|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 12 (December 15), 1999:
pp. 4282-4293
Normal Neutrophil Function in Cathepsin G-Deficient Mice
By
Debra M. MacIvor,
Steven D. Shapiro,
Christine T.N. Pham,
Abderazzaq Belaaouaj,
Soman N. Abraham, and
Timothy J. Ley
From the Departments of Internal Medicine and Genetics, Division of
Bone Marrow Transplantation and Stem Cell Biology, Department of
Pediatrics, Medicine, and Cell Biology, Division of Rheumatology, and
Department of Pathology, Washington University Medical School, St
Louis, MO.
 |
ABSTRACT |
Cathepsin G is a neutral serine protease that is highly expressed at
the promyelocyte stage of myeloid development. We have developed a
homologous recombination strategy to create a loss-of-function mutation
for murine cathepsin G. Bone marrow derived from mice homozygous for
this mutation had no detectable cathepsin G protein or activity,
indicating that no other protease in bone marrow cells has the same
specificity. Hematopoiesis in cathepsin G / mice is normal, and
the mice have no overt abnormalities in blood clotting. Neutrophils
derived from cathepsin G/ mice have normal morphology and
azurophil granule composition; these neutrophils also display normal
phagocytosis and superoxide production and have normal chemotactic
responses to C5a, fMLP, and interleukin-8. Although cathepsin G has
previously shown to have broad spectrum antibiotic properties,
challenges of mice with Staphylococcus aureus, Klebsiella
pneumoniae, or Escherichia coli yielded
survivals that were not different from those of wild-type animals. In
sum, cathepsin G/ neutrophils have no obvious defects in
function; either cathepsin G is not required for any of these normal
neutrophil functions or related azurophil granule proteases with
different specificities (ie, neutrophil elastase, proteinase 3, azurocidin, and/or others) can substitute for it in vivo.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
CATHEPSIN G IS A neutral serine protease
that is expressed and synthesized at the promyelocyte stage of
development and is packaged in the azurophil (primary)
granules.1,2 The amino acid composition and crystal
structure of cathepsin G are known.3-5 The human and murine
cathepsin G genes have been cloned6,7 and reside within a
cluster of granule-related serine proteases on syntenic regions of
human and mouse chromosomes 14.8-13 The highly related
serine proteases known as neutrophil elastase (NE), azurocidin, and
proteinase 3 are also expressed specifically in promyelocytes and
packaged in azurophil granules; these 3 genes are located in a tight
cluster on human chromosome 19 pter.14 The human and mouse
cathepsin G genes are highly related and are expressed in identical
fashion6,7,15; therefore, these genes are thought to be
true orthologues of one another. Cathepsin G has chymotrypsin-like
specificity, preferring to cleave at Phe in the P1
position16; a large number of potential substrates for
cathepsin G have been identified (discussed below). Although cathepsin
G is found in the azurophil granules of neutrophils, this enzyme has
also been found on the surface of neutrophils after
degranulation.17,18 Recent studies have suggested that inhibitors of cathepsin G ( -1 antichymotrypsin and/or specific antibodies directed against cathepsin G) can diminish the ability of
neutrophils to respond to a variety of chemotactic signals, suggesting
that cell surface-bound cathepsin G may play a role in this
process.19,20
Cathepsin G has been proposed to play a role in blood clotting, because
it cleaves and inactivates several clotting factors,21-26 because it can cleave and potentially modulate the function of the thrombin receptor,27-29 and because it can activate
platelets in vitro.30-38 Tight contact is thought to be
required between neutrophils and platelets for platelet
activation to occur33,34; cleavage of the thrombin receptor
or thrombin receptor-like proteins could potentially play a role in
this process.
Cathepsin G has been proposed to play a role in neutrophil responses
against a variety of bacteria. Purified cathepsin G has been shown to
inhibit the growth of several organisms, including Staphylococcus
aureus, Escherichia coli, Pseudomonas aeruginosa, and Neisseria gonorrhea; it also displays toxic properties
against Eimeria tenella sporozoites, Capnocytophaga,
and Listeria monocytogenes.39-45 The
enzymatic activity of cathepsin G is not required for its antibacterial
activities39,46-48; in fact, 3 peptides derived from
cathepsin G (IIGGR [aa 1-5], HPQYNQR [aa 77-83], and
RPGTLCTVAGWGRVSMRRGT [aa 117-136]) have direct antimicrobial
properties.47,48 The precise mechanisms by which these
peptides cause bacterial death are currently unknown.
Cathepsin G has a number of potential substrates and activities that
are difficult to classify, including the conversion of angiotensin I to
angiotensin II,49 the activation and damage of cultured
airway epithelial cells,50 the stimulation of secretion by
airway gland serous cells,51 the induction of
transendothelial albumin flux,52 and the processing of
NF-kB (p65) in vitro.53 It is not yet clear that any of
these activities represent physiologic roles of this enzyme.
Finally, cathepsin G has been proposed to play an important role in
tissue remodeling at sites of wounding or tissue injury. Cathepsin G
has been shown to cleave and inactivate the neutrophil chemoattractants
tumor necrosis factor (TNF),54 interleukin-1 (IL-1),55 and IL-8.56 In addition, cathepsin G
has been shown to cleave several matrix components, including collagen,
fibronectin, cartilage proteoglycans, and elastin.57-64 For
this reason, we recently examined the ability of cathepsin G-deficient
mice (the same mice described in this study) to heal incisional wounds
and found that these animals have reduced tensile strength of their healing wounds at 7 days. This defect is resolved by 10 days.65 Cathepsin G-deficient mice display excessive
neutrophilic inflammation at sites of wounding, which may be caused by
increased neutrophil chemoattractant activity in the wound
fluid.65 These observations suggest that cathepsin G may be
involved in degrading one or more soluble mediators in the wound milieu
that are important for the early phases of neutrophil migration into
the wound. However, we could not rule out an autonomous defect of
cathepsin G-deficient neutrophils that might contribute to the abnormal
wound healing.
In this report, we fully describe mice that possess a null mutation of
cathepsin G. Cathepsin G/ animals have no detectable defects in myeloid development or neutrophil function, suggesting that
either cathepsin G is not required for these functions or that related
proteases can substitute for the functions of cathepsin G in some circumstances.
| |
MATERIALS AND METHODS |
Production of the targeting construct.
A 3.7-kb Bgl II genomic fragment containing the 3' part
of exon 4 through the 3' flank of the murine cathepsin G gene was subcloned into the MJK-KO vector downstream from the PGK-neo cassette. A 1.6-kb HindIII/Pst I fragment containing 5'
genomic flanking sequence, exons 1 and 2, introns 1 and 2, and the
5' part of exon 3 was purified from a pUC 9 vector and subcloned
into pGEM7. This plasmid was then cut with Bgl II and
Xho I; the resulting Bgl II/Xho I fragment was
subcloned upstream from the PGK-neo cassette and downstream from the
HSV-TK cassette of the MJK-KO vector.66 Therefore, a 393-bp
Pst I-Bgl II fragment containing the 3' end of
exon 3, intron 3, and the 5' end of exon 4 was removed and replaced with a standard PGK-neo cassette in the reverse orientation. This deletion removes the region encoding aa 92-164 of the cathepsin G
protein (numbering from the initiation codon).
Electroporation, selection, and screening of embryonic stem
(ES) cells.
Early passage RW4 ES cells (129/SvJ) were maintained on feeder layers
of murine embryonic fibroblasts in the presence of 103 U/mL
leukocyte inhibitory factor. ES cells were transfected and selected,
and G418-resistant clones were identified by Southern blotting using
probe A (see Fig 1A). Recombinant clones were confirmed using a probe
specific for PGK-neo (probe B).
Production of mutant mice.
C57Bl/6J blastocysts were microinjected with 10 to 12 ES cells from 3 independent targeted clones and implanted into pseudopregnant Swiss
Webster foster females. Chimeric male progeny with greater than 60%
agouti fur were mated with C57Bl/6J females, and their progeny were
screened by Southern blot analysis (with probe A) for transmission of
the targeted allele. Heterozygotes were interbred to produce homozygous
mutant mice derived from 2 of the independently targeted ES clones (no.
11 and 76). Both lines were phenotypically identical. Chimeric males
from line 76 were also bred to 129/SvJ females to obtain cathepsin
G-deficient mice in a pure 129/SvJ background. Mice were maintained in
a specific virus free (SVAF) barrier facility at all times.
S1 nuclease protection assays.
Total cellular RNA was prepared and analyzed by S1 nuclease protection,
as previously described.67 The gene-specific probes for
murine granzyme B,2 murine cathepsin G,7 and
murine  2-microglobulin2 have been described
previously. The probe for murine mast cell chymase-2 (mMCP-2) RNA was
obtained by polymerase chain reaction (PCR); the forward primer was
located in IVS-4 (TTCATCTCCcathepsin GTTCTCAAGC) and the reverse primer
in exon 5 (AGACTTGATGCAGGATGAGA); and the PCR product was 489 bp in
length. Correctly processed exon 5 mMCP-2 mRNA protects a probe
fragment of 235 nucleotides from S1 nuclease digestion. Autoradiograms were exposed for 24 to 72 hours.
Western analysis.
Total proteins were prepared from approximately 2 × 107 bone marrow cells by sonicating the cells in 200 µL
of extraction buffer (1 mol/L NaCl, 25 mmol/L Tris 7.5, 0.1% Triton
X-100); protein was quantified using the Bio-Rad Protein Assay (Bio-Rad
Laboratories, Hercules, CA). Equal quantities of total proteins were
loaded onto 10% sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) gels, transferred to nitrocellulose, and
analyzed with a standard Western blotting technique using a rabbit
antiserum directed against a murine cathepsin G-derived peptide (aa
152-165 numbered from the initiation codon: CANRFQFYNSQTQI), followed by detection with chemiluminescence (Amersham, Arlington Heights, IL).
Determination of cathepsin G and neutrophil elastase activity.
Total bone marrow cells were extracted in extraction buffer as
described above and normalized for total protein context using the
Bio-Rad assay. Cathepsin G activity was measured using the peptide
substrate N-Succinyl-Ala-Ala-Pro-Phe-pNA (Sigma, St Louis, MO) and neutrophil elastase activity with the substrate
N-Methoxysuccinyl-Ala-Ala-Pro-Val-pNA, as previously
described.68
Generation of bone marrow-derived mast cells.
Mast cells were generated by culturing murine bone marrow cells for 3 weeks in enriched media (RPMI 1640 containing 0.1 mmol/L nonessential
amino acids, 2 mmol/L L-glutamine, 10% heat-inactivated fetal calf
serum, 100 U/mL penicillin, 10 µg/mL gentamicin, and 50 mmol/L
2-mercaptoethanol) supplemented with 50% WEHI-3 cell conditioned media
(WCM), as previously described.69 After 3 weeks, the cells
were cultured for an additional 72 hours in 50% WCM/50% enriched
media supplemented with 100 U/mL recombinant murine IL-10 (Amersham).
RNA was then extracted from the cells and analyzed using S1 nuclease
protection assays. These preparations yielded greater than 90% mast
cells as judged by light microscopic criteria.
Isolation of bone marrow-derived neutrophils.
Bone marrow was harvested using Hank's balanced salt solution (HBSS;
138 mmol/L NaCI, 5.4 mmol/L KCl, 0.4 mmol/L
KH2PO4, 0.2 mmol/L
Na2HPO4, 4.1 mmol/L NaHCO3, 5.5 mmol/L glucose) containing 1% bovine serum albumin (BSA). Neutrophils
were purified from the bone marrow preparations using a discontinuous
Ficoll gradient (Histopaque 1119; Sigma). Cells were then washed twice
with HBSS containing 1% BSA. Neutrophil purity was consistently 75%
to 85%, as assessed by light microscopy of Wright-Giemsa-stained cytospins.
Phagocytosis.
In vitro, 5 × 104 neutrophils in 100 µL of
phosphate-buffered saline (PBS; define) were mixed with 10 µL of a 1:5 dilution of 0.9-µm diameter fluorescein isothiocyanate
(FITC)-labeled latex beads (Poly Sciences, Inc,
Warrington, PA) and incubated for 1 hour at 37°C. Cells were then
washed with media, trypsin-EDTA was added, and the cells were incubated
at 37°C for 10 minutes. Cells were then layered over 4°C fetal
calf serum and spun at 1,500 rpm for 5 minutes to remove uningested
beads. After washing, the cells were fixed with 1.0% paraformaldehyde
in PBS and observed under a fluorescent microscope.
In vivo, 2 mL of zymosan (Sigma) was injected intraperitoneally. Total
intraperitoneal cells were harvested after 4 hours by injecting 10 mL
of PBS and then withdrawing 7 to 9 mL of fluid for analysis. Cytospin
preparation of cells were made and stained using Wright-Giemsa stain.
Superoxide production.
Purified bone marrow-derived neutrophils were resuspended in HBSS (with
1.3 mmol/L CaCl2 and 0.4 mmol/L MgSO4) and
added to tubes containing 0.2 mmol/L cytochrome C (Sigma) and 0, 5, 10, or 25 ng/mL phorbol 12-myristate 13-acetate (PMA; Sigma) or containing cytochrome C plus 300 U/mL superoxide dismutase (SOD; Sigma) with 0, 5, 10, or 25 ng/mL PMA. The cells were incubated for 20 minutes at
37°C in 5% CO2 and then centrifuged at 10,000 rpm for
2 minutes. Supernatants were assayed at OD550. The amount
of superoxide produced was calculated using the following formula:
( OD × 100)/21.1 = micromoles of
O2 = (nanomoles of
O2/mL)/(PMNs/mL/time) = nanomoles of
O2/PMNs/time.
Chemotaxis.
Optimal concentrations of several chemotactic agents were defined using
bone marrow-derived neutrophils, including fMLP (104
mol/L; Sigma), zymosan-activated rat serum (7%), and recombinant human
IL-8 (rhIL-8; 250 ng/mL; Amersham); these optimal
concentrations were used for all further experiments.70
Chemotactic agents were suspended in the bottom wells of
micro-chemotaxis chambers. The bottom chamber was covered with 2-mm
membrane filters, and 150,000 bone marrow-derived neutrophils (in
Dulbecco's modified Eagle's medium [DMEM]/0.1% human
serum albumin) derived from wild-type or cathepsin G-deficient mice
(all in the pure 129/SvJ strain) were suspended in the top wells. After
incubation for 75 minutes at 37°C in 5% CO2, the
membranes were fixed, stained with Leukostat (Sigma), and placed on
glass slides. Cells from the top chamber were removed with a wiper
blade. Fifteen fields were counted at 400× magnification. Each
experiment was performed in triplicate. Media alone was used as a
negative control and subtracted from total counted cells to yield net
neutrophil movement.
Chemoattractant-induced calcium influx.
Bone marrow-derived neutrophils were loaded with the calcium sensitive
dye Fluo-3 (9 µmol/L acetoxymethyl ester Fluo-3; Molecular Probes,
Eugene, OR) for 30 minutes at room temperature in HBSS without calcium
or magnesium. Cells were stained with phycoerythrin (PE)-conjugated
anti-Gr-1 antibody (Pharmingen, San Diego, CA), washed,
and then resuspended in HEPES buffer (137 mmol/L NaCl, 5 mmol/L KCl, 1 mmol/L Na2HPO4, 5 mmol/L glucose, 1 mmol/L
CaCl2, 0.5 mmol/L MgCl2, 0.1% BSA, and 10 mmol/L HEPES, pH 7.4). Antifluorescein antibody was added (per the
manufacturer's recommendation) to quench extracellular Fluo-3 signals.
The indicated agonist was added and cellular Fluo-3 fluorescence was
measured continuously for 90 seconds using a Coulter ESP flow cytometer
(Coulter, Hialeah, FL), as previously described.71
In vivo bacterial clearance.
All in vivo assays were performed in mice having a pure 129/SvJ
background. S aureus was grown in tryptic soy broth (TSB) and
passaged twice in 129/SvJ mice before use. Varying doses of S
aureus were injected intraperitoneally (IP) into 129/SvJ mice to
define the LD50, which was approximately 2.5 × 108
colony-forming units (CFU). Eight cathepsin G+/+ (5 male
and 3 female) and 9 cathepsin G/ (5 male and 4 female)
10-week-old mice were injected IP with 108 CFU S
aureus and observed for 15 days. Deaths were recorded and analyzed.
Klebsiella pneumoniae (KPA strain) was grown in
TSB and passaged once in 129/SvJ mice before use. Varying doses of
K pneumoniae were injected IP into wild-type 129/SvJ mice, and
the LD50 was determined to be between 5 × 105 CFU and
1 × 106 CFU. Fourteen cathepsin G+/+ and 15 cathepsin
G/ 12-week-old male mice were injected IP with 1 × 106 CFU of K pneumoniae. Deaths were recorded and analyzed.
E coli (K1) was grown in TSB and passaged twice in 129/SvJ mice
before use. Varying doses of E coli were injected IP into wild-type 129/SvJ mice to determine the LD50, which was 3 × 104 CFU. This dose of bacteria was then injected IP to 13 wild-type mice, 12 cathepsin G/ mice, and 12 NE/ mice. Deaths were recorded and analyzed.
In vitro microbicidal assays.
The in vitro bactericidal activities of cathepsin G and NE were
quantified as described.45 K pneumoniae, E
coli, and S aureus were grown in TSB at 37°C and washed
twice with PBS. Mid-log phase bacteria (105) were incubated
in the absence or presence of purified human NE or cathepsin G (5 µg;
Elastin Products Co, Owensville, MO) in a total volume of 100 µL of
10 mmol/L sodium phosphate containing 1% (vol/vol) TSB at 37°C for
4 hours. Serial dilutions were then spread on agarose plates and the
number of CFUs was determined after overnight incubation. At the time
of each assay, cathepsin G and NE activities were confirmed using the
spectrophotometric method of peptide substrate cleavage described above.
| |
RESULTS |
Targeting of the cathepsin G gene in ES cells and production of mutant
mice.
We electroporated RW4 ES cells (129/SvJ) with our cathepsin G targeting
vector (Fig 1). Three homologous
recombinants were identified (using Southern blotting with
external probe A) of 192 G418-resistant colonies screened from 2 independent transfections. After injection of C57Bl/6 blastocysts,
all 3 of these ES clones gave rise to highly chimeric males that were
then mated to C56Bl/6 females to obtain germline transmission of the
mutant cathepsin G allele. Chimeric males were also mated to 129/SvJ
females to obtain germline transmission in pure 129/SvJ mice. Figure 1B
is a Southern blot analysis of genomic tail DNA of progeny produced from a cross of cathepsin G+/ animals. Genomic DNA was digested with Xba I and hybridized with probe A to show bands
representing the wild-type (7.6 kb) and mutant (2.6 kb)
alleles. The heterozygous matings produced wild-type, heterozygous, and
homozygous mice at expected ratios
(+/+:+/:/= 30:55:31). Cathepsin
G/ mice develop normally and are fertile. Mice were
evaluated from 2 independently targeted ES clones and both had the same
phenotype (data not shown).
View larger version (31K):
[in this window]
[in a new window]
| Fig 1.
The cathepsin G (CG) locus and targeting strategy. (A)
The structures of the murine cathepsin G gene and the targeting vector
used to create homologous recombinants are shown. The PGK-neo cassette
was inserted in the antisense orientation with respect to the cathepsin
G gene. The structure of the targeted locus and the sizes of fragments
detected by probe A (which is completely external to the targeting
construct) and probe B (the PGK-neo cassette) are shown. (B) Southern
blot analysis of tail DNA from the progeny of a cross between cathepsin
G+/ animals. Genomic DNA was cleaved with Xba I and the
blot was hybridized with probe A. The positions of the wild-type (7.6 kb) allele and the targeted (2.2 kb) allele are shown.
|
|
Cathepsin G/ mice contain a null mutation for
cathepsin G.
Bone marrow was harvested from cathepsin G+/+, +/, and
/ mice and total cellular RNA was prepared for analysis
by S1 nuclease protection. Figure 2A (left
panel) is an S1 nuclease protection analysis of bone marrow cell RNA
(lanes 1, 2, and 3). RNA samples (10 µg) were hybridized with
specific probes for exon 5 of murine cathepsin G and for
2 microglobulin (m2M). Correctly
processed murine cathepsin G exon 5 mRNA protects a probe fragment of
212 nt from S1 digestion, whereas m2M mRNA protects a fragment of 190 nt. Cathepsin G mRNA is present in the bone marrow of +/+ mice, is
reduced in +/ mice, and is undetectable in the bone marrow of
cathepsin G/ mice (Fig 2A). The m2M signal
is present in bone marrow RNA from all 3 mice and serves as an internal
control for RNA quality and content.
View larger version (33K):
[in this window]
[in a new window]
| Fig 2.
The cathepsin G mutation eliminates cathepsin G mRNA and
protein expression in the bone marrow of cathepsin G/ mice. (A)
Lanes 1 through 3 show an S1 nuclease protection analysis of cathepsin
G and 2 microglobulin mRNAs in bone marrow samples derived from
+/+, +/, and / mice. In lanes 4 through 6, a Western
blot was performed with a rabbit antimurine cathepsin G antibody
prepared against a peptide from a unique region of the cathepsin G
protein (see Materials and Methods). After hybridization and
chemiluminescence, the blot was stripped and reprobed for the presence
of -actin to control for protein loading. (B) Analysis of mMCP-2
mRNA in cultured mast cells derived from the bone marrow of cathepsin
G+/+ and / mice. An S1 nuclease protection assay was
performed with probes for mouse 2 microglobulin and
either mouse cathepsin G or mMCP-2, as indicated. The positions of
probe fragments protected from S1 nuclease digestion by correctly
spliced mcathepsin G and mMCP-2 are shown. Mast cell mRNA from
cathepsin G+/+ animals contains easily detectable mcathepsin G
mRNA. RNA derived from cathepsin G/ mast cells shows no cathepsin
G mRNA, as expected, and a 10-fold reduction in mMCP-2 mRNA levels.
|
|
Total protein extracts from cathepsin G+/+, +/,
and/ bone marrows were analyzed by Western blotting (Fig
2A, right panel); the blot was probed sequentially with a rabbit
antimurine cathepsin G antibody and a rabbit antimurine -actin
antibody to control for protein loading. No cathepsin G protein (~29
kb) is detected in the bone marrow of cathepsin G/ mice.
Total bone marrow extracts were evaluated for cathepsin G activity
using the peptide substrate N-Succinyl-Ala-Ala-Pro-Phe-pNA. Importantly, equal amounts of human versus mouse bone marrow extracts contained virtually identical amounts of cathepsin G activity (data not
shown). Marrow extracts derived from cathepsin G/ mice
have virtually no detectable cleavage of this peptide substrate (Fig 3A). Neutrophil elastase-deficient
mice have normal levels of cathepsin G activity, as expected (data not
shown). In contrast, cathepsin G/ bone marrow extracts
cleave the elastase-specific peptide substrate N-Methoxy
Succinyl-Ala-Ala-Pro-Val-pNA as efficiently as wild-type marrow
extracts, as expected (Fig 3B).
View larger version (10K):
[in this window]
[in a new window]
| Fig 3.
Cathepsin G and neutrophil elastase activities in
cathepsin G-deficient mice. The activity of cathepsin G and neutrophil
elastase was determined by the ability of total bone marrow protein
extracts to cleave colorometric peptide substrates in vitro, as
described in Materials and Methods. (A) A peptide substrate for
cathepsin G (N-Succinyl-Ala-Ala-Pro-Phe-pNA) is used. Cathepsin
G/ mice have no detectable conversion of this substrate even
after 30 minutes of incubation at 37°C. (B) The conversion of the
neutrophil elastase-specific peptide
(N-Methoxysuccinyl-Ala-Ala-Pro-Val-pNA) is shown. Wild-type and
cathepsin G/ mice have equivalent amounts of neutrophil elastase
activity. These experiments were performed 3 times with identical
results.
|
|
The cathepsin G mutation reduces expression of the downstream mMCP-2
gene.
Our laboratory has shown that the targeted disruption of the granzyme B
gene (with a retained PGK-neo cassette) also disrupts expression of the
downstream granzymes C, D, F, and G in adherent lymphokine-activated
killer (AdLAK) cells derived from granzyme B/ mice. This
phenomenon is known as the neighborhood effect and is thought to be
caused by the retained PGK-neo cassette in the mutant
locus.72-75
The targeted mutation of the cathepsin G gene minimally alters the
expression of the upstream granzymes (B, C, D, and F) in activated cytotoxic T lymphocytes and AdLAK cells.10 To
determine whether the mutation in the cathepsin G gene affects
expression of downstream murine mast cell chymase
genes,10-13,76,77 we developed PCR-based detection methods
for the mMCP-1, -2, -4, and -5 genes and screened for their presence
(using PCR) on a bacterial artificial chromosome (BAC) that was known
to contain the cathepsin G gene.10 Only mMCP-2, a chymase
known to be expressed in mucosal mast cells,76 was present
on this BAC clone, mapping approximately 30 kb downstream from the
cathepsin G gene. Mast cells were cultivated from bone marrow cells
that had been incubated for 3 weeks in WCM and then stimulated for 72 hours in conditioned media containing murine rIL-10 (100 U/mL).76,77 An S1 probe specific for mMCP-2 was developed
and used to analyze these mast cell mRNA samples (Fig 2B). Cathepsin G
was expressed in cathepsin G+/+ mast cells, but not in cathepsin
G/ mast cells, as expected (lanes 1 and 3, respectively).
However, whereas mMCP-2 is expressed in cathepsin G+/+ mast cells,
there is a 10-fold reduction (as determined by phosphorimaging) of
mMCP-2 mRNA levels in cathepsin G/ mast cell mRNA (lanes
2 and 4, respectively). Although bone marrow samples and cultured mast
cells appear to have nearly equivalent levels of cathepsin G mRNA, the
level of cathepsin G mRNA per expressing cell may be much higher in
promyelocytes, because these are the only bone marrow cells that
contain detectable cathepsin G mRNA and because they comprise only 1%
to 2% of total bone marrow cells.2,7
Hematopoiesis, lymphopoiesis, and myeloid granule development are
normal in cathepsin G/ mice.
We compared the hematopoietic development of multiple cathepsin G+/+
and cathepsin G/ mice derived from 2 different ES cell lines. Complete blood counts and differentials showed no differences between cathepsin G+/+ and cathepsin G/ animals (n = 8, data not shown). Cytospins of bone marrow cells from cathepsin G+/+ and
cathepsin G/ mice were Wright-Giemsa stained and
evaluated for the presence of myeloperoxidase and chloroacetate
esterase activity; no clear differences were detected
(Fig 4A and B). Transmission electron
micrography of bone marrow-derived neutrophils from cathepsin G/ mice showed normal numbers of electron-dense
(azurophil) granules (Fig 4C) and normal neutrophil morphology. The
thymic and splenic tissues of cathepsin G/ mice were
evaluated by flow cytometry, using the markers for CD3, CD4, CD8, B220,
and NK1.1, as previously described.66 Normal numbers and
proportions of all lymphoid compartments were present in both organs,
as well as in the peripheral blood (data not shown). Similarly, normal numbers of Gr-1-positive and CD11b-positive cells were present in the
bone marrow and peripheral blood of the mutant mice (data not shown).
View larger version (85K):
[in this window]
[in a new window]
| Fig 4.
Morphology of neutrophils derived from cathepsin
G-deficient animals. Bone marrow cells were stained with choracetate
esterase (A) or myeloperoxidase stains (B) using conditions recommended
by the manufacturer (Sigma). The reddish-pink stain in (A) represents
chloracetate esterase activity, and the dark brown stain in (B)
represents myeloperoxidase activity. Transmission electron microscopic
(TEM) images of bone marrow derived neutrophils are shown in (C). Note
that cathepsin G/ neutrophils have equal numbers of
electron-dense granules and normal morphology.
|
|
Normal hemostasis in cathepsin G/ mice.
Cathepsin G/ mice do not hemorrhage at birth and clot
normally when tailed or subjected to retroorbital bleeding. The
bleeding time of cathepsin G/ mice is 3.9 ± 2 minutes
(n = 6), a value that is not different from the bleeding times of
wild-type littermate controls (4.2 ± 1.5 minutes, n = 6).
Histopathologic examination of the spleens, livers, kidneys, and
lungs from 1- to 2-year-old cathepsin G/ mice
showed no evidence of microthrombosis or chronic organ damage of any
kind (data not shown).
Phagocytosis and superoxide production are normal in cathepsin
G/ neutrophils.
Neutrophils isolated from bone marrow were incubated with FITC-labeled
latex beads and observed under a fluorescent microscope. At least 98%
of cathepsin G+/+ and cathepsin G/ neutrophils engulfed
 10 beads. In addition, cathepsin G+/+ and cathepsin G/
mice were injected IP with 2 mL of zymosan. Four hours later, cells
were harvested and cytospins were made. Again, at least 98% of
cathepsin G+/+ and cathepsin G/ neutrophils had engulfed at least 10 zymosan particles.
-1 antichymotrypsin, a serpin that inhibits cathepsin G, has been
shown to inhibit neutrophil superoxide production in
vitro78,79; we therefore asked whether cathepsin G was
required for this response. Bone marrow neutrophils from cathepsin G+/+
and cathepsin G/ mice were stimulated with 0 to 25 µg/mL PMA, and cells were analyzed for superoxide production.
Cathepsin G deficiency had no significant effect on the production of
superoxide at these concentrations of PMA (data not shown).
Cathepsin G/ neutrophils have normal in vitro and in
vivo chemotaxis.
Membrane-bound cathepsin G has been suggested to play a role in
chemotaxis, although the mechanism by which it functions in this
setting is unknown. We therefore examined the in vitro chemotaxis of
cathepsin G/ neutrophils using a Boyden chamber using
optimal concentrations of C5a (7% zymosan-activated serum), fMLP
(104 mol/L; we confirmed that a much higher
concentration of fMLP is required for the optimal chemotaxis of murine
neutrophils [104 mol/L] compared with human
neutrophils [107 mol/L]70), or
recombinant human IL-8 (250 µg/mL), as shown in
Fig 5A. There was no
significant reduction in the chemotaxis of cathepsin G/
neutrophils towards any of these reagents.
View larger version (15K):
[in this window]
[in a new window]
| Fig 5.
Cathepsin G/ neutrophils have normal
chemotaxis towards a variety of stimuli in vitro and in vivo. (A)
Cathepsin G/ neutrophils have normal chemotaxis in vitro. Bone
marrow-derived neutrophils from wild-type (+/+) and cathepsin
G-deficient mice (/) were added to the top of a modified
micro-Boyden chamber with the chemoattractant on the bottom well.
Maximally effective concentrations of fMLP (104 mol/L),
C5a (7% zymosan activated serum), and rhIL-8 (250 ng/mL) were used.
Net neutrophil movement per high power field (HPF) is defined as total
neutrophils minus neutrophils migrating towards the media control
(between 11 and 15 for different experiments). The data represent the
mean from 4 individual mice per group each performed in triplicate.
Bars represent standard deviations. (B) Quantitation of the total cells
and neutrophils in peritoneal lavage fluid from thioglycolate-treated
mice. Mice were injected with 2 mL of thioglycolate IP, and, at the
indicated times, peritoneal cells were harvested by lavage and
quantified. Cathepsin G +/+ and / mice demonstrate nearly
identical numbers of total cells and neutrophils in the peritoneal
harvests. This experiment was repeated 3 times with similar results.
(C) Inflammation induced by IP injection of S aureus is not
altered in cathepsin G/ mice. S aureus (108
CFU) was injected into the peritoneal cavities of 3 cathepsin G+/+
or / mice, and peritoneal lavage was performed 2 hours later.
There is no significant difference between the total cells or the
number of neutrophils harvested from cathepsin G+/+ or /
mice. This experiment was repeated twice with similar results.
|
|
To determine whether in vivo chemotaxis was altered in cathepsin
G/ mice, we injected 2 mL (58 mg) of thioglycolate IP
into cathepsin G+/+ and cathepsin G/ mice and, at various
time points, peritoneal cells were collected by lavage and quantified
and cell type differentials were performed. As shown in Fig 5B, there
was no difference in either the total number of cathepsin G+/+ and cathepsin G/ cells or the number of cathepsin G+/+ and
cathepsin G/ neutrophils at 4 or 24 hours after
injection. Similar results were obtained 48 hours after injection (data
not shown).
To further assess in vivo chemotaxis, we wanted to determine whether
cathepsin G/ neutrophils would migrate normally to a site
of bacterial infection. We therefore injected 3 cathepsin G+/+ and 3 cathepsin G/ mice with 108 CFU of S
aureus IP. At 2 hours, cells were harvested from the peritoneum and
total cell counts and total number of neutrophils were determined, as
shown in Fig 5C; there was no significant difference between the total
number of cells or the total number of neutrophils in the peritoneal
harvests from the wild-type versus cathepsin G/ mice.
Finally, we wished to determine whether cathepsin G-deficient
neutrophils had any defects in the early signaling pathways of fMLP,
C5A, or IL-8. We therefore loaded wild-type or cathepsin G-deficient
neutrophils with the calcium-sensitive dye Fluo-3 and added either no
agonist (Mock) or optimal concentrations of fMLP
(104 mol/L), C5a (7% Zymosan activated serum), or
recombinant human IL-8 (250 ng/mL) and measured the mean fluorescent
intensity in the neutrophils at 5-second intervals in Gr-1-positive
cells. For each of the agonists, cathepsin
G/ neutrophils mediated calcium fluxes at least as
efficiently as their wild-type counterparts (data not shown). This
indicates that cathepsin G deficiency does not alter the function of
the receptors for any of these chemoattractant molecules or reduce
their ability to mediate calcium fluxes.
Normal survival of cathepsin G/ mice in response to
S aureus, K pneumoniae, or E coli challenges.
Because cathepsin G had previously been shown to be bactericidal for a
variety of organisms, we wished to determine whether cathepsin
G/ mice were more susceptible to death induced by Gram-positive or Gram-negative bacterial species. We first determined that 108 CFU of S aureus killed 1 of 6 wild-type
129/SvJ mice, whereas 5 × 108 CFU killed 6 of 6 mice.
We injected 1 × 108 CFU of S aureus IP into 8 additional cathepsin G+/+ and 9 cathepsin G/ 129/SvJ
mice. The survival of cathepsin G+/+ versus cathepsin G/
animals was not significantly different
(Fig 6A).
View larger version (14K):
[in this window]
[in a new window]
| Fig 6.
Survival of mice challenged with IP injections of S
aureus, E coli, and K pneumoniae. (A) Cathepsin
G+/+ or / mice in the 129/SvJ strain were challenged with
108 CFU of S aureus. There is no significant
difference between the survival of +/+ and / animals. (B)
K pneumoniae (1 × 106 CFU) was injected IP into
cathepsin G+/+ or / animals in the 129/SvJ strain, and
survival was plotted. No difference in survival was noted for the 2 groups. (C) Survival of wild-type, cathepsin G/, and NE/
mice in response to IP challenge with E coli. E coli (3 × 104 CFU) was injected IP into groups of 12 cathepsin
G/, NE/, and wild-type (+/+) littermates and survival
was assessed over time. The survival of cathepsin G/ mice is not
different from that of wild-type, but the survival NE/ mice is
significantly less than that of the other groups (P  .01).
|
|
Similarly, we wanted to determine whether cathepsin G was required for
the clearance of Gram-negative organisms. K pneumoniae and
E coli were chosen, because neutrophil elastase-deficient mice
have been shown to have a defect in the clearance of both organisms.80 Three different doses of K pneumoniae
(1 × 105, 5 × 105, or 1 × 106 CFU) were injected IP into a total of 27 cathepsin G+/+
mice and 23 cathepsin G/ mice. At every dose tested, the
survival of cathepsin G/ mice was not different from that
of wild-type mice. Data from the 1 × 106 CFU dose are
shown in Fig 6B. There is a trend toward fewer deaths in cathepsin
G/ mice, but this difference is not statistically significant.
Finally, we defined the LD50 for E coli in 129/SvJ mice, which
was 3 × 104 CFU. This dose of bacteria was
administered IP to 13 wild-type mice, 12 neutrophil
elastase/ mice, or 12 cathepsin G/ mice, all in the pure 129/SvJ background. As shown in Fig 6C, the neutrophil elastase-deficient mice all succumb to the E coli infection
within 48 hours, whereas approximately 50% of both wild-type and
cathepsin G-deficient mice survive. The difference between the survival of NE/ mice versus wild-type or cathepsin
G/ mice is statistically significant (P < .01).
Human cathepsin G does not inhibit growth of E coli or K
pneumoniae in vitro, but neutrophil elastase does.
Because previous reports of the microbicidal activities of cathepsin G
had exclusively used purified human cathepsin G and because 2 of the
microbicidal peptides of human cathepsin G (aa 77-83 and aa 117-136)
are not completely conserved in mice (see Discussion), we decided to
directly test and compare the microbicidal activities of highly
purified human cathepsin G and neutrophil elastase. We incubated
105 mid-log phase bacteria in the absence or presence of
purified human cathepsin G or neutrophil elastase (both at 50 µg/mL)
for 4 hours. Bacterial killing was quantified by applying serial
dilutions of bacteria to agarose plates followed by overnight
incubation. Although human neutrophil elastase inhibits the
growth of both K pneumoniae and E coli, as
previously shown,80 the same dose of cathepsin G has no
effect on the growth of either organism (Fig 7). Neither enzyme affects the growth
of S aureus.
View larger version (16K):
[in this window]
[in a new window]
| Fig 7.
Purified human neutrophil elastase inhibits the growth of
E coli and K pneumoniae, but human cathepsin G does
not. Mid-log phase bacteria (105) were incubated in the
absence (control) or presence of purified human neutrophil elastase or
cathepsin G at 37°C for 4 hours, as described in Materials and
Methods. Serial dilutions were immediately spread on agarose plates and
the number of CFUs was determined after overnight incubation. Although
neutrophil elastase inhibits the growth of both Gram-negative rods,
cathepsin G does not. Neither enzyme effects the growth of S
aureus. This experiment was repeated twice with similar results.
|
|
| |
DISCUSSION |
In this report, we describe mice bearing a loss-of-function mutation of
the cathepsin G gene. These mice have normal growth, development, and
fertility and display normal hematopoietic development. The neutrophils
of cathepsin G/ mice have normal morphology, normal
phagocytosis, and normal production of superoxide in response to in
vitro stimuli. These neutrophils have no defect in their ability to
migrate towards a variety of chemotactic stimuli in vitro and in vivo.
Cathepsin G/ mice are able to clear S aureus, K pneumoniae, and E coli infections as efficiently as
wild-type animals, suggesting that this enzyme is not necessary for the normal clearance of any of these bacterial species.
Even though cathepsin G is one of the most abundant proteins found in
human and mouse neutrophils, mice that are deficient for this enzyme
have no clear-cut phenotype, except for a transient defect in wound
healing that is accompanied by excessive neutrophilic infiltration of
wounds.65 The minimal phenotype observed is quite
surprising, because a large body of literature has strongly suggested
that cathepsin G might have specific, nonredundant functions in
physiologic settings.
One potential reason for the lack of an obvious phenotype in these
animals is that the cathepsin G mutation is not truly null. However,
cathepsin G mRNA and protein are not detectable in cathepsin G/ mice. Even more importantly, bone marrow extracts from
cathepsin G/ mice have no detectable ability to cleave
the peptide substrate N-Succinyl-Ala-Ala-Pro-Phe-pNA. The complete lack
of protease activity against this substrate indicates that there are no
other enzymes with the same specificity in the bone marrow. This result also suggests that, if the functions of cathepsin G can be rescued by
other proteases (eg, neutrophil elastase, azurocidin, and/or proteinase-3, which are all presumably present at normal levels in
cathepsin G/ mice), then these functions must be rescued by protease activities that are different from that of cathepsin G. This result argues that the gene that we have knocked-out is indeed the
functional orthologue of human cathepsin G, because human cathepsin G
also cleaves this peptide substrate with high specificity. It is also
possible that cathepsin G has specific functions that are masked by the
presence of the other related azurophil granule proteases in vivo.
Neutrophil elastase, azurocidin, and proteinase-3 are clustered on a
different chromosome (19 pter) and are coordinately regulated and
expressed along with cathepsin G in the azurophil granules of
promyelocytes. The functions of these highly related proteases may be
difficult to fully define until mice deficient for more than 1 of these
enzymes are analyzed.
The only assay that suggests that cathepsin G may have unique
substrates in vivo is wound healing. In the wound healing studies, we
learned that incisional wounds displayed a significant reduction in
tensile strength on day 7 after wounding; this defect was associated with increased neutrophilic inflammation at the site of
wounding.65 The wound strength had completely normalized by
day 10. The wound fluid of cathepsin G-deficient mice contained
significantly increased chemotactic activity for wild-type neutrophils,
suggesting that increased levels of proinflammatory cytokines (or other
mediators) were present in this wound fluid. Indirectly, these data
suggest that cathepsin G may be involved in inactivating
proinflammatory molecules at the sites of wound injury, thereby
providing a dampening effect on continued neutrophil influx at these
sites. Although the precise molecules responsible for this effect are
not known, the ability of cathepsin G to cleave and inactivate IL-1,
TNF, and IL-854-56 suggest that one or more of these
molecules could be involved in this process.
Cathepsin G has been shown to cleave and inactivate several clotting
factors,21-26 cleave and/or modulate the function of the thrombin receptor,27-29 and activate platelets in
vitro.30-38 However, we found no gross hemostatic defects
in cathepsin G/ animals. Because neutrophil elastase has
activity in many of the same in vitro assays involving clotting factors
and platelet activation, this enzyme may be capable of substituting for
cathepsin G in this setting; however, neutrophil elastase deficient
mice also have no obvious defects in hemostasis.80 It will
therefore be important to determine whether mice doubly deficient for
both cathepsin G and neutrophil elastase have more severe defects in hemostasis.
Cathepsin G-deficient mice have no apparent defect in their ability to
clear S aureus, K pneumoniae, or E coli. A
large number of studies had previously suggested that purified human
cathepsin G had growth-inhibitory effects and/or bactericidal effects
on S aureus, E coli, and additional bacteria in vitro
and that the protease activity of cathepsin G was not required for this
effect. Three different peptides derived from human cathepsin G (aa
1-5, aa 77-83, and aa 117-136) have been shown to have microbicidal activity. Although the first peptide (aa 1-5) is conserved in the
mouse, the sequence of the second peptide (aa 77-83) in mice is
HPDYNPQ. Alanine substitutions in positions 3, 6, and 7 of the human
HPQYNQR peptide each reduce bactericidal activity of the peptide by
approximately 2.5-fold.48 The third peptide (aa 117-136)
contains 16 of 20 identical residues in the mouse, but 2 of the 4 arginine residues that are important for microbicidal function are
altered (Arg 117 Gln and Arg 133 Ser). Because the 77-83 and 117-136 peptides are not completely conserved, it is possible that human
cathepsin G is important for bacterial killing, but murine cathepsin G
is not. However, in this study, we have not been able to demonstrate a
role for human cathepsin G in bacterial killing in vitro, in contrast
to previously published work. Although we do not understand the reason
for this difference, our in vitro and in vivo results do corroborate
one another.
Neutrophil elastase-deficient mice have a defect in their ability to
clear both K pneumoniae and E coli.80
Purified human neutrophil elastase inhibits the growth of these two
Gram-negative rods, but equivalent concentrations of human cathepsin G
had no inhibitory activity. The preparations of enzymes that were used in these assay were both fully active, and the concentrations of the
enzymes were carefully confirmed. Therefore, human and murine
neutrophil elastase both have a specific, nonredundant ability to kill
Gram-negative rods in vitro and in vivo; cathepsin G cannot substitute
for this function in either setting.
Several recent studies have suggested that cathepsin G is not only
found in the azurophil granules of neutrophils, but also on the surface
of these cells.17,18,81 A role for cathepsin G on the cell
surface has been suggested by the fact that 1 antichymotrypsin (and
also antibodies specific for cathepsin G) can reduce the ability of
neutrophils to undergo chemotaxis towards a variety of
stimuli.19,20 These results suggested that cell
surface-associated cathepsin G may play a specific role in the
chemotactic response. Additionally, cathepsin G itself has been shown
to have chemotactic activity for neutrophils and monocytes, suggesting
that cathepsin G release by neutrophils may amplify a chemoattractant
response.82 However, our data showed that there is no
specific chemotactic defect for cathepsin G-deficient neutrophils using
fMLP, C5a, or rhIL-8 as the chemotactic stimuli. Similarly, neutrophil
calcium fluxes induced by these 3 molecules are essentially normal in cathepsin G/ neutrophils. In vivo, we observed no clear
defect in the ability of neutrophils to migrate into the peritoneal
space of mice treated with thioglycolate or S aureus,
suggesting that the in vivo chemoattractant response (and also the
ability of neutrophils to leave the circulation and migrate into the
peritoneal space) is not impaired in these mice. Although the
possibility clearly exists that other proteases can substitute for the
function of cathepsin G in this setting, it is also possible that
cathepsin G may not be required for neutrophil chemotaxis in vivo.
Lymphokine-activated killer cells derived from mice that contain a
retained PGK-neo cassette in the granzyme B gene demonstrate a loss of
granzyme B mRNA, as expected, but also lose expression of granzymes C,
D, F, and G. This phenomenon, known as the neighborhood effect, is
thought to be due to the productive interaction of a locus control
region (LCR; presumably upstream from granzyme B) with the PGK-neo
cassette; this may disrupt normal interactions between the LCR and the
downstream granzyme genes. In mice containing the granzyme B mutation,
cathepsin G mRNA levels are normal.10,66 We have also shown
that the retained PGK-neo cassette in the cathepsin G gene has minimal
effects on the expression of the granzymes, suggesting that the
neighborhood effect is predominantly unidirectional.10 In
this report, we show that mast cells cultured in vitro from cathepsin
G-deficient mice contain no cathepsin G mRNA, as expected, but also
demonstrate a 10-fold reduction in mMCP-2 mRNA levels. These data
strongly suggest that the retained PGK-neo cassette in the cathepsin G
gene has a neighborhood effect on the mMCP-2 gene (and perhaps on
additional members of the mast cell chymase family located further
downstream). These data also suggest that this large protease gene
cluster may contain at least 2 distinct regulatory domains. One domain
would include all of the granzyme genes upstream from cathepsin G; this
domain may be regulated by an LCR near granzyme B. The second domain,
which would include cathepsin G and the mast cell chymases, may be
controlled by a separate LCR that is active in the myeloid compartment,
but not the NK/T-compartment. Further experiments will be required to test this hypothesis.
In summary, our experiments have shown that many of the previously
defined in vitro activities of cathepsin G are either irrelevant or
redundant when a whole animal model of cathepsin G deficiency is
examined. Additional experiments will be required to further define the
normal functions of cathepsin G, using mice that are also deficient for
neutrophil elastase or the related azurophil granule
proteases azurocidin and/or proteinase 3.
| |
ACKNOWLEDGMENT |
The authors thank Dr Bob Senior for many helpful discussions, Robin
Wesselschmidt for blastocyst injections, and Pam Goda and Kelly
Schrimpf for excellent animal care. We thank Dan Link and Jeff Haug for
performing the neutrophil calcium flux assays, Diane Kelley for the
chemotaxis assays, Marilyn Levy for Transmission Electron Microscopy,
and Sujan Shresta for the flow studies of lymphoid organs. Nancy
Reidelberger expertly prepared the manuscript.
| |
FOOTNOTES |
Submitted April 8, 1999; accepted October 4, 1999.
Supported by National Institutes of Health Grants No. DK49786 and
CA49712 (to T.J.L.), BL03774 (to C.T.N.P.), and HL54853 (to S.D.S.).
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Timothy J. Ley, MD, Washington University
Medical School, Division of Bone Marrow Transplantation and Stem Cell
Biology, 660 S Euclid Ave, Campus Box 8007, St Louis, MO 63110; e-mail:
timley{at}im.wustl.edu.
| |
REFERENCES |
1.
Bainton DF, Ullyot JL, Farquhar MG:
The development of neutrophilic polymorphonuclear leukocytes in the human bone marrow.
J Exp Med
134:907, 1971
[Abstract]
2.
Hanson RK, Connolly NL, Burnett D, Campbell EJ, Senior RM, Ley TJ:
Developmental regulation of the human cathespin G gene in myelomonocytic cells.
J Biol Chem
265:1524, 1990
[Abstract/Free Full Text]
3.
Heck LW, Rostand KS, Hunter FA, Brown A:
Isolation, characterization, and amino-terminal amino acid sequence analysis of human neutrophil cahtepsin G from normal donors.
Anal Biochem
158:217, 1986
[Medline]
[Order article via Infotrieve]
4.
Salvesen G, Farley D, Shuman J, Przybyla A, Reilly C, Travis J:
Molecular cloning of human cathepsin G: Structural similarity to mast cell and cytotoxic T lymphocyte proteinases.
Biochemistry
26:2289, 1987
[Medline]
[Order article via Infotrieve]
5.
Hof P, Mayr I, Huber R, Korzus E, Potempa J, Travis J, Powers JC, Bode W:
The 1.8 A crystal structure of human cathepsin G in complex with Suc-Val-Pro-PheP-(OPh)2: A Janus-faced proteinase with two opposite specificities.
EMBO J
15:5481, 1996
[Medline]
[Order article via Infotrieve]
6.
Hohn PA, Popescu NC, Hanson RD, Salvesen G, Ley TJ:
Genomic organization and chromosomal localization of the human cathepsin G gene.
J Biol Chem
23:13412, 1989
7.
Heusel JW, Scarpati EM, Jenkins NA, Gilbert DJ, Copeland NG, Shapiro SD, Ley TJ:
Molecular cloning, chromosomal location, and tissue-specific expression of the murine cathepsin G gene.
Blood
81:1614, 1993
[Abstract/Free Full Text]
8.
Crosby JL, Bleackley RC, Nadeau JH:
A complex of serine protease genes expressed preferentially in cytotoxic T-lymphocytes is closely linked to the T-cell receptor - and  -chain genes on mouse chromosome 14.
Genomics
6:252, 1990
[Medline]
[Order article via Infotrieve]
9.
Hanson RD, Hohn PA, Popescu NC, Ley TJ:
A cluster of hematopoietic serine protease genes is found on the same chromosomal band as the human / T-cell receptor locus.
Proc Natl Acad Sci USA
87:960, 1990
[Abstract/Free Full Text]
10.
Pham CTN, MacIvor DM, Hug BA, Heuse JW, Ley TJ:
Long-range disruption of gene expression by a selectable marker cassette.
Proc Natl Acad Sci USA
93:13090, 1996
[Abstract/Free Full Text]
11.
Huang R, Blom T, Hellman L:
Cloning and structural analysis of mMCP-1, mMCP-4, and mMCP-5, three mouse mast cell-specific serine proteases.
Eur J Immunol
21:1611, 1991
[Medline]
[Order article via Infotrieve]
12.
Caughey GH, Schaumberg TH, Zerweck EH, Butterfield JH, Hanson RD, Silverman GA, Ley TJ:
The human mast cell chymase gene (CMA1): Mapping to the cathepsin G/granzyme gene cluster and lineage-restricted expression.
Genomics
15:614, 1993
[Medline]
[Order article via Infotrieve]
13.
Gurish MF, Nadeau JH, Johnson KR, McNeil HP, Grattan KM, Austen KF, Stevens RL:
A closely linked complex of mouse mast cell-specific chymase genes on chromosome 14.
J Biol Chem
268:11372, 1993
[Abstract/Free Full Text]
14.
Zimmer M, Medcalf RL, Fink TM, Mattman C, Lichter P, Jenne DE:
Three human elastase-like genes coordinately expressed in the myelomonocyte lineage are organized as a single genetic locus on 19pter.
Proc Natl Acad Sci USA
89:8215, 1992
[Abstract/Free Full Text]
15.
Grisolano JL, Sclar GM, Ley TJ:
Early meyloid-specific expression of the human cathepsin G gene in transgenic mice.
Proc Natl Acad Sci USA
91:8989, 1994
[Abstract/Free Full Text]
16.
Tanaku T, Minematsu Y, Reilly CF, Travis J, Powers JC:
Human leukocyte cathepsin G. Subsite mapping with 4-nitroanilides, chemical modification, and effect of possible cofactors.
Biochemistry
24:2040, 1985
[Medline]
[Order article via Infotrieve]
17.
Maison CM, Villiers CL, Colomb MG:
Proteolysis of C3 on U937 cell plasma membranes.
J Immunol
147:921, 1991
[Abstract]
18.
Owen CA, Campbell MA, Sannes PL, Boukedes SS, Campbell EJ:
A surface-bound elastase and cathepsin G on human neutrophils: A novel, non-oxidative mechanism by which neutrophils focus and preserve catalytic activity of serine proteases.
J Cell Biol
131:775, 1995
[Abstract/Free Full Text]
19.
Stockley RA, Shaw J, Afford SC, Morrison HM, Burnett D:
Effect of alpha-1-proteinase inhibitor on neutrophil chemotaxis.
Am J Respir Cell Mol Biol
2:163, 1990
20.
Lomas DA, Stone SR, Llewellyn-Jones C, Keogan M-T, Wang Z, Rubin H, Carrell RW, Stockley RA:
The control of neutrophil chemotaxis by inhibitors of cathepsin G and chymotrypsin.
J Biol Chem
270:23437, 1995
[Abstract/Free Full Text]
21.
Gramse M, Bingenheimer C, Havemann K:
Degradation of human fibrinogen by chymotrypsin-like neutral protease from human granulocytes.
Thromb Res
19:210, 1980
22.
Turkington PT, Blumsom NL, Elmore DT:
The degradation of bovine and human prothrombin by human polymorphonuclear leukocyte cathepsin G.
Thromb Res
44:339, 1996
23.
Brezniak DV, Brower MS, Witting JI, Walz DA, Fenton JW II:
Human alpha- to zeta-thrombin cleavage occurs with neutrophil cathepsin G or chymotrypsin while fibrinogen clotting activity is retained.
Biochemistry
29:3536, 1990
[Medline]
[Order article via Infotrieve]
24.
Turkington PT:
Cathepsin G, a regulator of human vitamin K. Dependent clotting factors and inhibitors.
Thromb Res
67:147, 1992
[Medline]
[Order article via Infotrieve]
25.
Anderssen T, Halvorsen H, Bajaj SP, Osterud B:
Human leukocyte elastase and cathepsin G inactivate factor VII by limited proteolysis.
Thromb Haemost
70:414, 1993
[Medline]
[Order article via Infotrieve]
26.
Allen DH, Tracy PB:
Human coagulation factor V is activated to the functional cofactor by elastase and cathepsin G expressed at the monocyte surface.
J Biol Chem
270:1408, 1995
[Abstract/Free Full Text]
27.
Weksler BB, Jaffe EA, Brower MS, Cole OF:
Human leukocyte cathepsin G and elastase specifically suppress thrombin-induced prostacyclin production in human endothelial cells.
Blood
74:1627, 1989
[Abstract/Free Full Text]
28.
Molino M, Blanchard N, Belmonte E, Tarver AP, Abrams C, Hoxie JA, Cerletti C, Brass LF:
Proteolysis of the human platelet and endothelial cell thrombin receptor by neutrophil-derived cathepsin G.
J Biol Chem
270:11168, 1995
[Abstract/Free Full Text]
29.
Renesto P, Chignard M:
Enhancement of cathepsin G-induced platelet activation by leukocyte elastase: Consequence for the neutrophil-mediated platelet activation.
Blood
82:139, 1993
[Abstract/Free Full Text]
30.
Selak MA, Chignard M, Smith JB:
Cathepsin G is a strong platelet agonist released by neutrophils.
Biochem J
251:293, 1988
[Medline]
[Order article via Infotrieve]
31.
Selak MA, Smith JB:
Cathepsin G binding to human platelets.
Am J Physiol
266:39, 1990
32.
Ferrer-Lopez P, Renesto P, Schattner M, Bassot S, Laurent P, Chignard M:
Activation of human platelets by C5a-stimulated neutrophils: A role for cathepsin G.
Am J Physiol
258:C1100, 1990
[Abstract/Free Full Text]
33.
Evangelista V, Rajtar G, de Gaetano G, White JG, Cerletti C:
Platelet activation by fMLP-stimulated polymorphonuclear leukocytes: The activity of cathepsin G is not prevented by antiproteinases.
Blood
77:2379, 1991
[Abstract/Free Full Text]
34.
Evangelista V, Piccardone P, White JG, de Gaetano G, Cerletti C:
Cathepsin G-dependent platelet stimulation by activated polymorphonuclear leukocytes and its inhibition by antiproteinases: Role of P-selectin-mediated cell-cell adhesion.
Blood
81:2947, 1993
[Abstract/Free Full Text]
35.
LaRosa CA, Rohrer MJ, Benoit SE, Rodino LJ, Barnard MR, Michelson AD:
Human neutrophil cathepsin G is a potent platelet activator.
J Vasc Surg
19:306, 1994
[Medline]
[Order article via Infotrieve]
36.
Cerletti C, Evangelista V, Molino M, de Gaetano G:
Platelet activation by polymorphonuclear leukocytes: Role of cathepsin G and P-selectin.
Thromb Haemost
74:218, 1995
[Medline]
[Order article via Infotrieve]
37.
Si-Tahar M, Renesto P, Falet H, Rendu F, Chignard M:
The phospholipase C/protein kinase C pathway is involved in cathepsin G-induced human platelet activation. Comparison with thrombin.
Biochem J
313:401, 1996
38.
Renesto P, Si-Tahar M, Moniatte M, Balloy V, Van Dorsselaer A, Pidard D, Chignard M:
Specific inhibition of thrombin-induced cell activation by the neutrophil proteinases elastase, cathepsin G, and proteinase 3: Evidence for distinct cleavage sites within the aminoterminal domain of the thrombin receptor.
Blood
89:1944, 1997
[Abstract/Free Full Text]
39.
Odeberg H, Olsson I:
Antibacterial activity of cationic proteins from human granulocytes.
J Clin Invest
56:1118, 1975
40.
Odeberg H, Olsson I:
Mechanisms for the microbicidal activity of cationic proteins of human granulocytes.
Infect Immunity
14:1269, 1975
41.
Shafer WM, Onunka VC, Martin LE:
Antigonococcal activity of human neutrophil cathepsin G.
Infect Immunity
54:184, 1986
[Abstract/Free Full Text]
42.
Shafer WM, Onunka VC:
Mechanism of staphylococcal resistance to non-oxidative antimicrobial action of neutrophils: Importance of pH and ionic strength in determining the bacterial action of cathepsin G.
J Gen Microbiol
135:825, 1989
[Abstract/Free Full Text]
43.
Alford CE, Amaral E, Campbell PA:
Listericidal activity of human neutrophil cathepsin G.
J Gen Microbiol
136:997, 1990
[Abstract/Free Full Text]
44.
Guyonnet V, Johnson JK, Bangalore N, Travis J, Long PL:
In vitro activity of the human neutrophil cathepsin G on Eimeria tenella sporozoites.
J Parasitol
77:775, 1991
[Medline]
[Order article via Infotrieve]
45.
Miyasaki KT, Bodeau AL:
In vitro killing of oral Capnocytophaga by granule fractions of human neutrophils is associated with cathepsin G activity.
J Clin Invest
87:1585, 1991
46.
Bangalore N, Travis J, Onunka VC, Pohl J, Shafer WM:
Identification of the primary antimicrobial domains in human neutrophil cathepsin G.
J Biol Chem
265:13584, 1990
[Abstract/Free Full Text]
47.
Shafer WM, Polh J, Onunka VC, Bangalore N, Travis J:
Human lysosomal cathepsin G and granzyme B share a functionally conserved broad spectrum antibacterial peptide.
J Biol Chem
266:112, 1991
[Abstract/Free Full Text]
48.
Shafer WM, Hubalek F, Huang M, Pohl J:
Bactericidal activity of a synthetic peptide (CG 117-136) of human lysosomal cathepsin G is dependent on arginine content.
Infect Immunity
64:4842, 1996
[Abstract]
49.
Reilly CF, Tewksbury DA, Schechter NM, Travis J:
Rapid conversion of angiotensin I to angiotensin II by neutrophil and mast cell proteinases.
J Biol Chem
257:8619, 1982
[Abstract/Free Full Text]
50.
Nahori M-A, Renesto P, Vargaftig BB, Chignard M:
Activation and damage of cultured airway epithelial cells by human elastase and cathepsin G.
Eur J Pharmacol
228:213, 1992
[Medline]
[Order article via Infotrieve]
51.
Sommerhoff CP, Nadel JA, Basbaum CB, Caughey GH:
Neutrophil elastase and cathepsin G stimulate secretion from cultured bovine airway gland serous cells.
J Clin Invest
85:682, 1990
52.
Peterson MW:
Neutrophil cathepsin G increases transendothelial albumin flux.
J Lab Clin Med
113:297, 1989
[Medline]
[Order article via Infotrieve]
53.
Franzoso G, Biswas P, Poli G, Carlson LM, Brown KD, Tomita-Yamaguchi M, Fauci AS, Siebenlist UK:
A family of serine proteases expressed exclusively in myelo-monocytic cells specifically processes the nuclear factor-Kappa B subunit p65 in vitro and may impair human immunodeficency virus replication in these cells.
J Exp Med
180:1445, 1994
[Abstract/Free Full Text]
54.
Scuderi P, Nez PA, Derr ML, Wong BJ, Valdez CM:
Cathepsin-G and leukocyte elastase inactivate human tumor necrosis factor and lymphotoxin.
Cell Immunol
135:299, 1991
[Medline]
[Order article via Infotrieve]
55.
Hazuda DM, Strickler J, Kueppers F, Simon PL, Young PR:
Processing of precursor interleukin 1 beta and inflammatory disease.
J Biol Chem
265:6318, 1990
[Abstract/Free Full Text]
56.
Padrines M, Wolf M, Walz A, Baggiolini M:
Interleukin-8 processing by neutrophil elastase, cathepsin G and proteinase-3.
FEBS Lett
352:231, 1994
[Medline]
[Order article via Infotrieve]
57.
Malemud CJ, Janoff A:
Identification of neutral proteases in human neutrophil granules that degrade articular cartilage proteoglycan.
Arthritis Rheum
18:361, 1975
[Medline]
[Order article via Infotrieve]
58.
Roughley PJ, Barrett AJ:
The degradation of cartilage proteoglycans by tissue proteinases. Proteoglycan structure and its susceptibility to proteolysis.
Biochem J
167:629, 1977
[Medline]
[Order article via Infotrieve]
59.
Starkey PM, Barrett AJ, Burleigh MC:
The degradation of articular collagen by neutrophil proteinases.
Biochem Biophys Acta
483:386, 1977
[Medline]
[Order article via Infotrieve]
60.
Wintroub BU, Coblyn JS, Kaempfer CE, Austen KF:
Cleavage of fibronectin by the human neutrophil neutral peptide-generating protease.
Proc Natl Acad Sci USA
77:5448, 1980
[Abstract/Free Full Text]
61.
Reilly CF, Travis J:
The degradation of human lung elastin by neutrophil proteinases.
Biochim Biophys Acta
621:147, 1980
[Medline]
[Order article via Infotrieve]
62.
Vartio T, Seppa H, Vaheri A:
Susceptibility of soluble and matrix fibronectins to degradation by tissue proteinases, mast cell chymase and cathepsin G.
J Biol Chem
256:471, 1981
[Free Full Text]
63.
Vartio T:
Characterization of the binding domains in the fragments cleaved by cathepsin G from human plasma fibronectin.
Eur J Biochem
123:223, 1982
[Medline]
[Order article via Infotrieve]
64.
Capodici C, Berg RA:
Cathepsin G degrades denatured collagen.
Inflammation
13:137, 1989
[Medline]
[Order article via Infotrieve]
65.
Abbott RE, Corral CJ, MacIvor DM, Lin X, Ley TJ, Mustoe TA:
Augmented inflammatory responses and altered wound healing in cathepsin G-deficient mice.
Arch Surg
133:1002, 1998
[Abstract/Free Full Text]
66.
Heusel JW, Wesselschmidt R, Shresta S, Russell J, Ley TJ:
Cytotoxic lymphocytes require granzyme B for the rapid induction of DNA fragmentation and apoptosis in allogeneic target cells.
Cell
76:977, 1994
[Medline]
[Order article via Infotrieve]
67.
Ley TJ, Maloney KA, Gordon JI, Schwartz AL:
Globin gene expression in erythroid human fetal liver cells.
J Clin Invest
83:1032, 1989
68.
Senior R, Campbell EJ:
Cathepsin G in human mononuclear phagocytes: Comparisons between monocytes and U937 monocyte-like cells.
J Immunol
132:2547, 1984
[Abstract]
69.
Eklund KK, Ghildyal N, Austen F, Friend DS, Schiller V, Stevens RL:
Mouse bone marrow-derived mast cells (mBMMC) obtained in vitro from mice that are mast cell-deficient in vivo expresses the same panel of granule proteases as mBMMC and serosal mast cells from their normal littermates.
J Exp Med
180:67, 1994
[Abstract/Free Full Text]
70.
Sugawara T, Miyamoto M, Takayama S, Kato M:
Separation of neutrophils from blood in human and laboratory animals and comparison of the chemotaxis.
J Pharmacol Toxicol Methods
33:91, 1995
[Medline]
[Order article via Infotrieve]
71.
Aiuti A, Webb IJ, Bleul C, Springer T, Gutierrez-Ramos JC:
The chemokine SDF-1 is a chemoattractant for human CD34+ hematopoietic progenitor cells and provides a new mechanism to explain the mobilization of CD34+ progenitors to peripheral blood.
J Exp Med
185:111, 1997
[Abstract/Free Full Text]
72.
Kim C, Epner E, Forrester W, Groudine M:
Inactivation of the human beta-globin gene by targeted insertion into the beta-globin locus control region.
Genes Dev
6:928, 1992
[Abstract/Free Full Text]
73.
Fiering S, Kim C, Epner E, Groudine M:
An "in-out" strategy using gene targeting and FLP recombinase for the functional dissection of complex DNA regulatory elements: Analysis of the beta-globin locus control region.
Proc Natl Acad Sci USA
90:8469, 1993
[Abstract/Free Full Text]
74.
Fiering S, Epner E, Robinson K, Zhuang Y, Telling A, Hu M, Martin DIK, Enver T, Ley TJ, Groudine M:
Targeted deletion of 5' HS2 of the murine -globin LCR reveals that it is not essential for proper regulation of the -globin locus.
Genes Dev
9:2203, 1995
[Abstract/Free Full Text]
75.
Hug BA, Wesselschmidt RL, Fiering S, Bender MA, Epner E, Groudine M, Ley TJ:
Analysis of mice containing a targeted deletion of -globin locus control region 5' hypersensitive 3.
Mol Cell Biol
16:2906, 1996
[Abstract]
76.
Ghildyal N, Friend DS, Nicodemus CF, Austen KF, Stevens RL:
Reversible expression of mouse mast cell protease 2 mRNA and protein in cultured mast cells exposed to IL-10.
J Immunol
151:3206, 1993
[Abstract]
77.
Eklund KK, Ghildyal N, Austen KF, Stevens RL:
Induction by IL-9 and suppression by IL-3 and IL-4 of the levels of chromosome 14-derived transcripts that encode late-expressed mouse mast cell proteases.
J Immunol
151:4266, 1993
[Abstract]
78.
Kilpatrick L, Johnson JL, Nickbarg EG, Wang Z, Clifford TF, Banach M, Cooperman BS, Douglas SD, Rubin H:
Inhibition of human neutrophil superoxide generation by alpha-1-antichymotrypsin.
J Immunol
146:2388, 1991
[Abstract]
79.
Kilpatrick L, McCawley L, Naciappan V, Greer W, Majumdar S, Korchak HM, Douglas SD:
Alpha-1-antichymotrypsin inhibits the NADPH oxidase-enzyme complex in phorbol ester-stimulated neutrophil membranes.
J Immunol
149:3059, 1992
[Abstract]
80.
Belaaouaj B, McCarthy R, Baumann M, Gao Z, Ley TJ, Abraham SN, Shapiro SD:
Mice lacking neutrophil elastase reveal impaired host defense against gram negative bacterial sepsis.
Nat Med
4:615, 1998
[Medline]
[Order article via Infotrieve]
81.
Owen CA, Campbell EJ:
Angiotensin II generation at the cell surface of activated neutrophils: Novel cathepsin G-mediated catalytic activity that is resistant to inhibition.
J Immunol
160:1436, 1998
[Abstract/Free Full Text]
82.
Chertov O, Ueda H, Xu LL, Tani K, Murphy WJ, Wang JM, Howard OM, Sayers TJ, Oppenheim JJ:
Identification of human neutrophil-derived cathepsin G and azurocidin/CAP37 as chemoattractants for mononuclear cells and neutrophils.
J Exp Med
186:739, 1997
[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. Dabek, L. Ferrier, R. Roka, K. Gecse, A. Annahazi, J. Moreau, J. Escourrou, C. Cartier, G. Chaumaz, M. Leveque, et al.
Luminal Cathepsin G and Protease-Activated Receptor 4: A Duet Involved in Alterations of the Colonic Epithelial Barrier in Ulcerative Colitis
Am. J. Pathol.,
July 1, 2009;
175(1):
207 - 214.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. J. Wilson, K. C. Nannuru, and R. K. Singh
Cathepsin G Recruits Osteoclast Precursors via Proteolytic Activation of Protease-Activated Receptor-1
Cancer Res.,
April 1, 2009;
69(7):
3188 - 3195.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Manolov, T. T. Tan, A. Forsgren, and K. Riesbeck
Moraxella-Dependent {alpha}1-Antichymotrypsin Neutralization: A Unique Virulence Mechanism
Am. J. Respir. Cell Mol. Biol.,
May 1, 2008;
38(5):
609 - 617.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Benarafa, G. P. Priebe, and E. Remold-O'Donnell
The neutrophil serine protease inhibitor serpinb1 preserves lung defense functions in Pseudomonas aeruginosa infection
J. Exp. Med.,
August 6, 2007;
204(8):
1901 - 1909.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Methot, J. Rubin, D. Guay, C. Beaulieu, D. Ethier, T. J. Reddy, D. Riendeau, and M. D. Percival
Inhibition of the Activation of Multiple Serine Proteases with a Cathepsin C Inhibitor Requires Sustained Exposure to Prevent Pro-enzyme Processing
J. Biol. Chem.,
July 20, 2007;
282(29):
20836 - 20846.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Shimoda, N. Fukazawa, K. Nonomura, and R. L. Fairchild
Cathepsin G Is Required for Sustained Inflammation and Tissue Injury after Reperfusion of Ischemic Kidneys
Am. J. Pathol.,
March 1, 2007;
170(3):
930 - 940.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. R. Sutton, N. J. Waterhouse, K. A. Browne, K. Sedelies, A. Ciccone, D. Anthony, A. Koskinen, A. Mullbacher, and J. A. Trapani
Residual active granzyme B in cathepsin C-null lymphocytes is sufficient for perforin-dependent target cell apoptosis
J. Cell Biol.,
February 12, 2007;
176(4):
425 - 433.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. F. de Haar, P. S. Hiemstra, M. T. J. M. van Steenbergen, V. Everts, and W. Beertsen
Role of Polymorphonuclear Leukocyte-Derived Serine Proteinases in Defense against Actinobacillus actinomycetemcomitans
Infect. Immun.,
September 1, 2006;
74(9):
5284 - 5291.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Shao, A. Belaaouaj, C. L. M. J. Verlinde, X. Fu, and J. W. Heinecke
Methionine Sulfoxide and Proteolytic Cleavage Contribute to the Inactivation of Cathepsin G by Hypochlorous Acid: AN OXIDATIVE MECHANISM FOR REGULATION OF SERINE PROTEINASES BY MYELOPEROXIDASE
J. Biol. Chem.,
August 12, 2005;
280(32):
29311 - 29321.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. D. Unwin, A. Pierce, R. B. Watson, D. W. Sternberg, and A. D. Whetton
Quantitative Proteomic Analysis Using Isobaric Protein Tags Enables Rapid Comparison of Changes in Transcript and Protein Levels in Transformed Cells
Mol. Cell. Proteomics,
July 1, 2005;
4(7):
924 - 935.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. C. Taggart, C. M. Greene, T. P. Carroll, S. J. O'Neill, and N. G. McElvaney
Elastolytic Proteases: Inflammation Resolution and Dysregulation in Chronic Infective Lung Disease
Am. J. Respir. Crit. Care Med.,
May 15, 2005;
171(10):
1070 - 1076.
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. A. Revell, W. J. Grossman, D. A. Thomas, X. Cao, R. Behl, J. A. Ratner, Z. H. Lu, and T. J. Ley
Granzyme B and the Downstream Granzymes C and/or F Are Important for Cytotoxic Lymphocyte Functions
J. Immunol.,
February 15, 2005;
174(4):
2124 - 2131.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. O. Hirche, J. P. Gaut, J. W. Heinecke, and A. Belaaouaj
Myeloperoxidase Plays Critical Roles in Killing Klebsiella pneumoniae and Inactivating Neutrophil Elastase: Effects on Host Defense
J. Immunol.,
February 1, 2005;
174(3):
1557 - 1565.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. A. Lane and T. J. Ley
Neutrophil Elastase Is Important for PML-Retinoic Acid Receptor {alpha} Activities in Early Myeloid Cells
Mol. Cell. Biol.,
January 1, 2005;
25(1):
23 - 33.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. D. Swain, T. W. Wright, P. M. Degel, F. Gigliotti, and A. G. Harmsen
Neither Neutrophils nor Reactive Oxygen Species Contribute to Tissue Damage during Pneumocystis Pneumonia in Mice
Infect. Immun.,
October 1, 2004;
72(10):
5722 - 5732.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J.-P. Levesque, F. Liu, P. J. Simmons, T. Betsuyaku, R. M. Senior, C. Pham, and D. C. Link
Characterization of hematopoietic progenitor mobilization in protease-deficient mice
Blood,
July 1, 2004;
104(1):
65 - 72.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. O. Hirche, E. C. Crouch, M. Espinola, T. J. Brokelman, R. P. Mecham, N. DeSilva, J. Cooley, E. Remold-O'Donnell, and A. Belaaouaj
Neutrophil Serine Proteinases Inactivate Surfactant Protein D by Cleaving within a Conserved Subregion of the Carbohydrate Recognition Domain
J. Biol. Chem.,
June 25, 2004;
279(26):
27688 - 27698.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. O. Hirche, J. J. Atkinson, S. Bahr, and A. Belaaouaj
Deficiency in Neutrophil Elastase Does Not Impair Neutrophil Recruitment to Inflamed Sites
Am. J. Respir. Cell Mol. Biol.,
April 1, 2004;
30(4):
576 - 584.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Ottonello, A. L. Epstein, M. Mancini, P. Dapino, and F. Dallegri
Monoclonal LYM-1 antibody-dependent cytolysis by human neutrophils exposed to GM-CSF: auto-regulation of target cell attack by cathepsin G
J. Leukoc. Biol.,
January 1, 2004;
75(1):
99 - 105.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. S. Lopez-Boado, M. Espinola, S. Bahr, and A. Belaaouaj
Neutrophil Serine Proteinases Cleave Bacterial Flagellin, Abrogating Its Host Response-Inducing Activity
J. Immunol.,
January 1, 2004;
172(1):
509 - 515.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Saeftel, M. Arndt, S. Specht, L. Volkmann, and A. Hoerauf
Synergism of Gamma Interferon and Interleukin-5 in the Control of Murine Filariasis
Infect. Immun.,
December 1, 2003;
71(12):
6978 - 6985.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. D. Shapiro, N. M. Goldstein, A. M. Houghton, D. K. Kobayashi, D. Kelley, and A. Belaaouaj
Neutrophil Elastase Contributes to Cigarette Smoke-Induced Emphysema in Mice
Am. J. Pathol.,
December 1, 2003;
163(6):
2329 - 2335.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
P. Westervelt, A. A. Lane, J. L. Pollock, K. Oldfather, M. S. Holt, D. B. Zimonjic, N. C. Popescu, J. F. DiPersio, and T. J. Ley
High-penetrance mouse model of acute promyelocytic leukemia with very low levels of PML-RAR{alpha} expression
Blood,
September 1, 2003;
102(5):
1857 - 1865.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Dziarski, K. A. Platt, E. Gelius, H. Steiner, and D. Gupta
Defect in neutrophil killing and increased susceptibility to infection with nonpathogenic gram-positive bacteria in peptidoglycan recognition protein-S (PGRP-S)-deficient mice
Blood,
July 15, 2003;
102(2):
689 - 697.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. S. Grenda, S. E. Johnson, J. R. Mayer, M. L. McLemore, K. F. Benson, M. Horwitz, and D. C. Link
Mice expressing a neutrophil elastase mutation derived from patients with severe congenital neutropenia have normal granulopoiesis
Blood,
October 16, 2002;
100(9):
3221 - 3228.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Bolon and E. Galbreath
Use of Genetically Engineered Mice in Drug Discovery and Development: Wielding Occam's Razor to Prune the Product Portfolio
International Journal of Toxicology,
January 1, 2002;
21(1):
55 - 64.
[Abstract]
[PDF]
|
|
|
|
|
|
|
L. Volkmann, M. Saeftel, O. Bain, K. Fischer, B. Fleischer, and A. Hoerauf
Interleukin-4 Is Essential for the Control of Microfilariae in Murine Infection with the Filaria Litomosoides sigmodontis
Infect. Immun.,
May 1, 2001;
69(5):
2950 - 2956.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Ge, T. Jippo, Y.-M. Lee, S. Adachi, and Y. Kitamura
Independent Influence of Strain Difference and mi Transcription Factor on the Expression of Mouse Mast Cell Chymases
Am. J. Pathol.,
January 1, 2001;
158(1):
281 - 292.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. M. Cole, J. Shi, A. Ceccarelli, Y.-H. Kim, A. Park, and T. Ganz
Inhibition of neutrophil elastase prevents cathelicidin activation and impairs clearance of bacteria from wounds
Blood,
January 1, 2001;
97(1):
297 - 304.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. a. Belaaouaj, K. S. Kim, and S. D. Shapiro
Degradation of Outer Membrane Protein A in Escherichia coli Killing by Neutrophil Elastase
Science,
August 18, 2000;
289(5482):
1185 - 1187.
[Abstract]
[Full Text]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION