Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by MacIvor, D. M.
Right arrow Articles by Ley, T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by MacIvor, D. M.
Right arrow Articles by Ley, T. J.
Related Collections
Right arrow Phagocytes
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 94 No. 12 (December 15), 1999: pp. 4282-4293

Normal Neutrophil Function in Cathepsin G-Deficient Mice

By Debra M. MacIvor, Steven D. Shapiro, Christine T.N. Pham, Abderazzaq Belaaouaj, Soman N. Abraham, and Timothy J. Ley

From the Departments of Internal Medicine and Genetics, Division of Bone Marrow Transplantation and Stem Cell Biology, Department of Pediatrics, Medicine, and Cell Biology, Division of Rheumatology, and Department of Pathology, Washington University Medical School, St Louis, MO.


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cathepsin G is a neutral serine protease that is highly expressed at the promyelocyte stage of myeloid development. We have developed a homologous recombination strategy to create a loss-of-function mutation for murine cathepsin G. Bone marrow derived from mice homozygous for this mutation had no detectable cathepsin G protein or activity, indicating that no other protease in bone marrow cells has the same specificity. Hematopoiesis in cathepsin G-/- mice is normal, and the mice have no overt abnormalities in blood clotting. Neutrophils derived from cathepsin G-/- mice have normal morphology and azurophil granule composition; these neutrophils also display normal phagocytosis and superoxide production and have normal chemotactic responses to C5a, fMLP, and interleukin-8. Although cathepsin G has previously shown to have broad spectrum antibiotic properties, challenges of mice with Staphylococcus aureus, Klebsiella pneumoniae, or Escherichia coli yielded survivals that were not different from those of wild-type animals. In sum, cathepsin G-/- neutrophils have no obvious defects in function; either cathepsin G is not required for any of these normal neutrophil functions or related azurophil granule proteases with different specificities (ie, neutrophil elastase, proteinase 3, azurocidin, and/or others) can substitute for it in vivo.
© 1999 by The American Society of Hematology.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

CATHEPSIN G IS A neutral serine protease that is expressed and synthesized at the promyelocyte stage of development and is packaged in the azurophil (primary) granules.1,2 The amino acid composition and crystal structure of cathepsin G are known.3-5 The human and murine cathepsin G genes have been cloned6,7 and reside within a cluster of granule-related serine proteases on syntenic regions of human and mouse chromosomes 14.8-13 The highly related serine proteases known as neutrophil elastase (NE), azurocidin, and proteinase 3 are also expressed specifically in promyelocytes and packaged in azurophil granules; these 3 genes are located in a tight cluster on human chromosome 19 pter.14 The human and mouse cathepsin G genes are highly related and are expressed in identical fashion6,7,15; therefore, these genes are thought to be true orthologues of one another. Cathepsin G has chymotrypsin-like specificity, preferring to cleave at Phe in the P1 position16; a large number of potential substrates for cathepsin G have been identified (discussed below). Although cathepsin G is found in the azurophil granules of neutrophils, this enzyme has also been found on the surface of neutrophils after degranulation.17,18 Recent studies have suggested that inhibitors of cathepsin G (alpha -1 antichymotrypsin and/or specific antibodies directed against cathepsin G) can diminish the ability of neutrophils to respond to a variety of chemotactic signals, suggesting that cell surface-bound cathepsin G may play a role in this process.19,20

Cathepsin G has been proposed to play a role in blood clotting, because it cleaves and inactivates several clotting factors,21-26 because it can cleave and potentially modulate the function of the thrombin receptor,27-29 and because it can activate platelets in vitro.30-38 Tight contact is thought to be required between neutrophils and platelets for platelet activation to occur33,34; cleavage of the thrombin receptor or thrombin receptor-like proteins could potentially play a role in this process.

Cathepsin G has been proposed to play a role in neutrophil responses against a variety of bacteria. Purified cathepsin G has been shown to inhibit the growth of several organisms, including Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, and Neisseria gonorrhea; it also displays toxic properties against Eimeria tenella sporozoites, Capnocytophaga, and Listeria monocytogenes.39-45 The enzymatic activity of cathepsin G is not required for its antibacterial activities39,46-48; in fact, 3 peptides derived from cathepsin G (IIGGR [aa 1-5], HPQYNQR [aa 77-83], and RPGTLCTVAGWGRVSMRRGT [aa 117-136]) have direct antimicrobial properties.47,48 The precise mechanisms by which these peptides cause bacterial death are currently unknown.

Cathepsin G has a number of potential substrates and activities that are difficult to classify, including the conversion of angiotensin I to angiotensin II,49 the activation and damage of cultured airway epithelial cells,50 the stimulation of secretion by airway gland serous cells,51 the induction of transendothelial albumin flux,52 and the processing of NF-kB (p65) in vitro.53 It is not yet clear that any of these activities represent physiologic roles of this enzyme.

Finally, cathepsin G has been proposed to play an important role in tissue remodeling at sites of wounding or tissue injury. Cathepsin G has been shown to cleave and inactivate the neutrophil chemoattractants tumor necrosis factor alpha  (TNFalpha ),54 interleukin-1 (IL-1),55 and IL-8.56 In addition, cathepsin G has been shown to cleave several matrix components, including collagen, fibronectin, cartilage proteoglycans, and elastin.57-64 For this reason, we recently examined the ability of cathepsin G-deficient mice (the same mice described in this study) to heal incisional wounds and found that these animals have reduced tensile strength of their healing wounds at 7 days. This defect is resolved by 10 days.65 Cathepsin G-deficient mice display excessive neutrophilic inflammation at sites of wounding, which may be caused by increased neutrophil chemoattractant activity in the wound fluid.65 These observations suggest that cathepsin G may be involved in degrading one or more soluble mediators in the wound milieu that are important for the early phases of neutrophil migration into the wound. However, we could not rule out an autonomous defect of cathepsin G-deficient neutrophils that might contribute to the abnormal wound healing.

In this report, we fully describe mice that possess a null mutation of cathepsin G. Cathepsin G-/- animals have no detectable defects in myeloid development or neutrophil function, suggesting that either cathepsin G is not required for these functions or that related proteases can substitute for the functions of cathepsin G in some circumstances.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Production of the targeting construct.   A 3.7-kb Bgl II genomic fragment containing the 3' part of exon 4 through the 3' flank of the murine cathepsin G gene was subcloned into the MJK-KO vector downstream from the PGK-neo cassette. A 1.6-kb HindIII/Pst I fragment containing 5' genomic flanking sequence, exons 1 and 2, introns 1 and 2, and the 5' part of exon 3 was purified from a pUC 9 vector and subcloned into pGEM7. This plasmid was then cut with Bgl II and Xho I; the resulting Bgl II/Xho I fragment was subcloned upstream from the PGK-neo cassette and downstream from the HSV-TK cassette of the MJK-KO vector.66 Therefore, a 393-bp Pst I-Bgl II fragment containing the 3' end of exon 3, intron 3, and the 5' end of exon 4 was removed and replaced with a standard PGK-neo cassette in the reverse orientation. This deletion removes the region encoding aa 92-164 of the cathepsin G protein (numbering from the initiation codon).

Electroporation, selection, and screening of embryonic stem (ES) cells.   Early passage RW4 ES cells (129/SvJ) were maintained on feeder layers of murine embryonic fibroblasts in the presence of 103 U/mL leukocyte inhibitory factor. ES cells were transfected and selected, and G418-resistant clones were identified by Southern blotting using probe A (see Fig 1A). Recombinant clones were confirmed using a probe specific for PGK-neo (probe B).

Production of mutant mice.   C57Bl/6J blastocysts were microinjected with 10 to 12 ES cells from 3 independent targeted clones and implanted into pseudopregnant Swiss Webster foster females. Chimeric male progeny with greater than 60% agouti fur were mated with C57Bl/6J females, and their progeny were screened by Southern blot analysis (with probe A) for transmission of the targeted allele. Heterozygotes were interbred to produce homozygous mutant mice derived from 2 of the independently targeted ES clones (no. 11 and 76). Both lines were phenotypically identical. Chimeric males from line 76 were also bred to 129/SvJ females to obtain cathepsin G-deficient mice in a pure 129/SvJ background. Mice were maintained in a specific virus free (SVAF) barrier facility at all times.

S1 nuclease protection assays.   Total cellular RNA was prepared and analyzed by S1 nuclease protection, as previously described.67 The gene-specific probes for murine granzyme B,2 murine cathepsin G,7 and murine beta 2-microglobulin2 have been described previously. The probe for murine mast cell chymase-2 (mMCP-2) RNA was obtained by polymerase chain reaction (PCR); the forward primer was located in IVS-4 (TTCATCTCCcathepsin GTTCTCAAGC) and the reverse primer in exon 5 (AGACTTGATGCAGGATGAGA); and the PCR product was 489 bp in length. Correctly processed exon 5 mMCP-2 mRNA protects a probe fragment of 235 nucleotides from S1 nuclease digestion. Autoradiograms were exposed for 24 to 72 hours.

Western analysis.   Total proteins were prepared from approximately 2 × 107 bone marrow cells by sonicating the cells in 200 µL of extraction buffer (1 mol/L NaCl, 25 mmol/L Tris 7.5, 0.1% Triton X-100); protein was quantified using the Bio-Rad Protein Assay (Bio-Rad Laboratories, Hercules, CA). Equal quantities of total proteins were loaded onto 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels, transferred to nitrocellulose, and analyzed with a standard Western blotting technique using a rabbit antiserum directed against a murine cathepsin G-derived peptide (aa 152-165 numbered from the initiation codon: CANRFQFYNSQTQI), followed by detection with chemiluminescence (Amersham, Arlington Heights, IL).

