequence binding protein, but neither of interferon regulatory factor 1 nor of nitric oxide synthesis for protection against murine listeriosis.
J Exp Med
185:921, 1997
[Abstract/Free Full Text]
14.
Schmidt M, Nagel S, Proba J, Thiede C, Waring JF, Rosenbauer F, Huhn D, Wittig B, Horak I, Neubauer A:
Lack of interferon consensus sequence binding protein (ICSBP) transcripts in human myeloid leukemias.
Blood
91:22, 1998
[Abstract/Free Full Text]
15.
Giese NA, Gabriele L, Doherty TM, Klinman DM, Tadesse-Heath L, Contursi C, Epstein SL, Morse HC III:
Interferon (IFN) consensus sequence-binding protein, a transcription factor of the IFN regulatory factor family, regulates immune responses in vivo through control of interleukin 12 expression.
J Exp Med
186:1535, 1997
[Abstract/Free Full Text]
16.
Scharton-Kersten T, Contursi C, Masumi A, Sher A, Ozato K:
Interferon consensus sequence binding protein-deficient mice display impaired resistance to intracellular infection due to a primary defect in interleukin 12 p40 induction.
J Exp Med
186:1523, 1997
[Abstract/Free Full Text]
17.
Tenen DG, Hromas R, Licht JD, Zhang D-E:
Transcription factors, normal myeloid development, and leukemia.
Blood
90:489, 1997
[Free Full Text]
18.
Eisenbeis CF, Singh H, Storb U:
PU.1 is a component of a multiprotein complex which binds an essential site in the murine immunoglobulin  2-4 enhancer.
Mol Cell Biol
9:6452, 1993
19.
Pongubala JMR, Nagulapalli S, Klemsz MJ, McKercher SR, Maki RA, Atchison ML:
PU.1 recruits a second nuclear factor to a site important for immunoglobulin K 3' enhancer activity.
Mol Cell Biol
12:368, 1992
[Abstract/Free Full Text]
20.
Brass AL, Kehrli E, Eisenbeis CF, Storb U, Singh H:
Pip, a lymphoid-restricted IRF, contains a regulatory domain that is important for autoinhibition and ternary complex formation with the Ets factor PU.1.
Genes Dev
10:2335, 1996
[Abstract/Free Full Text]
21.
Schreiber E, Harshman K, Kemler I, Malipiero U, Schaffner W, Fontana A:
Astrocytes and glioblastoma cells express novel octamer-DNA binding proteins distinct from the ubiquitous Oct-1 and B cell type Oct-2 proteins.
Nucleic Acids Res
18:5495, 1990
[Abstract/Free Full Text]
22.
Waring JF, Radford JE, Burns LJ, Ginder GD:
The human leukocyte antigen A2 interferon-stimulated response element consensus binds a nuclear factor required for constitutive expression.
J Biol Chem
270:12276, 1995
[Abstract/Free Full Text]
23.
Parrington JR, Rogers NC, Gewert DR, Pine R, Veals SA, Levy DE, Stark GR, Kerr IM:
The interferon-stimulable response elements of two human genes detect overlapping sets of transcription factors.
Eur J Biochem
15:617, 1993
24.
Weisz A, Marx P, Sharf R, Appella E, Driggers PH, Ozato K, Levi B-Z:
Human interferon consensus sequence binding protein is a negative regulator of enhancer elements common to interferon-inducible genes.
J Biol Chem
267:25589, 1992
[Abstract/Free Full Text]
25.
Mittrücker H-W, Matsuyama T, Grossman A, Kündig TM, Potter J, Shahinian A, Wakeham A, Patterson B, Ohashi PS, Mak TW:
Requirement for the transcription factor LSIRF/IRF4 for mature B and T lymphocyte function.
Science
275:540, 1997
[Abstract/Free Full Text]
26.
Farrar MA, Schreiber RD:
The molecular cell biology of interferon- and its receptor.
Annu Rev Immunol
11:571, 1993
[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
R. Hrdlickova, J. Nehyba, and H. R. Bose Jr.
Regulation of Telomerase Activity by Interferon Regulatory Factors 4 and 8 in Immune Cells
Mol. Cell. Biol.,
February 1, 2009;
29(3):
929 - 941.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Wang, C. H. Lee, C. Qi, P. Tailor, J. Feng, S. Abbasi, T. Atsumi, and H. C. Morse III
IRF8 regulates B-cell lineage specification, commitment, and differentiation
Blood,
November 15, 2008;
112(10):
4028 - 4038.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. H. Lee, M. Melchers, H. Wang, T. A. Torrey, R. Slota, C.-F. Qi, J. Y. Kim, P. Lugar, H. J. Kong, L. Farrington, et al.
