|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, Vol. 94 No. 12 (December 15), 1999:
pp. 4358-4369
By
From the Departments of Pediatrics and Immunohematology and Blood
Transfusion, Leiden University Medical Center, Leiden, The Netherlands.
To evaluate the role of T-cell selection in the thymus and/or
periphery in T-cell immune reconstitution after allogeneic bone marrow
transplantation (allo-BMT), we have analyzed the overall and
antigen-specific T-cell repertoires in pediatric allo-BMT recipients
treated for leukemia. We observed a lack of overall T-cell receptor
(TCR) diversity in the repopulating T cells at 3 months after allo-BMT,
as was deduced from complementarity determining region 3 (CDR3) size
distribution patterns displaying reduced complexity. This was noted
particularly in recipients of a T-cell-depleted (TCD) graft and, to a
lesser extent, also in recipients of unmanipulated grafts. At 1 year
after allo-BMT, normalization was observed of TCR CDR3 size complexity
in almost all recipients. Analysis of the antigen-specific T-cell
repertoire at 1 year after BMT showed that the T cells responding to
tetanus toxoid (TT) differed in TCR gene segment usage and in amino
acid composition of the CDR3 region when comparing the recipient with
the donor. Moreover, the TT-specific TCR repertoire was found to be
stable within a given allo-BMT recipient, because TT-specific T cells
with completely identical TCRs were found at 3 consecutive years after
transplantation. These observations suggest an important role for
T-cell selection processes in the complete restoration of the T-cell
immune repertoire in children after allo-BMT.
ALLOGENEIC BONE MARROW transplantation
(allo-BMT) is a possibly curative treatment of otherwise incurable
malignant hematologic disorders and severe immunodeficiency diseases.
After allo-BMT, the recipients demonstrate a varying period of
immunoincompetence that can last for up to several years after
transplantation and may cause significant morbidity and
mortality.1-4 Moreover, immune reconstitution can be
hampered by the occurrence of acute and chronic
graft-versus-host-disease (GVHD).1,5 Immune reconstitution after allo-BMT has been studied extensively in
adults.1,3,6,7 The innate immune system, ie, the function
of phagocytes, fully recovers in the first weeks to months after BMT,
whereas complete reconstitution of the adaptive immune system, ie, B
and T lymphocytes, takes much longer. As a result, infectious
complications exist for a prolonged time after allo-BMT.8
During normal T-cell development, bone marrow (BM)-derived T-cell
precursors home to the thymus, where they are subjected to positive and
negative selection processes upon interactions with major
histocompatibility complex (MHC) class I and II molecules expressed on
thymic epithelial and dendritic cells.9-11 These selection
processes will ensure a nonautoreactive peripheral T-cell repertoire
that is restricted to recognizing antigenic peptides in the context of
self-MHC. Within the thymic micro-environment, MHC class II-mediated
interactions result mostly in CD4+ T-cell development,
whereas MHC class I-mediated interactions result in CD8+
T-cell development. During T-cell selection in normal individuals, T-cell receptor (TCR)-B and TCR-A genes are sequentially and randomly rearranged from a pool of TCR gene segments, resulting in a diverse TCR
repertoire.12-14 However, this repertoire is less diverse
than theoretically possible due to nonrandom TCRV and TCRJ gene segment usage, nonrandom amino acid incorporation in the TCR complementarity determining region 3 (CDR3),15-17 and skewing of certain
TCRBV and TCRAV gene segments towards CD4+ or
CD8+ T-cell subsets.18,19
After the loss of mature T cells, such as occurs after chemotherapy or
after myeloablative conditioning before allo-BMT, regeneration of the
T-cell population can proceed via at least 2 pathways. First, transfer
of graft-derived mature donor T cells to the periphery followed by
antigen-driven expansion. This process, which represents a
thymus-independent pathway of reconstitution, most likely provides the
first wave of T cells after allo-BMT.20-22 These mature T
cells with a limited TCR diversity23 can be maintained in
the periphery for up to 10 to 20 years,24 provided that
appropriate TCR-peptide/MHC interactions occur.25,26 The
second mechanism involves selection of graft-derived precursor cells in
the thymus27-29 and/or possibly at peripheral selection
sites.30,31 The process of thymic T-cell selection probably
accounts for the more durable reconstitution of the T-cell compartment
and potentiates a more diverse TCR repertoire. Because thymic functions
decrease with increasing age,4,22 this selection mechanism
is thought to be the most effective in young allo-BMT recipients, as is
reflected by the delayed recovery of especially CD4+ T
cells in adult allo-BMT recipients.3,6,7
At present, it is not precisely known to what extent expansion of
mature graft-derived T cells and thymic selection of precursor T cells
contribute to T-cell immune reconstitution after allo-BMT in children.
To address this question, we analyzed in the present study the overall
and antigen-specific T-cell repertoires in well-defined groups of
pediatric allo-BMT recipients, ie, grafted either with BM cells from an
HLA-identical sibling donor or a matched unrelated donor (MUD) and
within the latter group, with or without T-cell depletion (TCD) of the graft.
Patients.
Between November 1994 and October 1996, 44 children with hematologic
malignancies were treated with an HLA-identical allo-BMT at the
Department of Pediatrics of the Leiden University Medical Center
(Leiden, The Netherlands). Conditioning of the patients was performed
according to protocols of the Dutch Childhood Leukemia Study Group
(DCLSG). All children showed complete engraftment. Fifteen children
died: 11 of relapse of the original disease and 4 of infection. For the
purpose of our study, we selected 3 groups of patients: (I)
myelodysplastic syndrome (MDS) patients treated with a TCD MUD BM
graft; (II) (juvenile) chronic myeloid leukemia [(J)CML] patients
treated with an unmanipulated MUD BM graft; and (III) acute leukemia
patients treated with an unmanipulated HLA-identical sibling BM graft.
The sibling donors were 6 to 25 years old (mean age, 13.1 years),
whereas MUD donors in general were more than 30 years old. TCD ( Processing of peripheral blood mononuclear cells (PBMC),
fluorescence-activated cell sorting (FACS) sorting, and
immunophenotypical analysis.
PBMC were isolated from approximately 20 mL heparinized blood via
Ficoll-Isopaque (LUMC Hospital Pharmacy, Leiden, The Netherlands) density centrifugation. PBMC (2 × 106 to 3 × 106) were used for FACS sorting to separate
CD4+ and CD8+ T-cell subsets using
fluorescein-conjugated anti-CD4 and R-phycoerythrin-conjugated anti-CD8
monoclonal antibodies (MoAbs; Dakopatts, Glostrup, Denmark) and a
FACScan (Becton Dickinson, Mountain View, CA). FACS-sorted subsets (8 × 103 to 3 × 105 cells) were
collected in fetal calf serum, washed twice in phosphate-buffered saline (PBS), and stored at Generation of antigen-specific T-cell lines/clones.
For the analysis of the antigen-specific TCR repertoire, tetanus toxoid
(TT)-specific T-cell lines were generated as described previously.37 Briefly, 3 to 6 × 106 PBMC
were grown in culture medium in the presence of 1.9 limes flocculationis (lf)/mL TT (RIVM, Bilthoven, The Netherlands). After at
least 2 rounds of TT-stimulation and subsequent TT-specificity testing
in a 3H-thymidine incorporation assay, T-cell clones were
generated from some of these lines by limiting dilution.38
The T-cell lines and clones that, after repeated testing, had a
stimulation index (SI) greater than 3, with more than 5 × 103 counts per minute (cpm) in the case of T-cell lines or
more than 1 × 103 cpm in the case of T-cell clones,
were considered to be TT-specific (SI= 3H incorporation of
T+APC+TT/3H incorporation T+APC only). Epstein-Barr virus
(EBV)-transformed B-cell lines of recipients and their respective
donors (MUD/siblings) were used as antigen-presenting cells (APC) in
these tests. Blocking of the proliferative response was analyzed as
described previously37 using MoAbs directed against MHC
class I (W6/32), MHC class II (PdV5.2), CD4 (RIV6), and HLA-DR
(B8.11.2), which remained present during the entire assay.
RNA extraction, cDNA synthesis, and polymerase chain reaction (PCR)
amplification.
Total RNA was extracted from FACS-sorted CD4+ and
CD8+ T-cell subsets and from TT-specific T-cell clones (8 × 103 to 1 × 106 cells). The RNA
was converted into cDNA using oligo-dT (Promega, Madison, WI). The cDNA
was subjected to PCR amplification for the determination of TCR gene
segment usage. PCR amplification and TCR-primers were as described
previously.19,37
Spectratyping and method validation.
The distribution of TCR CDR3 sizes was analyzed by PCR.39
PCR reactions were performed with 5' TCRBV family specific
primers (TCRBV1-23) and a 3' generic TCRBC internal primer
labeled with [
PCR fragment purification and DNA sequencing.
The desired TCRBV PCR fragments were purified by electrophoresis in a
1% low melting point agarose gel and subsequent use of Wizard columns
(Promega). The Wizard-purified fragment was used for direct
sequencing42 using the T7 sequencing Kit (Pharmacia LKB,
Uppsala, Sweden) with 5 to 10 pmol of TCRBC internal primer, approximately 0.25 pmol PCR fragment, and [ Sequencing/spectratyping oligonucleotide primer.
The primer used for sequencing of the TCR of TT-specific T-cell clones
and for the spectratype analysis was TCRBC internal (5' TGT GGG
AGA TCT CTG CTT CTG 3').
TCR CDR3-specific oligonucleotide hybridization.
For the analysis of the persistence of TCR clonotypes, TCRBV9 PCR
products were generated from TT-specific T-cell lines and clones,37 size-fractionated in a 1% agarose gel, and
transferred to nylon membranes (HybondN+; Amersham, Little
Chalfont, UK) in 20× SSPE for 17 hours. After blotting, filters
were incubated in 0.4 N NaOH for 20 minutes and washed in 5× SSPE
for 5 minutes at room temperature. Filters were prehybridized and
hybridized at 60°C in 5× SSPE, 0.1% bovine serum albumin
(BSA), 0.1% Ficoll, 0.1% polyvinylpyrolidone, and 0.5%
sodium dodecyl sulfate (SDS). The oligonucleotide probe
specific for the TCR CDR3 region of the UPN 285-derived sequence
TCRBV9S1 PTGSG was composed of 5'
CAGTGCCGCTCCCTGTAGGGCTGC 3' and was end-labeled with
[ Transplant outcome.
Successful engraftment was observed in all analyzed children. In the
total group of analyzed children (I-III), 9 of 12 survived (75%); in
the group of allo-BMT recipients who received a TCD-BM graft (I), 2 of
3 children (67%) survived, and in the groups who received
unmanipulated BM grafts (II+III), 7 of 9 children (78%) survived.
Causes of death were relapse of the original disease in 2 children and
EBV-induced B-cell lymphoproliferative disease (BLPD) in 1 child. Acute
GVHD grade I was observed in 5 children and chronic GVHD developed in 4 children (3 limited and 1 extensive). Almost all survivors are alive
with a follow-up of 3 to 4 years after allo-BMT and have a Karnofsky
score of 100%, whereas UPN 298, who suffers from extensive chronic
GVHD, including the liver, has a Karnofsky score of 80%. The
transplant-related variables and the allo-BMT outcome of all analyzed
patients are summarized in Table 1.
Immunological reconstitution: recovery of the main lymphocyte
subsets.
Absolute lymphocyte counts below the fifth percentile (p5) of
age-matched reference values34,35 were observed in 10 of 12 children at 3 months after allo-BMT, as shown in
Table 2. The absolute numbers of
CD3+ T cells at this time-point were below p5 values in 8 of 12 recipients. In 4 of 12 allo-BMT recipients, all from the
unmanipulated graft groups, normal numbers of CD3+ T cells
were detected. The absolute number of CD4+ T cells was low
in almost all recipients at 3 months after allo-BMT (11 of 12 patients), irrespective of the nature of the graft (TCD or
unmanipulated). In contrast, CD8+ T-cell numbers were
either normal (6 of 12 patients), increased (2 of 12 patients), or
decreased (4 of 12 patients) at this time-point. The absolute number of
NK cells (CD3
CD45RA and CD45RO expression profiles on CD4+ and
CD8+ T-cell subsets.
At approximately 3 months after allo-BMT, the absolute number of
CD4+ T cells expressing CD45RA was low in all 11 children
investigated (mean, 0.037 × 103 cells/µL), whereas
the absolute number of CD8+ T cells expressing this marker
was much higher (mean, 0.29 × 103 cells/µL;
Table 3). The absolute number of
CD4+ T cells expressing the memory marker CD45RO (mean,
0.21 × 103 cells/µL) was significantly higher than
the number of CD4+CD45RA+ T cells. Within the
CD8+ T-cell subset, expression of CD45RA and CD45RO was
variable: the absolute number of CD8+CD45RO+ T
cells was higher than that of CD8+CD45RA+ T
cells in 5 of 11 patients, lower in 3 of 11 patients, and in the
same range in 3 of 11 children. Similar analyses at 12 months after allo-BMT showed an increase in the number of
CD4+CD45RA+ T cells in 9 of 9 recipients, but
the counts were still below the p5 of age-matched reference values in
the majority of the patients. Moreover, an increase in the absolute
number of CD8+CD45RA+ T cells was observed in 8 of 9 recipients. Absolute numbers of memory (CD45RO+) cells
also increased in CD4+ as well as in CD8+
T-cell subsets, in 7 of 9 and 4 of 9 recipients, respectively, showing
expansion of memory-type T cells within the first year after
transplantation.
TCR CDR3 size profile analysis.
The overall TCR repertoire diversity was investigated by evaluation of
the TCR CDR3 size distribution patterns. Spectratype analysis of
TCD-graft recipients (group I) at 3 months after allo-BMT demonstrated
TCR CDR3 size distribution patterns that were deviated from a Gaussian
distribution in both T-cell subsets in the majority of the TCRBV
families (Table 4) when compared with their
donors or age-matched controls who displayed Gaussian distributed
spectratypes (results not shown). It should be noted that the
TCD-grafts contained approximately 0.69% (~1.7 × 106/kg BW of the recipient) mature T cells after the
depletion procedure as estimated by FACS analysis (results not shown).
At 1 year post-BMT, a more or less normal distribution of TCR CDR3
sizes was observed in the majority of the TCRBV families in these TCD
graft recipients when a similar number of cells was used as for the
early analysis. Analyses of TCR CDR3 size distribution patterns in
unmanipulated-graft recipients (group II+III) showed less heterogenous
patterns at 3 months after transplantation, whereas a Gaussian
distribution of TCR CDR3 sizes could be observed at 1 year after
allo-BMT. When comparing the spectratypes at 3 months after
transplantation in the 3 transplantation groups, a more diverse TCR
repertoire was observed in the unmanipulated graft groups (3 of 4 children), as summarized in Table 4, irrespective of the number of
cells used for the analyses. For example, the deviated TCR CDR3 size distribution pattern of UPN 272 at 3 months after BMT, the less heterogenous size distribution (3 months post-BMT) of UPN 301, and the
Gaussian size distribution (1 year post-BMT) of UPN 301 were all
generated with 8 × 103 cells. Representative examples
of TCR CDR3 size distribution patterns are shown in
Fig 2.
TT-specific T-cell immune response after allo-BMT.
To follow the restoration of the proliferative response against the
recall antigen TT in time, PBMC obtained at 6, 10, 14, 32, and 52 weeks
after allo-BMT were stimulated with TT. The responding T cells were
tested for their TT-specificity in 3H thymidine
incorporation assays. These analyses showed the lack of a significant
proliferative response to TT in T-cell lines of all 6 recipients
generated at the early time points (4 to 14 weeks) after allo-BMT
(Table 5), whereas the response of these T-cell lines to phytohemagglutinin (PHA) was in normal
range (SI, 30 to 145) at these time-points (results not shown). The
T-cell line of UPN 275 generated at 14 weeks after allo-BMT showed a very weak proliferative response to TT (SI, ~5), albeit with counts less than 10 × 103 cpm. Furthermore,
T-cell-dependent B-cell reponses to TT were also lacking at these
time-points in all analyzed recipients, as shown by the level of
TT-specific Igs that did not increase after repeated DTP-vaccination
(results not shown). Of note was the observation that, after 3 DTP-vaccinations, the TT-specific B-cell responses were completely
absent in 5 of 6 analyzed recipients, with the only exception being UPN
275, who showed a moderate increase in TT-specific Igs (both IgG1 and
IgG3) after the third vaccination (results not shown). T-cell lines
generated at 32 weeks after transplantation were found to be
TT-specific in 4 of 5 analyzed recipients, as were T-cell lines
generated at 52 weeks after allo-BMT (Table 5 and
Fig 4). The lack of a proliferative
response to TT in UPN 301 corresponded with standard PBMC culture assay
results (results not shown). A similar analysis of T-cell lines of the respective BM donors (Fig 4) showed normal proliferative responses to
PHA (SI, 26 to 59) in all 5 analyzed donors, whereas only 3 of 5 donors
responded to TT (SI, 1.3 to 43), which is probably related to the
TT-vaccination status of these donors.
DNA-sequence analysis of TT-specific T-cell clones after allo-BMT and
detection of stable TCR CDR3 clonotypes in T-cell lines.
When comparing TCR sequences of TT-specific T-cell clones from allo-BMT
recipients (group III) with those from their donors, a striking
dissimilarity was found in the usage of TCRBV and TCRBJ gene segments
and in the amino acid composition of the CDR3 region (Table 6). This suggests that the T cells
responding to TT in the recipients at 52 weeks after allo-BMT are
composed of newly selected precursor T cells that are educated in the
recipient. The number of different TCR sequences was low in the donors
(3 to 5) and high in the recipients (11 to 13), which may reflect a
relative naive anti-TT immune response in the patient and a memory-type
immune response in the donor. In all analyzed individuals, one
particular TCR sequence was found multiple times, showing the dominant
character of these clones in the TT-specific T-cell lines (Table 6, in
italics).
In the present study, we analyzed the T-cell immune recovery in
well-defined groups of pediatric allo-BMT recipients to investigate the
relative contribution of expansion of transferred mature donor T cells
and of thymic selection of donor precursor T cells in this process.
Immunophenotypic analysis showed that the pediatric recipients analyzed
in this study have extremely low numbers of CD4+ and low to
normal numbers of CD8+ T cells (Table 2) at 3 months
post-BMT, which is in line with previously published data from TCD
BMT46-48 as well as from full graft BMT in
children.48-51 At this time-point, the absolute number of
CD4+ T cells expressing the CD45RA+ naive
marker was low, whereas the number of CD8+ T cells
expressing this marker was much higher (Table 3).41,49-51 This relatively quick recovery of CD8+ T cells expressing
CD45RA may be due to selection via an alternative regeneration pathway
as proposed for regeneration in a thymectomized pediatric allo-BMT
recipient50 or, less likely, due to conversion of
CD45RO+ cells to CD45RA+ end-stage effector T
cells. These CD8+CD45RA+ end-stage effector
cells with a LFA1high and/or CD29high phenotype
have been found in adults and also in children, albeit to a much lesser
extent.52,53 At 1 year after allo-BMT, naive CD4+CD45RA+ T-cell numbers increased but
remained below age-matched reference values in the majority of the
analyzed recipients (Table 3). This finding is in contrast with the
quick recovery of naive CD4+ T cells that was observed in
children after convential chemotherapy.54 It can be argued
that the preparative regimen including total body irradiation
(TBI), which was administered to our patients before
allo-BMT and the CsA, which was administered as GVHD
prophylaxis,55,56 may have damaged the thymus more severely
and, therefore, may have delayed the recovery of naive CD4+
T cells. Of note was the observation that the memory-type
(CD45RO+) T cells increased as well, in particular in the
CD4+ T-cell subset (Table 3), suggesting that naive cells
may have become memory cells after proper activation or that mature
graft-derived memory cells may have expanded in these allo-BMT recipients.
The authors thank Drs Sam Gobin, Tuna Mutis, and Frans Claas for
critically reading the manuscript; Maarten van der Keur and Arie van de
Marel for FACS sorting and analysis; Renée Langlois van den
Bergh, Jaqueline Waaijer, and Monique ten Dam for
immunophenotyping of blood samples; and Els Jol-van der
Zijde for analysis of the antibody responses to TT.
Submitted May 4, 1999; accepted August 10, 1999.
Supported in part by the J.A Cohen Institute for Radiopathology and
Radiation Protection (IRS).
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Peter J. van den Elsen, PhD, Department of
Immunohematology and Blood Transfusion, Leiden University Medical
Center, Bldg 1, E3-Q, PO Box 9600, 2300 RC Leiden, The Netherlands;
e-mail: pvdelsen{at}euronet.nl.
1.
Lum LG:
The kinetics of immune reconstitution after human marrow grafting.
Blood
63:369, 1987
2.
Storb R, Thomas ED:
Allogeneic bone-marrow transplantation.
Immunol Rev
71:77, 1983
[Medline]
[Order article via Infotrieve]
3.
Blume K:
Pattern of T cell immune reconstitution following allogeneic bone marrow transplantation for acute hematological malignancy.
Transplantation
34:96, 1982
[Medline]
[Order article via Infotrieve]
4.
Parkman R, Weinberg KI:
Immunological reconstitution following bone marrow transplantation.
Immunol Rev
157:73, 1997
[Medline]
[Order article via Infotrieve]
5.
Noel DR, Witherspoon RP, Storb R, Atkinson K, Doney K, Mickelson EM, Ochs HD, Warren RP, Weiden PL, Thomas ED:
Does graft versus host disease influence tempo of immunological recovery after human marrow transplantation? An analysis on 56 long-term survivors.
Blood
51:1087, 1978
6.
Keever CA, Small TN, Flomenberg N, Heller G, Pekle K, Black P, Pecora A, Gillio A, Kernan NA, O'Reilly RJ:
Immune reconstitution following bone marrow transplantation: Comparison of recipients of T-cell depleted marrow with recipients of conventional grafts.
Blood
73:1340, 1989
7.
Storek J, Witherspoon RP, Storb R:
T cell reconstitution after bone marrow transplantation into adult patients does not resemble T cell development in early life.
Bone Marrow Tranplant
16:413, 1995
[Medline]
[Order article via Infotrieve]
8.
Storek J, Gooley T, Witherspoon RP, Sullivan KM, Storb R:
Infectious morbidity in long-term survivors of allogeneic marrow transplantation is associated with low CD4 T cell counts.
Am J Hematol
54:131, 1997
[Medline]
[Order article via Infotrieve]
9.
Von Boehmer H:
Thymic selection a matter of life and death.
Immunol Today
13:454, 1992
[Medline]
[Order article via Infotrieve]
10.
Lucas B, Germain RN:
Unexpectedly complex regulation of CD4/CD8 coreceptor expression supports a revised model for CD4+CD8+ thymocyte differentiation.
Immunity
5:461, 1996
[Medline]
[Order article via Infotrieve]
11.
Bevan MJ:
In thymic selection, peptide diversity gives and takes away.
Immunity
7:175, 1997
[Medline]
[Order article via Infotrieve]
12.
Hunkapiller T, Killeen E, Littman DR, Schwartz RH:
Diversity of the immunoglobulin gene superfamily.
Adv Immunol
44:1, 1989
[Medline]
[Order article via Infotrieve]
13.
Wilson RK, Lai E, Concannon P, Barth RK, Hood LE:
Structure, organization, and polymorphism of murine and human T cell receptor
14.
Chotia C, Boswell DR, Lesk AM:
The outline structure of the T cell receptor
15.
Raaphorst FM, Kaijzel EL, van Tol MDJ, Vossen JM, van den Elsen PJ:
Non-random employment of V
16.
Quiros-Roldan E, Sottini A, Bertini A, Albertini A, Imberti L, Primi D:
Different TCRBV genes generate biased patterns of V-D-J diversity in human T cells.
Immunogenetics
41:91, 1995
[Medline]
[Order article via Infotrieve]
17.
Grunewald J, Jeddi-Tehrani M, Pisa E, Janson CH, Anderson R, Wigzell H:
Analysis of J
18.
Grunewald J, Janson CH, Wigzell H:
Biased expression of individual T cell receptor V gene segments in CD4+ and CD8+ human peripheral blood T lymphocytes.
Eur J Immunol
21:819, 1991
[Medline]
[Order article via Infotrieve]
19.
Hawes GE, Struyk L, van den Elsen PJ:
Differential usage of T cell receptor V gene segments in CD4+ and CD8+ T cell subs |
TOP
ABSTRACT
INTRODUCTION
2
log) of the graft was achieved by albumin gradient centrifugation and
subsequent E-rosette sedimentation.
80°C until RNA extraction.
Immunophenotypical analysis of PBMC was performed at regular intervals
after allo-BMT by flow cytometric analysis using a FACStar flow
cytometer and commercially available MoAbs in appropriate dilutions:
the MoAbs used to discriminate the various lymphoid subsets were
directed against CD3/CD4 or CD3/CD8 for T-cell subsets, CD3/CD16/CD56
for natural killer cells, and CD19 and/or CD20 for B cells.
Normalization of the absolute number of cells in a given lymphocyte
(sub)population in the peripheral blood of an allo-BMT recipient was
defined as reaching the fifth percentile of age-matched reference
values.
-32P]ATP as described
previously.
-33P]ATP
(0.5 µCi; Dupont NEN, Boston, MA). DNA sequences were compared with
TCR sequences contained in the GenBank using the PCGENE Computer Software Program (Release 6.85; Intelligenetics Inc, Palo Alto, CA).
CD16+56+) was
normal at 3 months post-BMT in the majority of the recipients (11 of
12), whereas the absolute number of B cells (CD20+) was
decreased in the majority of the analyzed recipients (8 of 12). Similar
analyses at 1 year after allo-BMT showed normalization of lymphocyte
numbers in the majority of the patients (Table 
] UPN275 cl 40 and
[
] UPN 285 cl 2).
chain gene families.
Immunol Rev
101:149, 1988