Determination of cathepsin G and neutrophil elastase activity.   Total bone marrow cells were extracted in extraction buffer as described above and normalized for total protein context using the Bio-Rad assay. Cathepsin G activity was measured using the peptide substrate N-Succinyl-Ala-Ala-Pro-Phe-pNA (Sigma, St Louis, MO) and neutrophil elastase activity with the substrate N-Methoxysuccinyl-Ala-Ala-Pro-Val-pNA, as previously described.68

Generation of bone marrow-derived mast cells.   Mast cells were generated by culturing murine bone marrow cells for 3 weeks in enriched media (RPMI 1640 containing 0.1 mmol/L nonessential amino acids, 2 mmol/L L-glutamine, 10% heat-inactivated fetal calf serum, 100 U/mL penicillin, 10 µg/mL gentamicin, and 50 mmol/L 2-mercaptoethanol) supplemented with 50% WEHI-3 cell conditioned media (WCM), as previously described.69 After 3 weeks, the cells were cultured for an additional 72 hours in 50% WCM/50% enriched media supplemented with 100 U/mL recombinant murine IL-10 (Amersham). RNA was then extracted from the cells and analyzed using S1 nuclease protection assays. These preparations yielded greater than 90% mast cells as judged by light microscopic criteria.

Isolation of bone marrow-derived neutrophils.   Bone marrow was harvested using Hank's balanced salt solution (HBSS; 138 mmol/L NaCI, 5.4 mmol/L KCl, 0.4 mmol/L KH2PO4, 0.2 mmol/L Na2HPO4, 4.1 mmol/L NaHCO3, 5.5 mmol/L glucose) containing 1% bovine serum albumin (BSA). Neutrophils were purified from the bone marrow preparations using a discontinuous Ficoll gradient (Histopaque 1119; Sigma). Cells were then washed twice with HBSS containing 1% BSA. Neutrophil purity was consistently 75% to 85%, as assessed by light microscopy of Wright-Giemsa-stained cytospins.

Phagocytosis.   In vitro, 5 × 104 neutrophils in 100 µL of phosphate-buffered saline (PBS; define) were mixed with 10 µL of a 1:5 dilution of 0.9-µm diameter fluorescein isothiocyanate (FITC)-labeled latex beads (Poly Sciences, Inc, Warrington, PA) and incubated for 1 hour at 37°C. Cells were then washed with media, trypsin-EDTA was added, and the cells were incubated at 37°C for 10 minutes. Cells were then layered over 4°C fetal calf serum and spun at 1,500 rpm for 5 minutes to remove uningested beads. After washing, the cells were fixed with 1.0% paraformaldehyde in PBS and observed under a fluorescent microscope.

In vivo, 2 mL of zymosan (Sigma) was injected intraperitoneally. Total intraperitoneal cells were harvested after 4 hours by injecting 10 mL of PBS and then withdrawing 7 to 9 mL of fluid for analysis. Cytospin preparation of cells were made and stained using Wright-Giemsa stain.

Superoxide production.   Purified bone marrow-derived neutrophils were resuspended in HBSS (with 1.3 mmol/L CaCl2 and 0.4 mmol/L MgSO4) and added to tubes containing 0.2 mmol/L cytochrome C (Sigma) and 0, 5, 10, or 25 ng/mL phorbol 12-myristate 13-acetate (PMA; Sigma) or containing cytochrome C plus 300 U/mL superoxide dismutase (SOD; Sigma) with 0, 5, 10, or 25 ng/mL PMA. The cells were incubated for 20 minutes at 37°C in 5% CO2 and then centrifuged at 10,000 rpm for 2 minutes. Supernatants were assayed at OD550. The amount of superoxide produced was calculated using the following formula: (Delta OD × 100)/21.1 = micromoles of O2- = (nanomoles of O2-/mL)/(PMNs/mL/time) = nanomoles of O2-/PMNs/time.

Chemotaxis.   Optimal concentrations of several chemotactic agents were defined using bone marrow-derived neutrophils, including fMLP (10-4 mol/L; Sigma), zymosan-activated rat serum (7%), and recombinant human IL-8 (rhIL-8; 250 ng/mL; Amersham); these optimal concentrations were used for all further experiments.70 Chemotactic agents were suspended in the bottom wells of micro-chemotaxis chambers. The bottom chamber was covered with 2-mm membrane filters, and 150,000 bone marrow-derived neutrophils (in Dulbecco's modified Eagle's medium [DMEM]/0.1% human serum albumin) derived from wild-type or cathepsin G-deficient mice (all in the pure 129/SvJ strain) were suspended in the top wells. After incubation for 75 minutes at 37°C in 5% CO2, the membranes were fixed, stained with Leukostat (Sigma), and placed on glass slides. Cells from the top chamber were removed with a wiper blade. Fifteen fields were counted at 400× magnification. Each experiment was performed in triplicate. Media alone was used as a negative control and subtracted from total counted cells to yield net neutrophil movement.

Chemoattractant-induced calcium influx.   Bone marrow-derived neutrophils were loaded with the calcium sensitive dye Fluo-3 (9 µmol/L acetoxymethyl ester Fluo-3; Molecular Probes, Eugene, OR) for 30 minutes at room temperature in HBSS without calcium or magnesium. Cells were stained with phycoerythrin (PE)-conjugated anti-Gr-1 antibody (Pharmingen, San Diego, CA), washed, and then resuspended in HEPES buffer (137 mmol/L NaCl, 5 mmol/L KCl, 1 mmol/L Na2HPO4, 5 mmol/L glucose, 1 mmol/L CaCl2, 0.5 mmol/L MgCl2, 0.1% BSA, and 10 mmol/L HEPES, pH 7.4). Antifluorescein antibody was added (per the manufacturer's recommendation) to quench extracellular Fluo-3 signals. The indicated agonist was added and cellular Fluo-3 fluorescence was measured continuously for 90 seconds using a Coulter ESP flow cytometer (Coulter, Hialeah, FL), as previously described.71

In vivo bacterial clearance.   All in vivo assays were performed in mice having a pure 129/SvJ background. S aureus was grown in tryptic soy broth (TSB) and passaged twice in 129/SvJ mice before use. Varying doses of S aureus were injected intraperitoneally (IP) into 129/SvJ mice to define the LD50, which was approximately 2.5 × 108 colony-forming units (CFU). Eight cathepsin G+/+ (5 male and 3 female) and 9 cathepsin G-/- (5 male and 4 female) 10-week-old mice were injected IP with 108 CFU S aureus and observed for 15 days. Deaths were recorded and analyzed.

Klebsiella pneumoniae (KPA strain) was grown in TSB and passaged once in 129/SvJ mice before use. Varying doses of K pneumoniae were injected IP into wild-type 129/SvJ mice, and the LD50 was determined to be between 5 × 105 CFU and 1 × 106 CFU. Fourteen cathepsin G+/+ and 15 cathepsin G-/- 12-week-old male mice were injected IP with 1 × 106 CFU of K pneumoniae. Deaths were recorded and analyzed.

E coli (K1) was grown in TSB and passaged twice in 129/SvJ mice before use. Varying doses of E coli were injected IP into wild-type 129/SvJ mice to determine the LD50, which was 3 × 104 CFU. This dose of bacteria was then injected IP to 13 wild-type mice, 12 cathepsin G-/- mice, and 12 NE-/- mice. Deaths were recorded and analyzed.

In vitro microbicidal assays.   The in vitro bactericidal activities of cathepsin G and NE were quantified as described.45 K pneumoniae, E coli, and S aureus were grown in TSB at 37°C and washed twice with PBS. Mid-log phase bacteria (105) were incubated in the absence or presence of purified human NE or cathepsin G (5 µg; Elastin Products Co, Owensville, MO) in a total volume of 100 µL of 10 mmol/L sodium phosphate containing 1% (vol/vol) TSB at 37°C for 4 hours. Serial dilutions were then spread on agarose plates and the number of CFUs was determined after overnight incubation. At the time of each assay, cathepsin G and NE activities were confirmed using the spectrophotometric method of peptide substrate cleavage described above.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Targeting of the cathepsin G gene in ES cells and production of mutant mice.   We electroporated RW4 ES cells (129/SvJ) with our cathepsin G targeting vector (Fig 1). Three homologous recombinants were identified (using Southern blotting with external probe A) of 192 G418-resistant colonies screened from 2 independent transfections. After injection of C57Bl/6 blastocysts, all 3 of these ES clones gave rise to highly chimeric males that were then mated to C56Bl/6 females to obtain germline transmission of the mutant cathepsin G allele. Chimeric males were also mated to 129/SvJ females to obtain germline transmission in pure 129/SvJ mice. Figure 1B is a Southern blot analysis of genomic tail DNA of progeny produced from a cross of cathepsin G+/- animals. Genomic DNA was digested with Xba I and hybridized with probe A to show bands representing the wild-type (7.6 kb) and mutant (2.6 kb) alleles. The heterozygous matings produced wild-type, heterozygous, and homozygous mice at expected ratios (+/+:+/-:-/-= 30:55:31). Cathepsin G-/- mice develop normally and are fertile. Mice were evaluated from 2 independently targeted ES clones and both had the same phenotype (data not shown).


View larger version (31K):
[in this window]
[in a new window]
 
Fig 1. The cathepsin G (CG) locus and targeting strategy. (A) The structures of the murine cathepsin G gene and the targeting vector used to create homologous recombinants are shown. The PGK-neo cassette was inserted in the antisense orientation with respect to the cathepsin G gene. The structure of the targeted locus and the sizes of fragments detected by probe A (which is completely external to the targeting construct) and probe B (the PGK-neo cassette) are shown. (B) Southern blot analysis of tail DNA from the progeny of a cross between cathepsin G+/- animals. Genomic DNA was cleaved with Xba I and the blot was hybridized with probe A. The positions of the wild-type (7.6 kb) allele and the targeted (2.2 kb) allele are shown.

Cathepsin G-/- mice contain a null mutation for cathepsin G.   Bone marrow was harvested from cathepsin G+/+, +/-, and -/- mice and total cellular RNA was prepared for analysis by S1 nuclease protection. Figure 2A (left panel) is an S1 nuclease protection analysis of bone marrow cell RNA (lanes 1, 2, and 3). RNA samples (10 µg) were hybridized with specific probes for exon 5 of murine cathepsin G and for beta 2 microglobulin (mbeta 2M). Correctly processed murine cathepsin G exon 5 mRNA protects a probe fragment of 212 nt from S1 digestion, whereas mbeta 2M mRNA protects a fragment of 190 nt. Cathepsin G mRNA is present in the bone marrow of +/+ mice, is reduced in +/- mice, and is undetectable in the bone marrow of cathepsin G-/- mice (Fig 2A). The mbeta 2M signal is present in bone marrow RNA from all 3 mice and serves as an internal control for RNA quality and content.


View larger version (33K):
[in this window]
[in a new window]
 
Fig 2. The cathepsin G mutation eliminates cathepsin G mRNA and protein expression in the bone marrow of cathepsin G-/- mice. (A) Lanes 1 through 3 show an S1 nuclease protection analysis of cathepsin G and beta 2 microglobulin mRNAs in bone marrow samples derived from +/+, +/-, and -/- mice. In lanes 4 through 6, a Western blot was performed with a rabbit antimurine cathepsin G antibody prepared against a peptide from a unique region of the cathepsin G protein (see Materials and Methods). After hybridization and chemiluminescence, the blot was stripped and reprobed for the presence of beta -actin to control for protein loading. (B) Analysis of mMCP-2 mRNA in cultured mast cells derived from the bone marrow of cathepsin G+/+ and -/- mice. An S1 nuclease protection assay was performed with probes for mouse beta 2 microglobulin and either mouse cathepsin G or mMCP-2, as indicated. The positions of probe fragments protected from S1 nuclease digestion by correctly spliced mcathepsin G and mMCP-2 are shown. Mast cell mRNA from cathepsin G+/+ animals contains easily detectable mcathepsin G mRNA. RNA derived from cathepsin G-/- mast cells shows no cathepsin G mRNA, as expected, and a 10-fold reduction in mMCP-2 mRNA levels.

Total protein extracts from cathepsin G+/+, +/-, and-/- bone marrows were analyzed by Western blotting (Fig 2A, right panel); the blot was probed sequentially with a rabbit antimurine cathepsin G antibody and a rabbit antimurine beta -actin antibody to control for protein loading. No cathepsin G protein (~29 kb) is detected in the bone marrow of cathepsin G-/- mice.

Total bone marrow extracts were evaluated for cathepsin G activity using the peptide substrate N-Succinyl-Ala-Ala-Pro-Phe-pNA. Importantly, equal amounts of human versus mouse bone marrow extracts contained virtually identical amounts of cathepsin G activity (data not shown). Marrow extracts derived from cathepsin G-/- mice have virtually no detectable cleavage of this peptide substrate (Fig 3A). Neutrophil elastase-deficient mice have normal levels of cathepsin G activity, as expected (data not shown). In contrast, cathepsin G-/- bone marrow extracts cleave the elastase-specific peptide substrate N-Methoxy Succinyl-Ala-Ala-Pro-Val-pNA as efficiently as wild-type marrow extracts, as expected (Fig 3B).


View larger version (10K):
[in this window]
[in a new window]
 
Fig 3. Cathepsin G and neutrophil elastase activities in cathepsin G-deficient mice. The activity of cathepsin G and neutrophil elastase was determined by the ability of total bone marrow protein extracts to cleave colorometric peptide substrates in vitro, as described in Materials and Methods. (A) A peptide substrate for cathepsin G (N-Succinyl-Ala-Ala-Pro-Phe-pNA) is used. Cathepsin G-/- mice have no detectable conversion of this substrate even after 30 minutes of incubation at 37°C. (B) The conversion of the neutrophil elastase-specific peptide (N-Methoxysuccinyl-Ala-Ala-Pro-Val-pNA) is shown. Wild-type and cathepsin G-/- mice have equivalent amounts of neutrophil elastase activity. These experiments were performed 3 times with identical results.

The cathepsin G mutation reduces expression of the downstream mMCP-2 gene.   Our laboratory has shown that the targeted disruption of the granzyme B gene (with a retained PGK-neo cassette) also disrupts expression of the downstream granzymes C, D, F, and G in adherent lymphokine-activated killer (AdLAK) cells derived from granzyme B-/- mice. This phenomenon is known as the neighborhood effect and is thought to be caused by the retained PGK-neo cassette in the mutant locus.72-75

The targeted mutation of the cathepsin G gene minimally alters the expression of the upstream granzymes (B, C, D, and F) in activated cytotoxic T lymphocytes and AdLAK cells.10 To determine whether the mutation in the cathepsin G gene affects expression of downstream murine mast cell chymase genes,10-13,76,77 we developed PCR-based detection methods for the mMCP-1, -2, -4, and -5 genes and screened for their presence (using PCR) on a bacterial artificial chromosome (BAC) that was known to contain the cathepsin G gene.10 Only mMCP-2, a chymase known to be expressed in mucosal mast cells,76 was present on this BAC clone, mapping approximately 30 kb downstream from the cathepsin G gene. Mast cells were cultivated from bone marrow cells that had been incubated for 3 weeks in WCM and then stimulated for 72 hours in conditioned media containing murine rIL-10 (100 U/mL).76,77 An S1 probe specific for mMCP-2 was developed and used to analyze these mast cell mRNA samples (Fig 2B). Cathepsin G was expressed in cathepsin G+/+ mast cells, but not in cathepsin G-/- mast cells, as expected (lanes 1 and 3, respectively). However, whereas mMCP-2 is expressed in cathepsin G+/+ mast cells, there is a 10-fold reduction (as determined by phosphorimaging) of mMCP-2 mRNA levels in cathepsin G-/- mast cell mRNA (lanes 2 and 4, respectively). Although bone marrow samples and cultured mast cells appear to have nearly equivalent levels of cathepsin G mRNA, the level of cathepsin G mRNA per expressing cell may be much higher in promyelocytes, because these are the only bone marrow cells that contain detectable cathepsin G mRNA and because they comprise only 1% to 2% of total bone marrow cells.2,7

Hematopoiesis, lymphopoiesis, and myeloid granule development are normal in cathepsin G-/- mice.   We compared the hematopoietic development of multiple cathepsin G+/+ and cathepsin G-/- mice derived from 2 different ES cell lines. Complete blood counts and differentials showed no differences between cathepsin G+/+ and cathepsin G-/- animals (n = 8, data not shown). Cytospins of bone marrow cells from cathepsin G+/+ and cathepsin G-/- mice were Wright-Giemsa stained and evaluated for the presence of myeloperoxidase and chloroacetate esterase activity; no clear differences were detected (Fig 4A and B). Transmission electron micrography of bone marrow-derived neutrophils from cathepsin G-/- mice showed normal numbers of electron-dense (azurophil) granules (Fig 4C) and normal neutrophil morphology. The thymic and splenic tissues of cathepsin G-/- mice were evaluated by flow cytometry, using the markers for CD3, CD4, CD8, B220, and NK1.1, as previously described.66 Normal numbers and proportions of all lymphoid compartments were present in both organs, as well as in the peripheral blood (data not shown). Similarly, normal numbers of Gr-1-positive and CD11b-positive cells were present in the bone marrow and peripheral blood of the mutant mice (data not shown).


View larger version (85K):
[in this window]
[in a new window]
 
Fig 4. Morphology of neutrophils derived from cathepsin G-deficient animals. Bone marrow cells were stained with choracetate esterase (A) or myeloperoxidase stains (B) using conditions recommended by the manufacturer (Sigma). The reddish-pink stain in (A) represents chloracetate esterase activity, and the dark brown stain in (B) represents myeloperoxidase activity. Transmission electron microscopic (TEM) images of bone marrow derived neutrophils are shown in (C). Note that cathepsin G-/- neutrophils have equal numbers of electron-dense granules and normal morphology.

Normal hemostasis in cathepsin G-/- mice.   Cathepsin G-/- mice do not hemorrhage at birth and clot normally when tailed or subjected to retroorbital bleeding. The bleeding time of cathepsin G-/- mice is 3.9 ± 2 minutes (n = 6), a value that is not different from the bleeding times of wild-type littermate controls (4.2 ± 1.5 minutes, n = 6). Histopathologic examination of the spleens, livers, kidneys, and lungs from 1- to 2-year-old cathepsin G-/- mice showed no evidence of microthrombosis or chronic organ damage of any kind (data not shown).

Phagocytosis and superoxide production are normal in cathepsin G-/- neutrophils.   Neutrophils isolated from bone marrow were incubated with FITC-labeled latex beads and observed under a fluorescent microscope. At least 98% of cathepsin G+/+ and cathepsin G-/- neutrophils engulfed >= 10 beads. In addition, cathepsin G+/+ and cathepsin G-/- mice were injected IP with 2 mL of zymosan. Four hours later, cells were harvested and cytospins were made. Again, at least 98% of cathepsin G+/+ and cathepsin G-/- neutrophils had engulfed at least 10 zymosan particles.

alpha -1 antichymotrypsin, a serpin that inhibits cathepsin G, has been shown to inhibit neutrophil superoxide production in vitro78,79; we therefore asked whether cathepsin G was required for this response. Bone marrow neutrophils from cathepsin G+/+ and cathepsin G-/- mice were stimulated with 0 to 25 µg/mL PMA, and cells were analyzed for superoxide production. Cathepsin G deficiency had no significant effect on the production of superoxide at these concentrations of PMA (data not shown).

Cathepsin G-/- neutrophils have normal in vitro and in vivo chemotaxis.   Membrane-bound cathepsin G has been suggested to play a role in chemotaxis, although the mechanism by which it functions in this setting is unknown. We therefore examined the in vitro chemotaxis of cathepsin G-/- neutrophils using a Boyden chamber using optimal concentrations of C5a (7% zymosan-activated serum), fMLP (10-4 mol/L; we confirmed that a much higher concentration of fMLP is required for the optimal chemotaxis of murine neutrophils [10-4 mol/L] compared with human neutrophils [10-7 mol/L]70), or recombinant human IL-8 (250 µg/mL), as shown in Fig 5A. There was no significant reduction in the chemotaxis of cathepsin G-/- neutrophils towards any of these reagents.


View larger version (15K):
[in this window]
[in a new window]
 
Fig 5. Cathepsin G-/- neutrophils have normal chemotaxis towards a variety of stimuli in vitro and in vivo. (A) Cathepsin G-/- neutrophils have normal chemotaxis in vitro. Bone marrow-derived neutrophils from wild-type (+/+) and cathepsin G-deficient mice (-/-) were added to the top of a modified micro-Boyden chamber with the chemoattractant on the bottom well. Maximally effective concentrations of fMLP (10-4 mol/L), C5a (7% zymosan activated serum), and rhIL-8 (250 ng/mL) were used. Net neutrophil movement per high power field (HPF) is defined as total neutrophils minus neutrophils migrating towards the media control (between 11 and 15 for different experiments). The data represent the mean from 4 individual mice per group each performed in triplicate. Bars represent standard deviations. (B) Quantitation of the total cells and neutrophils in peritoneal lavage fluid from thioglycolate-treated mice. Mice were injected with 2 mL of thioglycolate IP, and, at the indicated times, peritoneal cells were harvested by lavage and quantified. Cathepsin G +/+ and -/- mice demonstrate nearly identical numbers of total cells and neutrophils in the peritoneal harvests. This experiment was repeated 3 times with similar results. (C) Inflammation induced by IP injection of S aureus is not altered in cathepsin G-/- mice. S aureus (108 CFU) was injected into the peritoneal cavities of 3 cathepsin G+/+ or -/- mice, and peritoneal lavage was performed 2 hours later. There is no significant difference between the total cells or the number of neutrophils harvested from cathepsin G+/+ or -/- mice. This experiment was repeated twice with similar results.

To determine whether in vivo chemotaxis was altered in cathepsin G-/- mice, we injected 2 mL (58 mg) of thioglycolate IP into cathepsin G+/+ and cathepsin G-/- mice and, at various time points, peritoneal cells were collected by lavage and quantified and cell type differentials were performed. As shown in Fig 5B, there was no difference in either the total number of cathepsin G+/+ and cathepsin G-/- cells or the number of cathepsin G+/+ and cathepsin G-/- neutrophils at 4 or 24 hours after injection. Similar results were obtained 48 hours after injection (data not shown).

To further assess in vivo chemotaxis, we wanted to determine whether cathepsin G-/- neutrophils would migrate normally to a site of bacterial infection. We therefore injected 3 cathepsin G+/+ and 3 cathepsin G-/- mice with 108 CFU of S aureus IP. At 2 hours, cells were harvested from the peritoneum and total cell counts and total number of neutrophils were determined, as shown in Fig 5C; there was no significant difference between the total number of cells or the total number of neutrophils in the peritoneal harvests from the wild-type versus cathepsin G-/- mice.

Finally, we wished to determine whether cathepsin G-deficient neutrophils had any defects in the early signaling pathways of fMLP, C5A, or IL-8. We therefore loaded wild-type or cathepsin G-deficient neutrophils with the calcium-sensitive dye Fluo-3 and added either no agonist (Mock) or optimal concentrations of fMLP (10-4 mol/L), C5a (7% Zymosan activated serum), or recombinant human IL-8 (250 ng/mL) and measured the mean fluorescent intensity in the neutrophils at 5-second intervals in Gr-1-positive cells. For each of the agonists, cathepsin G-/- neutrophils mediated calcium fluxes at least as efficiently as their wild-type counterparts (data not shown). This indicates that cathepsin G deficiency does not alter the function of the receptors for any of these chemoattractant molecules or reduce their ability to mediate calcium fluxes.

Normal survival of cathepsin G-/- mice in response to S aureus, K pneumoniae, or E coli challenges.   Because cathepsin G had previously been shown to be bactericidal for a variety of organisms, we wished to determine whether cathepsin G-/- mice were more susceptible to death induced by Gram-positive or Gram-negative bacterial species. We first determined that 108 CFU of S aureus killed 1 of 6 wild-type 129/SvJ mice, whereas 5 × 108 CFU killed 6 of 6 mice. We injected 1 × 108 CFU of S aureus IP into 8 additional cathepsin G+/+ and 9 cathepsin G-/- 129/SvJ mice. The survival of cathepsin G+/+ versus cathepsin G-/- animals was not significantly different (Fig 6A).


View larger version (14K):
[in this window]
[in a new window]
 
Fig 6. Survival of mice challenged with IP injections of S aureus, E coli, and K pneumoniae. (A) Cathepsin G+/+ or -/- mice in the 129/SvJ strain were challenged with 108 CFU of S aureus. There is no significant difference between the survival of +/+ and -/- animals. (B) K pneumoniae (1 × 106 CFU) was injected IP into cathepsin G+/+ or -/- animals in the 129/SvJ strain, and survival was plotted. No difference in survival was noted for the 2 groups. (C) Survival of wild-type, cathepsin G-/-, and NE-/- mice in response to IP challenge with E coli. E coli (3 × 104 CFU) was injected IP into groups of 12 cathepsin G-/-, NE-/-, and wild-type (+/+) littermates and survival was assessed over time. The survival of cathepsin G-/- mice is not different from that of wild-type, but the survival NE-/- mice is significantly less than that of the other groups (P <=  .01).

Similarly, we wanted to determine whether cathepsin G was required for the clearance of Gram-negative organisms. K pneumoniae and E coli were chosen, because neutrophil elastase-deficient mice have been shown to have a defect in the clearance of both organisms.80 Three different doses of K pneumoniae (1 × 105, 5 × 105, or 1 × 106 CFU) were injected IP into a total of 27 cathepsin G+/+ mice and 23 cathepsin G-/- mice. At every dose tested, the survival of cathepsin G-/- mice was not different from that of wild-type mice. Data from the 1 × 106 CFU dose are shown in Fig 6B. There is a trend toward fewer deaths in cathepsin G-/- mice, but this difference is not statistically significant.

Finally, we defined the LD50 for E coli in 129/SvJ mice, which was 3 × 104 CFU. This dose of bacteria was administered IP to 13 wild-type mice, 12 neutrophil elastase-/- mice, or 12 cathepsin G-/- mice, all in the pure 129/SvJ background. As shown in Fig 6C, the neutrophil elastase-deficient mice all succumb to the E coli infection within 48 hours, whereas approximately 50% of both wild-type and cathepsin G-deficient mice survive. The difference between the survival of NE-/- mice versus wild-type or cathepsin G-/- mice is statistically significant (P < .01).

Human cathepsin G does not inhibit growth of E coli or K pneumoniae in vitro, but neutrophil elastase does.   Because previous reports of the microbicidal activities of cathepsin G had exclusively used purified human cathepsin G and because 2 of the microbicidal peptides of human cathepsin G (aa 77-83 and aa 117-136) are not completely conserved in mice (see Discussion), we decided to directly test and compare the microbicidal activities of highly purified human cathepsin G and neutrophil elastase. We incubated 105 mid-log phase bacteria in the absence or presence of purified human cathepsin G or neutrophil elastase (both at 50 µg/mL) for 4 hours. Bacterial killing was quantified by applying serial dilutions of bacteria to agarose plates followed by overnight incubation. Although human neutrophil elastase inhibits the growth of both K pneumoniae and E coli, as previously shown,80 the same dose of cathepsin G has no effect on the growth of either organism (Fig 7). Neither enzyme affects the growth of S aureus.


View larger version (16K):
[in this window]
[in a new window]
 
Fig 7. Purified human neutrophil elastase inhibits the growth of E coli and K pneumoniae, but human cathepsin G does not. Mid-log phase bacteria (105) were incubated in the absence (control) or presence of purified human neutrophil elastase or cathepsin G at 37°C for 4 hours, as described in Materials and Methods. Serial dilutions were immediately spread on agarose plates and the number of CFUs was determined after overnight incubation. Although neutrophil elastase inhibits the growth of both Gram-negative rods, cathepsin G does not. Neither enzyme effects the growth of S aureus. This experiment was repeated twice with similar results.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In this report, we describe mice bearing a loss-of-function mutation of the cathepsin G gene. These mice have normal growth, development, and fertility and display normal hematopoietic development. The neutrophils of cathepsin G-/- mice have normal morphology, normal phagocytosis, and normal production of superoxide in response to in vitro stimuli. These neutrophils have no defect in their ability to migrate towards a variety of chemotactic stimuli in vitro and in vivo. Cathepsin G-/- mice are able to clear S aureus, K pneumoniae, and E coli infections as efficiently as wild-type animals, suggesting that this enzyme is not necessary for the normal clearance of any of these bacterial species.

Even though cathepsin G is one of the most abundant proteins found in human and mouse neutrophils, mice that are deficient for this enzyme have no clear-cut phenotype, except for a transient defect in wound healing that is accompanied by excessive neutrophilic infiltration of wounds.65 The minimal phenotype observed is quite surprising, because a large body of literature has strongly suggested that cathepsin G might have specific, nonredundant functions in physiologic settings.

One potential reason for the lack of an obvious phenotype in these animals is that the cathepsin G mutation is not truly null. However, cathepsin G mRNA and protein are not detectable in cathepsin G-/- mice. Even more importantly, bone marrow extracts from cathepsin G-/- mice have no detectable ability to cleave the peptide substrate N-Succinyl-Ala-Ala-Pro-Phe-pNA. The complete lack of protease activity against this substrate indicates that there are no other enzymes with the same specificity in the bone marrow. This result also suggests that, if the functions of cathepsin G can be rescued by other proteases (eg, neutrophil elastase, azurocidin, and/or proteinase-3, which are all presumably present at normal levels in cathepsin G-/- mice), then these functions must be rescued by protease activities that are different from that of cathepsin G. This result argues that the gene that we have knocked-out is indeed the functional orthologue of human cathepsin G, because human cathepsin G also cleaves this peptide substrate with high specificity. It is also possible that cathepsin G has specific functions that are masked by the presence of the other related azurophil granule proteases in vivo. Neutrophil elastase, azurocidin, and proteinase-3 are clustered on a different chromosome (19 pter) and are coordinately regulated and expressed along with cathepsin G in the azurophil granules of promyelocytes. The functions of these highly related proteases may be difficult to fully define until mice deficient for more than 1 of these enzymes are analyzed.

The only assay that suggests that cathepsin G may have unique substrates in vivo is wound healing. In the wound healing studies, we learned that incisional wounds displayed a significant reduction in tensile strength on day 7 after wounding; this defect was associated with increased neutrophilic inflammation at the site of wounding.65 The wound strength had completely normalized by day 10. The wound fluid of cathepsin G-deficient mice contained significantly increased chemotactic activity for wild-type neutrophils, suggesting that increased levels of proinflammatory cytokines (or other mediators) were present in this wound fluid. Indirectly, these data suggest that cathepsin G may be involved in inactivating proinflammatory molecules at the sites of wound injury, thereby providing a dampening effect on continued neutrophil influx at these sites. Although the precise molecules responsible for this effect are not known, the ability of cathepsin G to cleave and inactivate IL-1, TNF, and IL-854-56 suggest that one or more of these molecules could be involved in this process.

Cathepsin G has been shown to cleave and inactivate several clotting factors,21-26 cleave and/or modulate the function of the thrombin receptor,27-29 and activate platelets in vitro.30-38 However, we found no gross hemostatic defects in cathepsin G-/- animals. Because neutrophil elastase has activity in many of the same in vitro assays involving clotting factors and platelet activation, this enzyme may be capable of substituting for cathepsin G in this setting; however, neutrophil elastase deficient mice also have no obvious defects in hemostasis.80 It will therefore be important to determine whether mice doubly deficient for both cathepsin G and neutrophil elastase have more severe defects in hemostasis.

Cathepsin G-deficient mice have no apparent defect in their ability to clear S aureus, K pneumoniae, or E coli. A large number of studies had previously suggested that purified human cathepsin G had growth-inhibitory effects and/or bactericidal effects on S aureus, E coli, and additional bacteria in vitro and that the protease activity of cathepsin G was not required for this effect. Three different peptides derived from human cathepsin G (aa 1-5, aa 77-83, and aa 117-136) have been shown to have microbicidal activity. Although the first peptide (aa 1-5) is conserved in the mouse, the sequence of the second peptide (aa 77-83) in mice is HPDYNPQ. Alanine substitutions in positions 3, 6, and 7 of the human HPQYNQR peptide each reduce bactericidal activity of the peptide by approximately 2.5-fold.48 The third peptide (aa 117-136) contains 16 of 20 identical residues in the mouse, but 2 of the 4 arginine residues that are important for microbicidal function are altered (Arg 117 Gln and Arg 133 Ser). Because the 77-83 and 117-136 peptides are not completely conserved, it is possible that human cathepsin G is important for bacterial killing, but murine cathepsin G is not. However, in this study, we have not been able to demonstrate a role for human cathepsin G in bacterial killing in vitro, in contrast to previously published work. Although we do not understand the reason for this difference, our in vitro and in vivo results do corroborate one another.

Neutrophil elastase-deficient mice have a defect in their ability to clear both K pneumoniae and E coli.80 Purified human neutrophil elastase inhibits the growth of these two Gram-negative rods, but equivalent concentrations of human cathepsin G had no inhibitory activity. The preparations of enzymes that were used in these assay were both fully active, and the concentrations of the enzymes were carefully confirmed. Therefore, human and murine neutrophil elastase both have a specific, nonredundant ability to kill Gram-negative rods in vitro and in vivo; cathepsin G cannot substitute for this function in either setting.

Several recent studies have suggested that cathepsin G is not only found in the azurophil granules of neutrophils, but also on the surface of these cells.17,18,81 A role for cathepsin G on the cell surface has been suggested by the fact that alpha 1 antichymotrypsin (and also antibodies specific for cathepsin G) can reduce the ability of neutrophils to undergo chemotaxis towards a variety of stimuli.19,20 These results suggested that cell surface-associated cathepsin G may play a specific role in the chemotactic response. Additionally, cathepsin G itself has been shown to have chemotactic activity for neutrophils and monocytes, suggesting that cathepsin G release by neutrophils may amplify a chemoattractant response.82 However, our data showed that there is no specific chemotactic defect for cathepsin G-deficient neutrophils using fMLP, C5a, or rhIL-8 as the chemotactic stimuli. Similarly, neutrophil calcium fluxes induced by these 3 molecules are essentially normal in cathepsin G-/- neutrophils. In vivo, we observed no clear defect in the ability of neutrophils to migrate into the peritoneal space of mice treated with thioglycolate or S aureus, suggesting that the in vivo chemoattractant response (and also the ability of neutrophils to leave the circulation and migrate into the peritoneal space) is not impaired in these mice. Although the possibility clearly exists that other proteases can substitute for the function of cathepsin G in this setting, it is also possible that cathepsin G may not be required for neutrophil chemotaxis in vivo.

Lymphokine-activated killer cells derived from mice that contain a retained PGK-neo cassette in the granzyme B gene demonstrate a loss of granzyme B mRNA, as expected, but also lose expression of granzymes C, D, F, and G. This phenomenon, known as the neighborhood effect, is thought to be due to the productive interaction of a locus control region (LCR; presumably upstream from granzyme B) with the PGK-neo cassette; this may disrupt normal interactions between the LCR and the downstream granzyme genes. In mice containing the granzyme B mutation, cathepsin G mRNA levels are normal.10,66 We have also shown that the retained PGK-neo cassette in the cathepsin G gene has minimal effects on the expression of the granzymes, suggesting that the neighborhood effect is predominantly unidirectional.10 In this report, we show that mast cells cultured in vitro from cathepsin G-deficient mice contain no cathepsin G mRNA, as expected, but also demonstrate a 10-fold reduction in mMCP-2 mRNA levels. These data strongly suggest that the retained PGK-neo cassette in the cathepsin G gene has a neighborhood effect on the mMCP-2 gene (and perhaps on additional members of the mast cell chymase family located further downstream). These data also suggest that this large protease gene cluster may contain at least 2 distinct regulatory domains. One domain would include all of the granzyme genes upstream from cathepsin G; this domain may be regulated by an LCR near granzyme B. The second domain, which would include cathepsin G and the mast cell chymases, may be controlled by a separate LCR that is active in the myeloid compartment, but not the NK/T-compartment. Further experiments will be required to test this hypothesis.

In summary, our experiments have shown that many of the previously defined in vitro activities of cathepsin G are either irrelevant or redundant when a whole animal model of cathepsin G deficiency is examined. Additional experiments will be required to further define the normal functions of cathepsin G, using mice that are also deficient for neutrophil elastase or the related azurophil granule proteases azurocidin and/or proteinase 3.


    ACKNOWLEDGMENT

The authors thank Dr Bob Senior for many helpful discussions, Robin Wesselschmidt for blastocyst injections, and Pam Goda and Kelly Schrimpf for excellent animal care. We thank Dan Link and Jeff Haug for performing the neutrophil calcium flux assays, Diane Kelley for the chemotaxis assays, Marilyn Levy for Transmission Electron Microscopy, and Sujan Shresta for the flow studies of lymphoid organs. Nancy Reidelberger expertly prepared the manuscript.


    FOOTNOTES

Submitted April 8, 1999; accepted October 4, 1999.

Supported by National Institutes of Health Grants No. DK49786 and CA49712 (to T.J.L.), BL03774 (to C.T.N.P.), and HL54853 (to S.D.S.).

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

Address reprint requests to Timothy J. Ley, MD, Washington University Medical School, Division of Bone Marrow Transplantation and Stem Cell Biology, 660 S Euclid Ave, Campus Box 8007, St Louis, MO 63110; e-mail: timley{at}im.wustl.edu.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Bainton DF, Ullyot JL, Farquhar MG: The development of neutrophilic polymorphonuclear leukocytes in the human bone marrow. J Exp Med 134:907, 1971 [Abstract]

2. Hanson RK, Connolly NL, Burnett D, Campbell EJ, Senior RM, Ley TJ: Developmental regulation of the human cathespin G gene in myelomonocytic cells. J Biol Chem 265:1524, 1990 [Abstract/Free Full Text]

3. Heck LW, Rostand KS, Hunter FA, Brown A: Isolation, characterization, and amino-terminal amino acid sequence analysis of human neutrophil cahtepsin G from normal donors. Anal Biochem 158:217, 1986 [Medline] [Order article via Infotrieve]

4. Salvesen G, Farley D, Shuman J, Przybyla A, Reilly C, Travis J: Molecular cloning of human cathepsin G: Structural similarity to mast cell and cytotoxic T lymphocyte proteinases. Biochemistry 26:2289, 1987 [Medline] [Order article via Infotrieve]

5. Hof P, Mayr I, Huber R, Korzus E, Potempa J, Travis J, Powers JC, Bode W: The 1.8 A crystal structure of human cathepsin G in complex with Suc-Val-Pro-PheP-(OPh)2: A Janus-faced proteinase with two opposite specificities. EMBO J 15:5481, 1996 [Medline] [Order article via Infotrieve]

6. Hohn PA, Popescu NC, Hanson RD, Salvesen G, Ley TJ: Genomic organization and chromosomal localization of the human cathepsin G gene. J Biol Chem 23:13412, 1989

7. Heusel JW, Scarpati EM, Jenkins NA, Gilbert DJ, Copeland NG, Shapiro SD, Ley TJ: Molecular cloning, chromosomal location, and tissue-specific expression of the murine cathepsin G gene. Blood 81:1614, 1993 [Abstract/Free Full Text]

8. Crosby JL, Bleackley RC, Nadeau JH: A complex of serine protease genes expressed preferentially in cytotoxic T-lymphocytes is closely linked to the T-cell receptor alpha - and delta -chain genes on mouse chromosome 14. Genomics 6:252, 1990 [Medline] [Order article via Infotrieve]

9. Hanson RD, Hohn PA, Popescu NC, Ley TJ: A cluster of hematopoietic serine protease genes is found on the same chromosomal band as the human alpha /delta T-cell receptor locus. Proc Natl Acad Sci USA 87:960, 1990 [Abstract/Free Full Text]

10. Pham CTN, MacIvor DM, Hug BA, Heuse JW, Ley TJ: Long-range disruption of gene expression by a selectable marker cassette. Proc Natl Acad Sci USA 93:13090, 1996 [Abstract/Free Full Text]

11. Huang R, Blom T, Hellman L: Cloning and structural analysis of mMCP-1, mMCP-4, and mMCP-5, three mouse mast cell-specific serine proteases. Eur J Immunol 21:1611, 1991 [Medline] [Order article via Infotrieve]

12. Caughey GH, Schaumberg TH, Zerweck EH, Butterfield JH, Hanson RD, Silverman GA, Ley TJ: The human mast cell chymase gene (CMA1): Mapping to the cathepsin G/granzyme gene cluster and lineage-restricted expression. Genomics 15:614, 1993 [Medline] [Order article via Infotrieve]

13. Gurish MF, Nadeau JH, Johnson KR, McNeil HP, Grattan KM, Austen KF, Stevens RL: A closely linked complex of mouse mast cell-specific chymase genes on chromosome 14. J Biol Chem 268:11372, 1993 [Abstract/Free Full Text]

14. Zimmer M, Medcalf RL, Fink TM, Mattman C, Lichter P, Jenne DE: Three human elastase-like genes coordinately expressed in the myelomonocyte lineage are organized as a single genetic locus on 19pter. Proc Natl Acad Sci USA 89:8215, 1992 [Abstract/Free Full Text]

15. Grisolano JL, Sclar GM, Ley TJ: Early meyloid-specific expression of the human cathepsin G gene in transgenic mice. Proc Natl Acad Sci USA 91:8989, 1994 [Abstract/Free Full Text]

16. Tanaku T, Minematsu Y, Reilly CF, Travis J, Powers JC: Human leukocyte cathepsin G. Subsite mapping with 4-nitroanilides, chemical modification, and effect of possible cofactors. Biochemistry 24:2040, 1985 [Medline] [Order article via Infotrieve]

17. Maison CM, Villiers CL, Colomb MG: Proteolysis of C3 on U937 cell plasma membranes. J Immunol 147:921, 1991 [Abstract]

18. Owen CA, Campbell MA, Sannes PL, Boukedes SS, Campbell EJ: A surface-bound elastase and cathepsin G on human neutrophils: A novel, non-oxidative mechanism by which neutrophils focus and preserve catalytic activity of serine proteases. J Cell Biol 131:775, 1995 [Abstract/Free Full Text]

19. Stockley RA, Shaw J, Afford SC, Morrison HM, Burnett D: Effect of alpha-1-proteinase inhibitor on neutrophil chemotaxis. Am J Respir Cell Mol Biol 2:163, 1990

20. Lomas DA, Stone SR, Llewellyn-Jones C, Keogan M-T, Wang Z, Rubin H, Carrell RW, Stockley RA: The control of neutrophil chemotaxis by inhibitors of cathepsin G and chymotrypsin. J Biol Chem 270:23437, 1995 [Abstract/Free Full Text]

21. Gramse M, Bingenheimer C, Havemann K: Degradation of human fibrinogen by chymotrypsin-like neutral protease from human granulocytes. Thromb Res 19:210, 1980

22. Turkington PT, Blumsom NL, Elmore DT: The degradation of bovine and human prothrombin by human polymorphonuclear leukocyte cathepsin G. Thromb Res 44:339, 1996

23. Brezniak DV, Brower MS, Witting JI, Walz DA, Fenton JW II: Human alpha- to zeta-thrombin cleavage occurs with neutrophil cathepsin G or chymotrypsin while fibrinogen clotting activity is retained. Biochemistry 29:3536, 1990 [Medline] [Order article via Infotrieve]

24. Turkington PT: Cathepsin G, a regulator of human vitamin K. Dependent clotting factors and inhibitors. Thromb Res 67:147, 1992 [Medline] [Order article via Infotrieve]

25. Anderssen T, Halvorsen H, Bajaj SP, Osterud B: Human leukocyte elastase and cathepsin G inactivate factor VII by limited proteolysis. Thromb Haemost 70:414, 1993 [Medline] [Order article via Infotrieve]

26. Allen DH, Tracy PB: Human coagulation factor V is activated to the functional cofactor by elastase and cathepsin G expressed at the monocyte surface. J Biol Chem 270:1408, 1995 [Abstract/Free Full Text]

27. Weksler BB, Jaffe EA, Brower MS, Cole OF: Human leukocyte cathepsin G and elastase specifically suppress thrombin-induced prostacyclin production in human endothelial cells. Blood 74:1627, 1989 [Abstract/Free Full Text]

28. Molino M, Blanchard N, Belmonte E, Tarver AP, Abrams C, Hoxie JA, Cerletti C, Brass LF: Proteolysis of the human platelet and endothelial cell thrombin receptor by neutrophil-derived cathepsin G. J Biol Chem 270:11168, 1995 [Abstract/Free Full Text]

29. Renesto P, Chignard M: Enhancement of cathepsin G-induced platelet activation by leukocyte elastase: Consequence for the neutrophil-mediated platelet activation. Blood 82:139, 1993 [Abstract/Free Full Text]

30. Selak MA, Chignard M, Smith JB: Cathepsin G is a strong platelet agonist released by neutrophils. Biochem J 251:293, 1988 [Medline] [Order article via Infotrieve]

31. Selak MA, Smith JB: Cathepsin G binding to human platelets. Am J Physiol 266:39, 1990

32. Ferrer-Lopez P, Renesto P, Schattner M, Bassot S, Laurent P, Chignard M: Activation of human platelets by C5a-stimulated neutrophils: A role for cathepsin G. Am J Physiol 258:C1100, 1990 [Abstract/Free Full Text]

33. Evangelista V, Rajtar G, de Gaetano G, White JG, Cerletti C: Platelet activation by fMLP-stimulated polymorphonuclear leukocytes: The activity of cathepsin G is not prevented by antiproteinases. Blood 77:2379, 1991 [Abstract/Free Full Text]

34. Evangelista V, Piccardone P, White JG, de Gaetano G, Cerletti C: Cathepsin G-dependent platelet stimulation by activated polymorphonuclear leukocytes and its inhibition by antiproteinases: Role of P-selectin-mediated cell-cell adhesion. Blood 81:2947, 1993 [Abstract/Free Full Text]

35. LaRosa CA, Rohrer MJ, Benoit SE, Rodino LJ, Barnard MR, Michelson AD: Human neutrophil cathepsin G is a potent platelet activator. J Vasc Surg 19:306, 1994 [Medline] [Order article via Infotrieve]

36. Cerletti C, Evangelista V, Molino M, de Gaetano G: Platelet activation by polymorphonuclear leukocytes: Role of cathepsin G and P-selectin. Thromb Haemost 74:218, 1995 [Medline] [Order article via Infotrieve]

37. Si-Tahar M, Renesto P, Falet H, Rendu F, Chignard M: The phospholipase C/protein kinase C pathway is involved in cathepsin G-induced human platelet activation. Comparison with thrombin. Biochem J 313:401, 1996

38. Renesto P, Si-Tahar M, Moniatte M, Balloy V, Van Dorsselaer A, Pidard D, Chignard M: Specific inhibition of thrombin-induced cell activation by the neutrophil proteinases elastase, cathepsin G, and proteinase 3: Evidence for distinct cleavage sites within the aminoterminal domain of the thrombin receptor. Blood 89:1944, 1997 [Abstract/Free Full Text]

39. Odeberg H, Olsson I: Antibacterial activity of cationic proteins from human granulocytes. J Clin Invest 56:1118, 1975

40. Odeberg H, Olsson I: Mechanisms for the microbicidal activity of cationic proteins of human granulocytes. Infect Immunity 14:1269, 1975

41. Shafer WM, Onunka VC, Martin LE: Antigonococcal activity of human neutrophil cathepsin G. Infect Immunity 54:184, 1986 [Abstract/Free Full Text]

42. Shafer WM, Onunka VC: Mechanism of staphylococcal resistance to non-oxidative antimicrobial action of neutrophils: Importance of pH and ionic strength in determining the bacterial action of cathepsin G. J Gen Microbiol 135:825, 1989 [Abstract/Free Full Text]

43. Alford CE, Amaral E, Campbell PA: Listericidal activity of human neutrophil cathepsin G. J Gen Microbiol 136:997, 1990 [Abstract/Free Full Text]

44. Guyonnet V, Johnson JK, Bangalore N, Travis J, Long PL: In vitro activity of the human neutrophil cathepsin G on Eimeria tenella sporozoites. J Parasitol 77:775, 1991 [Medline] [Order article via Infotrieve]

45. Miyasaki KT, Bodeau AL: In vitro killing of oral Capnocytophaga by granule fractions of human neutrophils is associated with cathepsin G activity. J Clin Invest 87:1585, 1991

46. Bangalore N, Travis J, Onunka VC, Pohl J, Shafer WM: Identification of the primary antimicrobial domains in human neutrophil cathepsin G. J Biol Chem 265:13584, 1990 [Abstract/Free Full Text]

47. Shafer WM, Polh J, Onunka VC, Bangalore N, Travis J: Human lysosomal cathepsin G and granzyme B share a functionally conserved broad spectrum antibacterial peptide. J Biol Chem 266:112, 1991 [Abstract/Free Full Text]

48. Shafer WM, Hubalek F, Huang M, Pohl J: Bactericidal activity of a synthetic peptide (CG 117-136) of human lysosomal cathepsin G is dependent on arginine content. Infect Immunity 64:4842, 1996 [Abstract/Free Full Text]

49. Reilly CF, Tewksbury DA, Schechter NM, Travis J: Rapid conversion of angiotensin I to angiotensin II by neutrophil and mast cell proteinases. J Biol Chem 257:8619, 1982 [Abstract/Free Full Text]

50. Nahori M-A, Renesto P, Vargaftig BB, Chignard M: Activation and damage of cultured airway epithelial cells by human elastase and cathepsin G. Eur J Pharmacol 228:213, 1992 [Medline] [Order article via Infotrieve]

51. Sommerhoff CP, Nadel JA, Basbaum CB, Caughey GH: Neutrophil elastase and cathepsin G stimulate secretion from cultured bovine airway gland serous cells. J Clin Invest 85:682, 1990

52. Peterson MW: Neutrophil cathepsin G increases transendothelial albumin flux. J Lab Clin Med 113:297, 1989 [Medline] [Order article via Infotrieve]

53. Franzoso G, Biswas P, Poli G, Carlson LM, Brown KD, Tomita-Yamaguchi M, Fauci AS, Siebenlist UK: A family of serine proteases expressed exclusively in myelo-monocytic cells specifically processes the nuclear factor-Kappa B subunit p65 in vitro and may impair human immunodeficency virus replication in these cells. J Exp Med 180:1445, 1994 [Abstract/Free Full Text]

54. Scuderi P, Nez PA, Derr ML, Wong BJ, Valdez CM: Cathepsin-G and leukocyte elastase inactivate human tumor necrosis factor and lymphotoxin. Cell Immunol 135:299, 1991 [Medline] [Order article via Infotrieve]

55. Hazuda DM, Strickler J, Kueppers F, Simon PL, Young PR: Processing of precursor interleukin 1 beta and inflammatory disease. J Biol Chem 265:6318, 1990 [Abstract/Free Full Text]

56. Padrines M, Wolf M, Walz A, Baggiolini M: Interleukin-8 processing by neutrophil elastase, cathepsin G and proteinase-3. FEBS Lett 352:231, 1994 [Medline] [Order article via Infotrieve]

57. Malemud CJ, Janoff A: Identification of neutral proteases in human neutrophil granules that degrade articular cartilage proteoglycan. Arthritis Rheum 18:361, 1975 [Medline] [Order article via Infotrieve]

58. Roughley PJ, Barrett AJ: The degradation of cartilage proteoglycans by tissue proteinases. Proteoglycan structure and its susceptibility to proteolysis. Biochem J 167:629, 1977 [Medline] [Order article via Infotrieve]

59. Starkey PM, Barrett AJ, Burleigh MC: The degradation of articular collagen by neutrophil proteinases. Biochem Biophys Acta 483:386, 1977 [Medline] [Order article via Infotrieve]

60. Wintroub BU, Coblyn JS, Kaempfer CE, Austen KF: Cleavage of fibronectin by the human neutrophil neutral peptide-generating protease. Proc Natl Acad Sci USA 77:5448, 1980 [Abstract/Free Full Text]

61. Reilly CF, Travis J: The degradation of human lung elastin by neutrophil proteinases. Biochim Biophys Acta 621:147, 1980 [Medline] [Order article via Infotrieve]

62. Vartio T, Seppa H, Vaheri A: Susceptibility of soluble and matrix fibronectins to degradation by tissue proteinases, mast cell chymase and cathepsin G. J Biol Chem 256:471, 1981 [Free Full Text]

63. Vartio T: Characterization of the binding domains in the fragments cleaved by cathepsin G from human plasma fibronectin. Eur J Biochem 123:223, 1982 [Medline] [Order article via Infotrieve]

64. Capodici C, Berg RA: Cathepsin G degrades denatured collagen. Inflammation 13:137, 1989 [Medline] [Order article via Infotrieve]

65. Abbott RE, Corral CJ, MacIvor DM, Lin X, Ley TJ, Mustoe TA: Augmented inflammatory responses and altered wound healing in cathepsin G-deficient mice. Arch Surg 133:1002, 1998 [Abstract/Free Full Text]

66. Heusel JW, Wesselschmidt R, Shresta S, Russell J, Ley TJ: Cytotoxic lymphocytes require granzyme B for the rapid induction of DNA fragmentation and apoptosis in allogeneic target cells. Cell 76:977, 1994 [Medline] [Order article via Infotrieve]

67. Ley TJ, Maloney KA, Gordon JI, Schwartz AL: Globin gene expression in erythroid human fetal liver cells. J Clin Invest 83:1032, 1989

68. Senior R, Campbell EJ: Cathepsin G in human mononuclear phagocytes: Comparisons between monocytes and U937 monocyte-like cells. J Immunol 132:2547, 1984 [Abstract]

69. Eklund KK, Ghildyal N, Austen F, Friend DS, Schiller V, Stevens RL: Mouse bone marrow-derived mast cells (mBMMC) obtained in vitro from mice that are mast cell-deficient in vivo expresses the same panel of granule proteases as mBMMC and serosal mast cells from their normal littermates. J Exp Med 180:67, 1994 [Abstract/Free Full Text]

70. Sugawara T, Miyamoto M, Takayama S, Kato M: Separation of neutrophils from blood in human and laboratory animals and comparison of the chemotaxis. J Pharmacol Toxicol Methods 33:91, 1995 [Medline] [Order article via Infotrieve]

71. Aiuti A, Webb IJ, Bleul C, Springer T, Gutierrez-Ramos JC: The chemokine SDF-1 is a chemoattractant for human CD34+ hematopoietic progenitor cells and provides a new mechanism to explain the mobilization of CD34+ progenitors to peripheral blood. J Exp Med 185:111, 1997 [Abstract/Free Full Text]

72. Kim C, Epner E, Forrester W, Groudine M: Inactivation of the human beta-globin gene by targeted insertion into the beta-globin locus control region. Genes Dev 6:928, 1992 [Abstract/Free Full Text]

73. Fiering S, Kim C, Epner E, Groudine M: An "in-out" strategy using gene targeting and FLP recombinase for the functional dissection of complex DNA regulatory elements: Analysis of the beta-globin locus control region. Proc Natl Acad Sci USA 90:8469, 1993 [Abstract/Free Full Text]

74. Fiering S, Epner E, Robinson K, Zhuang Y, Telling A, Hu M, Martin DIK, Enver T, Ley TJ, Groudine M: Targeted deletion of 5' HS2 of the murine beta -globin LCR reveals that it is not essential for proper regulation of the beta -globin locus. Genes Dev 9:2203, 1995 [Abstract/Free Full Text]

75. Hug BA, Wesselschmidt RL, Fiering S, Bender MA, Epner E, Groudine M, Ley TJ: Analysis of mice containing a targeted deletion of beta -globin locus control region 5' hypersensitive 3. Mol Cell Biol 16:2906, 1996 [Abstract/Free Full Text]

76. Ghildyal N, Friend DS, Nicodemus CF, Austen KF, Stevens RL: Reversible expression of mouse mast cell protease 2 mRNA and protein in cultured mast cells exposed to IL-10. J Immunol 151:3206, 1993 [Abstract]

77. Eklund KK, Ghildyal N, Austen KF, Stevens RL: Induction by IL-9 and suppression by IL-3 and IL-4 of the levels of chromosome 14-derived transcripts that encode late-expressed mouse mast cell proteases. J Immunol 151:4266, 1993 [Abstract]

78. Kilpatrick L, Johnson JL, Nickbarg EG, Wang Z, Clifford TF, Banach M, Cooperman BS, Douglas SD, Rubin H: Inhibition of human neutrophil superoxide generation by alpha-1-antichymotrypsin. J Immunol 146:2388, 1991 [Abstract]

79. Kilpatrick L, McCawley L, Naciappan V, Greer W, Majumdar S, Korchak HM, Douglas SD: Alpha-1-antichymotrypsin inhibits the NADPH oxidase-enzyme complex in phorbol ester-stimulated neutrophil membranes. J Immunol 149:3059, 1992 [Abstract]

80. Belaaouaj B, McCarthy R, Baumann M, Gao Z, Ley TJ, Abraham SN, Shapiro SD: Mice lacking neutrophil elastase reveal impaired host defense against gram negative bacterial sepsis. Nat Med 4:615, 1998 [Medline] [Order article via Infotrieve]

81. Owen CA, Campbell EJ: Angiotensin II generation at the cell surface of activated neutrophils: Novel cathepsin G-mediated catalytic activity that is resistant to inhibition. J Immunol 160:1436, 1998 [Abstract/Free Full Text]

82. Chertov O, Ueda H, Xu LL, Tani K, Murphy WJ, Wang JM, Howard OM, Sayers TJ, Oppenheim JJ: Identification of human neutrophil-derived cathepsin G and azurocidin/CAP37 as chemoattractants for mononuclear cells and neutrophils. J Exp Med 186:739, 1997 [Abstract/Free Full Text]


© 1999 by The American Society of Hematology.
 
0006-4971/99/9412-0044$3.00/0

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Eur Respir JHome page
M. M. Farberman, K. T. Akers, J. P. Malone, P. Erdman-Gilmore, R. R. Townsend, and T. Ferkol
Airway proteins involved in bacterial clearance susceptible to cathepsin G proteolysis
Eur. Respir. J., February 1, 2010; 35(2): 410 - 417.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Tausch, A. Henkel, U. Siemoneit, D. Poeckel, N. Kather, L. Franke, B. Hofmann, G. Schneider, C. Angioni, G. Geisslinger, et al.
Identification of Human Cathepsin G As a Functional Target of Boswellic Acids from the Anti-Inflammatory Remedy Frankincense
J. Immunol., September 1, 2009; 183(5): 3433 - 3442.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
M. Dabek, L. Ferrier, R. Roka, K. Gecse, A. Annahazi, J. Moreau, J. Escourrou, C. Cartier, G. Chaumaz, M. Leveque, et al.
Luminal Cathepsin G and Protease-Activated Receptor 4: A Duet Involved in Alterations of the Colonic Epithelial Barrier in Ulcerative Colitis
Am. J. Pathol., July 1, 2009; 175(1): 207 - 214.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. J. Wilson, K. C. Nannuru, and R. K. Singh
Cathepsin G Recruits Osteoclast Precursors via Proteolytic Activation of Protease-Activated Receptor-1
Cancer Res., April 1, 2009; 69(7): 3188 - 3195.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
T. Manolov, T. T. Tan, A. Forsgren, and K. Riesbeck
Moraxella-Dependent {alpha}1-Antichymotrypsin Neutralization: A Unique Virulence Mechanism
Am. J. Respir. Cell Mol. Biol., May 1, 2008; 38(5): 609 - 617.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
C. Benarafa, G. P. Priebe, and E. Remold-O'Donnell
The neutrophil serine protease inhibitor serpinb1 preserves lung defense functions in Pseudomonas aeruginosa infection
J. Exp. Med., August 6, 2007; 204(8): 1901 - 1909.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Methot, J. Rubin, D. Guay, C. Beaulieu, D. Ethier, T. J. Reddy, D. Riendeau, and M. D. Percival
Inhibition of the Activation of Multiple Serine Proteases with a Cathepsin C Inhibitor Requires Sustained Exposure to Prevent Pro-enzyme Processing
J. Biol. Chem., July 20, 2007; 282(29): 20836 - 20846.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
N. Shimoda, N. Fukazawa, K. Nonomura, and R. L. Fairchild
Cathepsin G Is Required for Sustained Inflammation and Tissue Injury after Reperfusion of Ischemic Kidneys
Am. J. Pathol., March 1, 2007; 170(3): 930 - 940.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
V. R. Sutton, N. J. Waterhouse, K. A. Browne, K. Sedelies, A. Ciccone, D. Anthony, A. Koskinen, A. Mullbacher, and J. A. Trapani
Residual active granzyme B in cathepsin C-null lymphocytes is sufficient for perforin-dependent target cell apoptosis
J. Cell Biol., February 12, 2007; 176(4): 425 - 433.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. F. de Haar, P. S. Hiemstra, M. T. J. M. van Steenbergen, V. Everts, and W. Beertsen
Role of Polymorphonuclear Leukocyte-Derived Serine Proteinases in Defense against Actinobacillus actinomycetemcomitans
Infect. Immun., September 1, 2006; 74(9): 5284 - 5291.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Shao, A. Belaaouaj, C. L. M. J. Verlinde, X. Fu, and J. W. Heinecke
Methionine Sulfoxide and Proteolytic Cleavage Contribute to the Inactivation of Cathepsin G by Hypochlorous Acid: AN OXIDATIVE MECHANISM FOR REGULATION OF SERINE PROTEINASES BY MYELOPEROXIDASE
J. Biol. Chem., August 12, 2005; 280(32): 29311 - 29321.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
R. D. Unwin, A. Pierce, R. B. Watson, D. W. Sternberg, and A. D. Whetton
Quantitative Proteomic Analysis Using Isobaric Protein Tags Enables Rapid Comparison of Changes in Transcript and Protein Levels in Transformed Cells
Mol. Cell. Proteomics, July 1, 2005; 4(7): 924 - 935.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
C. C. Taggart, C. M. Greene, T. P. Carroll, S. J. O'Neill, and N. G. McElvaney
Elastolytic Proteases: Inflammation Resolution and Dysregulation in Chronic Infective Lung Disease
Am. J. Respir. Crit. Care Med., May 15, 2005; 171(10): 1070 - 1076.
[Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. J. Klebanoff
Myeloperoxidase: friend and foe
J. Leukoc. Biol., May 1, 2005; 77(5): 598 - 625.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. A. Revell, W. J. Grossman, D. A. Thomas, X. Cao, R. Behl, J. A. Ratner, Z. H. Lu, and T. J. Ley
Granzyme B and the Downstream Granzymes C and/or F Are Important for Cytotoxic Lymphocyte Functions
J. Immunol., February 15, 2005; 174(4): 2124 - 2131.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. O. Hirche, J. P. Gaut, J. W. Heinecke, and A. Belaaouaj
Myeloperoxidase Plays Critical Roles in Killing Klebsiella pneumoniae and Inactivating Neutrophil Elastase: Effects on Host Defense
J. Immunol., February 1, 2005; 174(3): 1557 - 1565.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. A. Lane and T. J. Ley
Neutrophil Elastase Is Important for PML-Retinoic Acid Receptor {alpha} Activities in Early Myeloid Cells
Mol. Cell. Biol., January 1, 2005; 25(1): 23 - 33.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. D. Swain, T. W. Wright, P. M. Degel, F. Gigliotti, and A. G. Harmsen
Neither Neutrophils nor Reactive Oxygen Species Contribute to Tissue Damage during Pneumocystis Pneumonia in Mice
Infect. Immun., October 1, 2004; 72(10): 5722 - 5732.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J.-P. Levesque, F. Liu, P. J. Simmons, T. Betsuyaku, R. M. Senior, C. Pham, and D. C. Link
Characterization of hematopoietic progenitor mobilization in protease-deficient mice
Blood, July 1, 2004; 104(1): 65 - 72.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. O. Hirche, E. C. Crouch, M. Espinola, T. J. Brokelman, R. P. Mecham, N. DeSilva, J. Cooley, E. Remold-O'Donnell, and A. Belaaouaj
Neutrophil Serine Proteinases Inactivate Surfactant Protein D by Cleaving within a Conserved Subregion of the Carbohydrate Recognition Domain
J. Biol. Chem., June 25, 2004; 279(26): 27688 - 27698.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
T. O. Hirche, J. J. Atkinson, S. Bahr, and A. Belaaouaj
Deficiency in Neutrophil Elastase Does Not Impair Neutrophil Recruitment to Inflamed Sites
Am. J. Respir. Cell Mol. Biol., April 1, 2004; 30(4): 576 - 584.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
L. Ottonello, A. L. Epstein, M. Mancini, P. Dapino, and F. Dallegri
Monoclonal LYM-1 antibody-dependent cytolysis by human neutrophils exposed to GM-CSF: auto-regulation of target cell attack by cathepsin G
J. Leukoc. Biol., January 1, 2004; 75(1): 99 - 105.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. S. Lopez-Boado, M. Espinola, S. Bahr, and A. Belaaouaj
Neutrophil Serine Proteinases Cleave Bacterial Flagellin, Abrogating Its Host Response-Inducing Activity
J. Immunol., January 1, 2004; 172(1): 509 - 515.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. Saeftel, M. Arndt, S. Specht, L. Volkmann, and A. Hoerauf
Synergism of Gamma Interferon and Interleukin-5 in the Control of Murine Filariasis
Infect. Immun., December 1, 2003; 71(12): 6978 - 6985.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. D. Shapiro, N. M. Goldstein, A. M. Houghton, D. K. Kobayashi, D. Kelley, and A. Belaaouaj
Neutrophil Elastase Contributes to Cigarette Smoke-Induced Emphysema in Mice
Am. J. Pathol., December 1, 2003; 163(6): 2329 - 2335.
[Abstract] [Full Text]


Home page
BloodHome page
P. Westervelt, A. A. Lane, J. L. Pollock, K. Oldfather, M. S. Holt, D. B. Zimonjic, N. C. Popescu, J. F. DiPersio, and T. J. Ley
High-penetrance mouse model of acute promyelocytic leukemia with very low levels of PML-RAR{alpha} expression
Blood, September 1, 2003; 102(5): 1857 - 1865.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Dziarski, K. A. Platt, E. Gelius, H. Steiner, and D. Gupta
Defect in neutrophil killing and increased susceptibility to infection with nonpathogenic gram-positive bacteria in peptidoglycan recognition protein-S (PGRP-S)-deficient mice
Blood, July 15, 2003; 102(2): 689 - 697.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. S. Grenda, S. E. Johnson, J. R. Mayer, M. L. McLemore, K. F. Benson, M. Horwitz, and D. C. Link
Mice expressing a neutrophil elastase mutation derived from patients with severe congenital neutropenia have normal granulopoiesis
Blood, October 16, 2002; 100(9): 3221 - 3228.
[Abstract] [Full Text] [PDF]


Home page
International Journal of ToxicologyHome page
B. Bolon and E. Galbreath
Use of Genetically Engineered Mice in Drug Discovery and Development: Wielding Occam's Razor to Prune the Product Portfolio
International Journal of Toxicology, January 1, 2002; 21(1): 55 - 64.
[Abstract] [PDF]


Home page
Infect. Immun.Home page
L. Volkmann, M. Saeftel, O. Bain, K. Fischer, B. Fleischer, and A. Hoerauf
Interleukin-4 Is Essential for the Control of Microfilariae in Murine Infection with the Filaria Litomosoides sigmodontis
Infect. Immun., May 1, 2001; 69(5): 2950 - 2956.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
Y. Ge, T. Jippo, Y.-M. Lee, S. Adachi, and Y. Kitamura
Independent Influence of Strain Difference and mi Transcription Factor on the Expression of Mouse Mast Cell Chymases
Am. J. Pathol., January 1, 2001; 158(1): 281 - 292.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. M. Cole, J. Shi, A. Ceccarelli, Y.-H. Kim, A. Park, and T. Ganz
Inhibition of neutrophil elastase prevents cathelicidin activation and impairs clearance of bacteria from wounds
Blood, January 1, 2001; 97(1): 297 - 304.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
A. a. Belaaouaj, K. S. Kim, and S. D. Shapiro
Degradation of Outer Membrane Protein A in Escherichia coli Killing by Neutrophil Elastase
Science, August 18, 2000; 289(5482): 1185 - 1187.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by MacIvor, D. M.
Right arrow Articles by Ley, T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by MacIvor, D. M.
Right arrow Articles by Ley, T. J.
Related Collections
Right arrow Phagocytes
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1999 by American Society of Hematology         Online ISSN: 1528-0020