Regulation of the germinal center gene program by interferon (IFN) regulatory factor 8/IFN consensus sequence-binding protein
J. Exp. Med.,
January 23, 2006;
203(1):
63 - 72.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Wang, R. M. Baron, G. Zhu, M. Joo, J. W. Christman, E. S. Silverman, M. A. Perrella, R. J. Riese, and M. Cernadas
PU.1 Regulates Cathepsin S Expression in Professional APCs
J. Immunol.,
January 1, 2006;
176(1):
275 - 283.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Lehtonen, V. Veckman, T. Nikula, R. Lahesmaa, L. Kinnunen, S. Matikainen, and I. Julkunen
Differential Expression of IFN Regulatory Factor 4 Gene in Human Monocyte-Derived Dendritic Cells and Macrophages
J. Immunol.,
November 15, 2005;
175(10):
6570 - 6579.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Negishi, Y. Ohba, H. Yanai, A. Takaoka, K. Honma, K. Yui, T. Matsuyama, T. Taniguchi, and K. Honda
Negative regulation of Toll-like-receptor signaling by IRF-4
PNAS,
November 1, 2005;
102(44):
15989 - 15994.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Honma, H. Udono, T. Kohno, K. Yamamoto, A. Ogawa, T. Takemori, A. Kumatori, S. Suzuki, T. Matsuyama, and K. Yui
Interferon regulatory factor 4 negatively regulates the production of proinflammatory cytokines by macrophages in response to LPS
PNAS,
November 1, 2005;
102(44):
16001 - 16006.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Tamura, P. Thotakura, T. S. Tanaka, M. S. H. Ko, and K. Ozato
Identification of target genes and a unique cis element regulated by IRF-8 in developing macrophages
Blood,
September 15, 2005;
106(6):
1938 - 1947.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. V. Pedchenko, G. Y. Park, M. Joo, T. S. Blackwell, and J. W. Christman
Inducible binding of PU.1 and interacting proteins to the Toll-like receptor 4 promoter during endotoxemia
Am J Physiol Lung Cell Mol Physiol,
September 1, 2005;
289(3):
L429 - L437.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Suzuki, K. Honma, T. Matsuyama, K. Suzuki, K. Toriyama, I. Akitoyo, K. Yamamoto, T. Suematsu, M. Nakamura, K. Yui, et al.
From the Cover: Critical roles of interferon regulatory factor 4 in CD11bhighCD8{alpha}- dendritic cell development
PNAS,
June 15, 2004;
101(24):
8981 - 8986.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Rosenbauer, K. Wagner, P. Zhang, K.-P. Knobeloch, A. Iwama, and D. G. Tenen
pDP4, a novel glycoprotein secreted by mature granulocytes, is regulated by transcription factor PU.1
Blood,
June 1, 2004;
103(11):
4294 - 4301.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Joo, G. Y. Park, J. G. Wright, T. S. Blackwell, M. L. Atchison, and J. W. Christman
Transcriptional Regulation of the Cyclooxygenase-2 Gene in Macrophages by PU.1
J. Biol. Chem.,
February 20, 2004;
279(8):
6658 - 6665.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Liu and S. I. Abrams
Coordinate Regulation of IFN Consensus Sequence-Binding Protein and Caspase-1 in the Sensitization of Human Colon Carcinoma Cells to Fas-Mediated Apoptosis by IFN-{gamma}
J. Immunol.,
June 15, 2003;
170(12):
6329 - 6337.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. O'Reilly, C. M. Quinn, T. El-Shanawany, S. Gordon, and D. R. Greaves
Multiple Ets Factors and Interferon Regulatory Factor-4 Modulate CD68 Expression in a Cell Type-specific Manner
J. Biol. Chem.,
June 6, 2003;
278(24):
21909 - 21919.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. M. Martinez, C. A. Afshari, P. R. Bushel, A. Masuda, T. Takahashi, and N. J. Walker
Differential Toxicogenomic Responses to 2,3,7,8-Tetrachlorodibenzo-p-dioxin in Malignant and Nonmalignant Human Airway Epithelial Cells
Toxicol. Sci.,
October 1, 2002;
69(2):
409 - 423.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Sharma, N. Grandvaux, Y. Mamane, P. Genin, N. Azimi, T. Waldmann, and J. Hiscott
Regulation of IFN Regulatory Factor 4 Expression in Human T Cell Leukemia Virus-I-Transformed T Cells
J. Immunol.,
September 15, 2002;
169(6):
3120 - 3130.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Meraro, M. Gleit-Kielmanowicz, H. Hauser, and B.-Z. Levi
IFN-Stimulated Gene 15 Is Synergistically Activated Through Interactions Between the Myelocyte/Lymphocyte-Specific Transcription Factors, PU.1, IFN Regulatory Factor-8/IFN Consensus Sequence Binding Protein, and IFN Regulatory Factor-4: Characterization of a New Subtype of IFN-Stimulated Response Element
J. Immunol.,
June 15, 2002;
168(12):
6224 - 6231.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Kallies, F. Rosenbauer, M. Scheller, K.-P. Knobeloch, and I. Horak
Accumulation of c-Cbl and rapid termination of colony-stimulating factor 1 receptor signaling in interferon consensus sequence binding protein-deficient bone marrow-derived macrophages
Blood,
May 1, 2002;
99(9):
3213 - 3219.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. R. Bose Jr.
Interferon Regulatory Factor 4 Contributes to Transformation of v-Rel-Expressing Fibroblasts
Mol. Cell. Biol.,
October 1, 2001;
21(19):
6369 - 6386.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Marecki, C. J. Riendeau, M. D. Liang, and M. J. Fenton
PU.1 and Multiple IFN Regulatory Factor Proteins Synergize to Mediate Transcriptional Activation of the Human IL-1{{beta}} Gene
J. Immunol.,
June 1, 2001;
166(11):
6829 - 6838.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Matsumoto, K. Hisatake, Y. Nogi, and M. Tsujimoto
Regulation of Receptor Activator of NF-kappa B Ligand-induced Tartrate-resistant Acid Phosphatase Gene Expression by PU.1-interacting Protein/Interferon Regulatory Factor-4. SYNERGISM WITH MICROPHTHALMIA TRANSCRIPTION FACTOR
J. Biol. Chem.,
August 24, 2001;
276(35):
33086 - 33092.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION