|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 2 (July 15), 1999:
pp. 519-528
Constitutive HOXA5 Expression Inhibits Erythropoiesis and
Increases Myelopoiesis From Human Hematopoietic Progenitors
By
Gay M. Crooks,
John Fuller,
Denise Petersen,
Parvin Izadi,
Punam Malik,
Paul K. Pattengale,
Donald B. Kohn, and
Judith C. Gasson
From the Division of Research Immunology and Bone Marrow
Transplantation, Department of Pathology, and Division of
Hematology/Oncology, Childrens Hospital Los Angeles, Los Angeles, CA;
and the Department of Biological Chemistry, University of California at
Los Angeles, Los Angeles, CA.
 |
ABSTRACT |
The role of the homeobox gene HOXA5 in normal human
hematopoiesis was studied by constitutively expressing the
HOXA5 cDNA in CD34+ and
CD34+CD38 cells from bone marrow and cord
blood. By using retroviral vectors that contained both HOXA5
and a cell surface marker gene, pure populations of progenitors that
expressed the transgene were obtained for analysis of differentiation
patterns. Based on both immunophenotypic and morphological analysis of
cultures from transduced CD34+ cells, HOXA5
expression caused a significant shift toward myeloid differentiation
and away from erythroid differentiation in comparison to
CD34+ cells transduced with Control vectors (P
= .001, n = 15 for immunophenotypic analysis; and P < .0001, n = 19 for morphological analysis). Transduction of more
primitive progenitors (CD34+CD38 cells)
resulted in a significantly greater effect on differentiation than did
transduction of the largely committed CD34+ population
(P = .006 for difference between HOXA5 effect on
CD34+ v CD34+CD38
cells). Erythroid progenitors (burst-forming unit-erythroid
[BFU-E]) were significantly decreased in frequency among
progenitors transduced with the HOXA5 vector (P = .016, n = 7), with no reduction in total CFU numbers. Clonal analysis
of single cells transduced with HOXA5 or control vectors
(cultured in erythroid culture conditions) showed that HOXA5
expression prevented erythroid differentiation and produced clones with
a preponderance of undifferentiated blasts. These studies show that
constitutive expression of HOXA5 inhibits human erythropoiesis
and promotes myelopoiesis. The reciprocal inhibition of erythropoiesis
and promotion of myelopoiesis in the absence of any demonstrable effect
on proliferation suggests that HOXA5 diverts differentiation at
a mulitpotent progenitor stage away from the erythroid toward the
myeloid pathway.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
THE PLURIPOTENT hematopoietic stem cell
is capable of either self-renewal or of generation of committed
progenitors that give rise to mature blood elements. How this decision
is controlled at the molecular level remains an unanswered question. However, a coded pattern of gene expression must exist that carries out
the maturation program. Understanding the nature of the underlying pattern of gene expression and how it arises will provide a better understanding as to how hematopoietic lineage commitment occurs.
An increasing body of work suggests that the homeobox family of genes
may be at least one component of the coded pattern of gene expression
regulating hematopoiesis.1 Homeobox genes were originally
described as important regulators of embryogenesis in Drosophila
melanogaster, through the study of homeotic mutations whereby one
body part was replaced by another.2-5 Homeobox genes have
subsequently been identified in numerous species spanning the
evolutionary spectrum.6-8 The hallmark of all homeobox
genes is a 183-nucleotide stretch of sequence called the homeobox,
which encodes a highly conserved 61-amino acid homeodomain whose
helix-turn-helix tertiary structure binds DNA.9 Through
this DNA-binding activity, the homeodomain proteins function as
transcription factors and thereby regulate differentiation through
positive and negative regulation of gene expression.4,6,10
In mice and humans, the homeobox genes located within four specific
clusters on different chromosomes are referred to as the HOX
family.11
Early evidence for a role of homeobox genes in blood cell
differentiation came from the observation that these genes are involved in the chromosomal abnormalities associated with certain
leukemias.12 It has also been shown that HOX genes
are expressed in somewhat lineage-specific patterns in cell lines and
bone marrow and that experimental manipulation of these expression
patterns can influence the proliferation and differentiation of
hematopoietic cell lines.13-21 We have recently identified
the HOXA5 homeobox gene in a screen of HOX genes
expressed early during myelopoiesis.21 Using an antisense
approach, we demonstrated that reducing HOXA5 expression in
human bone marrow cells potentiates erythroid development while reducing granulocytic/monocytic cell development.21
Conversely, ectopic expression of HOXA5 inhibited the erythroid
development of the myeloid cell line, K562.21 In
experiments reported here, we enforced expression of HOXA5 in
normal human hematopoietic progenitor cells by transducing
CD34+ and CD34+CD38 cells
with a retroviral vector containing the HOXA5 cDNA. In these
studies, we show that ectopic expression of HOXA5 results in a
shift toward myeloid differentiation at the expense of erythroid differentiation. These data support the hypothesis that HOXA5 functions as an important regulator of lineage commitment,
specifically, determination of myeloid versus erythroid fates.
| |
MATERIALS AND METHODS |
Construction of retroviral vectors.
Two HOXA5-containing vectors (and their paired controls) were
constructed. Each incorporated the rat low-affinity nerve growth factor
receptor (NGFR; p75) as a cell surface marker gene. The NGFR cDNA was
truncated to remove the cytoplasmic tail to produce the inactivated
tNGFR.22 In the first pair of constructs, the SV40 promoter
and neoR gene were removed from the LXSN
vector23 and replaced with the murine phosphoglycerate
kinase (PGK) promoter,24 followed by the tNGFR cDNA to make
the control vector L-X-PGK-tNGFR. The human HOXA5 cDNA,
generated as described previously,21 was cloned into
L-X-PGK-tNGFR to make the vector L-A5-PGK-tNGFR. The HOXA5 cDNA
encodes a protein that is truncated after the homeodomain: there is no
difference in the activities of this construct and the full-length
clone.21
In the second construct, the human HOXA5 cDNA was cloned
downstream of the internal ribosome entry site (IRES) from the
encephalomyocarditis virus (ECMV)25 to align the ATG start
codon of the HOXA5 cDNA in-frame with that from the IRES. tNGFR
was cloned into the LN vector plasmid23 replacing the
neoR gene to make the control vector L-tNGFR. The
IRES-HOXA5 fusion was then cloned downstream of tNGFR to
produce the vector L-tNGFR-IRES-A5.
Stable high titer vector producing clones of the cell line PG13 were
generated for each of the two HOXA5 vectors and their respective negative control vectors (Fig
1A). PG13 is a murine fibroblast cell line that expresses the Gibbon
ape leukemia virus (GALV) envelope protein. HOXA5 expression in
PG13 producer clones was assessed by reverse polymerase chain reaction
(PCR) as follows. RNA was extracted according to manufacturer's
guidelines using the RNA STAT-60 kit (Tel-Test, Friendswood, TX) and
reverse transcribed to cDNA (GIBCO BRL, Gaithersburg, MD). The cDNA was
then subjected to 35 cycles of PCR as follows: 94°C (1 minute),
60°C (1 minute), and 72°C (1.5 minutes). HOXA5 primers
sequences were 5' primer (5'CGCCGGCAGCACCCACATCAG3')
and 3' primer (5'TTCCGGGCCGCCTATGTTGT3'), which
amplified a 193-bp product (Fig 1B). On each sample, mRNA for the gene
GAPDH was also determined by reverse PCR as a positive control to
confirm the presence of mRNA and successful reverse transcription.
Primers for the GAPDH cDNA were as follows: 5' primer
(5'TGATGACATCAAGAAGGTGGTGAAG3') and 3' primer
(5'TCCTTGGAGGCCATGTGGGCCAT3'), which amplify a 240-bp
fragment of GAPDH cDNA. Twenty-five cycles of PCR at 94°C (2 minutes), 55°C (1.5 minutes), and 72°C (1.5 minutes) were
performed for PCR of GAPDH.
View larger version (32K):
[in this window]
[in a new window]
| Fig 1.
Characterization of retroviral vectors. (A)
Schematic diagram of HOXA5 and control vectors with FACS
analysis of tNGFR expression (MC192-PE-GAM fluorescence) in
corresponding PG13 vector-producing clones. (B) Ethidium bromide gel
showing products of reverse PCR from RNA extracted from vector
producing PG13 clones (lanes 3 through 10). The 193-bp HOXA5
product is detected in lane 1 (a positive control using vector plasmid)
and lanes 3 and 4, showing that HOXA5 expression is present in
PG13 clones containing HOXA5 vectors and not in PG13 clones
with control vectors. (+/ RT, reverse transcriptase added/not
added). (C) Southern blot analyses of 293A cells transduced with
vectors shown, after digestion of DNA with EcoR5, which cuts at
points 3' and 5' to the HOXA5 cDNA, and probing
with HOXA5 cDNA.
|
|
To ensure that no splicing or rearrangement of the vector had occurred
during packaging, Southern blot analysis was performed on 293A cells (a
human kidney cell line) that had been transduced with supernatants
containing the two HOXA5-containing vectors and the two control
vectors. DNA was extracted from the 293A cells selected
posttransduction by fluorescence-activated cell sorting (FACS) for tNGFR expression. DNA was digested with the
EcoR5 restriction enzyme that cleaves 3' and 5' of
the HOXA5 cDNA at bp 387 and 4195 in the vector L-A5-PGK-tNGFR
(providing a 3,808-bp fragment including HOXA5) and at bp 213 and 4176 in the vector L-tNGFR-IRES-A5 (providing a 3,963-bp fragment
including HOXA5). Digested DNA was run on a 1% agarose gel,
transferred to nylon, and probed with an 800-bp fragment on
HOXA5 (Fig 1C).
Isolation of target progenitors.
CD34+ cells were isolated from cord blood and bone marrow
acquired from healthy normal donors according to guidelines from the
Committee of Clinical Investigation (CCI) at Childrens Hospital Los
Angeles (Los Angeles, CA). Mononuclear cells were first isolated from
fresh samples by density centrifugation using Ficoll-hypaque (Pharmacia, Piscataway, NJ). CD34+ cells were then isolated
from the mononuclear cells using a MiniMacs column (Miltenyi Biotec,
Auburn, CA). In some experiments,
CD34+CD38 cells were isolated by
incubating the CD34+ enriched population with
CD34-fluorescein isothiocyanate (FITC) (HPCA2; Becton
Dickinson Immunocytometry Systems [BDIS], San Jose, CA) and
CD38-phycoerythrin (PE) (leu-17; BDIS) and isolating the more primitive CD34+CD38 cells on the
FACSVantage (BDIS) as previously described.26
Retroviral transduction of progenitors.
CD34+ or CD34+CD38 cells
were incubated with viral supernatant for up to 4 days in transduction
medium (Iscove's modified Dulbecco medium [IMDM; GIBCO BRL], 5%
fetal calf serum [FCS], 1% bovine serum albumin [BSA],
2-mercapoethanol, 106 mol/L hydrocortisone,
penicillin/streptomycin, and glutamine with 5 ng/mL interleukin-3
[IL-3], 3.3 ng/mL IL-6, and 25 ng/mL Steel factor [SF]). Progenitor
cells were cultured during transduction on plates coated with the
recombinant human fibronectin fragment CH-296 (Retronectin; Takara,
Otsu, Shiga, Japan). Twenty-four hours after final transduction, cells
were incubated with 5 µL MC192 antibody (Oncogene Research Products,
Cambridge, MA), which binds to tNGFR, followed by 5 µL of 1:20
PE-goat antimouse (GAM; Caltag, Burlingame, CA) and CD34-FITC.
CD34+MC192+ cells were then isolated by FACS
for culture and further analysis.
Cultures of transduced cells.
HOXA5 and control transduced CD34+ cells that
expressed tNGFR were cultured in 25-cm vent cap flasks (Costar,
Cambridge, MA) on human irradiated allogeneic bone marrow stroma in
myeloid conditions, ie, long-term bone marrow culture
(LTBMC) medium (IMDM, 30% FCS, 1% BSA, 2-mercapoethanol,
106 mol/L hydrocortisone, penicillin/streptomycin,
and glutamine) with 5 ng/mL IL-3, 3.3 ng/mL IL-6, 25 ng/mL SF, 2 U/mL
erythropoietin (EPO), and 50 ng/mL granulocyte-macrophage
colony-stimulating factor (GM-CSF); or in erythroid conditions, ie,
LTBMC medium with IL-3, IL-6, SF, and EPO (no GM-CSF). Cultures were
fed twice weekly with fresh medium. After 2 to 4 weeks of culture,
nonadherent and adherent cells were analyzed by immunophenotype and morphology.
Clonal analysis of single CD34+tNGFR+ cells was
performed in liquid and semisolid cultures as follows. Single
CD34+tNGFR+ cells were either isolated by FACS
and cultured in 96-well plates (Falcon, BD Labware, Lincoln Park, NJ)
on irradiated stroma in erythroid conditions or plated immediately
after transduction in duplicates or quadruplicates in semisolid medium
(1.3% methylcellulose, IMDM, 30% FCS, 1% BSA, 2-ME
106 mol/L hydrocortisone, penicillin/streptomycin,
glutamine, 10 ng/mL IL-3, 3.3 ng/mL IL-6, and 50 ng/mL SF). EPO (2 U/mL) was added once to the methylcellulose cultures between days 4 and 7. Colony-forming unit-cells (CFU-C), ie, colony-forming
units-granulocyte-macrophage (CFU-GM), colony-forming
units-granulocyte erythroid macrophage megakaryocyte (CFU-GEMM), and
burst-forming unit-erythroid (BFU-E) were enumerated after 14 days.
Immunophenotypic analysis.
Cultures generated from bulk transduced cells were harvested, washed
once in phosphate-buffered saline (PBS; Irvine Scientific, Santa Ana,
CA), and incubated with 20 µL glycophorin-FITC (Coulter Immunotech,
Miami, FL) and 20 µL CD11b-PE (leu 15; BDIS). FITC and PE isotype
controls (Coulter Immunotech) and mock (nontransduced) cells were used
to define positive and negative quadrants
(Fig 2). The immunophenotype of cultures
was analyzed on a FACSVantage with CellQuest software (BDIS).
View larger version (36K):
[in this window]
[in a new window]
| Fig 2.
tNGFR expression after transduction of
CD34+ progenitors with HOXA5 and control vectors.
Numbers shown are the percentage of total cells expressing tNGFR
(%MC192+/total cells) and the percentage of
CD34+ cells expressing tNGFR
(%MC192+CD34+/total CD34+
cells) from 12 experiments (mean ± SEM). (A) and (B) show typical
FACS profiles of cultures 24 hours after transduction with either the
HOXA5 vector or control vector, respectively. The R1 gate was
used to isolate MC192+CD34+ cells for
further culture and analysis. (C) Isotype control. (D) Mock
(nontransduced) control.
|
|
Morphologic analysis.
Cultures of transduced cells in bulk and clones of single cells were
harvested and cytospin slides were prepared and stained with
Wright-Giemsa. Differential counts were performed on at least 100 cells
per slide noting the number of undifferentiated blasts, myeloid lineage
cells (promyelocytes, myelocytes, neutrophils, monocytes, and
macrophages), and erythroid lineage cells (basophilic pronormoblasts,
polychromatophilic normoblasts, and orthochromic normoblasts).
| |
RESULTS |
Retroviral vectors expressing HOXA5.
Retroviral vectors were used to establish transduction and constitutive
expression of HOXA5 in human hematopoietic progenitors. Two
different Moloney murine leukemia virus (MoMuLV)-based vector backbones
were used in these studies. Both vector backbones incorporated the
inactive marker gene tNGFR that can be detected by FACS on the surface
of transduced cells using the monoclonal antibody MC192. In the first
vector (L-A5-PGK-tNGFR), HOXA5 was expressed from the MoMuLV
LTR and tNGFR was expressed from an internal PGK promoter (Fig 1A). The
second vector (L-tNGFR-IRES-A5) used an IRES to express both tNGFR and
HOXA5 from the MoMuLV LTR. tNGFR expression was similar in PG13
producer fibroblasts expressing the two HOXA5 vectors and their
respective control vectors (L-X-PGK-tNGFR and L-tNGFR; Fig 1A). Reverse
PCR of RNA extracted from PG13 clones demonstrated HOXA5
message in L-A5-PGK-tNGFR and L-tNGFR-IRES-A5 clones with no
HOXA5 expression in the two control producer clones (Fig 1B).
Southern blot analysis of 293A cells transduced with each vector
confirmed that no splicing or rearrangement of vectors had occurred
during packaging (Fig 1C).
Transduction of CD34+ cells with HOXA5
vectors.
CD34+ cells were isolated from cord blood and bone marrow
to 75% to 99% purity using two passes through the MiniMacs column. Freshly isolated CD34+ enriched cells analyzed at day 0 showed CD11b expression in 1.3% to 6.9% of cells and glycophorin
expression in less than 1% cells. CD34+ cells were
transduced with supernatant containing either HOXA5 vectors or
control vectors. The levels of transduction with the HOXA5 and
control vectors as measured by tNGFR expression (%MC192+)
are shown in Fig 2. Twenty-four to 48 hours after transduction, cells
coexpressing CD34 and tNGFR were isolated by FACS using the R1 gate
shown in Fig 2 and placed onto irradiated human stroma for long-term
culture in either erythroid conditions (IL-3, IL-6, SF, and EPO) or
myeloid conditions (IL-3, IL-6, SF, EPO, and GM-CSF).
Immunophenotype of long-term cultures.
After 2 to 4 weeks of culture, cells were harvested, incubated with
glycophorin-FITC (to assay erythroid differentiation) and CD11b-PE (to
assay myeloid differentiation), and analyzed by FACS. As expected,
CD11b expression was higher and glycophorin expression was lower in
myeloid culture conditions compared with erythroid culture conditions.
However, HOXA5 expression caused a shift toward myeloid and
away from erythroid differentiation relative to control cultures
irrespective of culture conditions (Fig 3).
The frequency of CD11b+ cells was significantly increased
in the HOXA5 transduced cultures compared with cultures of
control transduced cells (Fig 4; P = .001 by Wilcoxon Rank test, n = 15). The increase in CD11b expression was accompanied by an equivalent decrease in glycophorin. The frequency
of cells expressing neither CD11b nor glycophorin (ie, CD33negglycophorinneg cells) was not
significantly different in cultures from HOXA5 and control
transduced cells. The number of total cells in HOXA5 and
control cultures was not different. The same effect on CD11b and
glycophorin expression was seen whether cells were transduced with
L-A5-PGK-tNGFR or with L-tNGFR-IRES-A5, demonstrating that the effect
on differentiation was specific to HOXA5 expression rather than
an uncharacterized artifact specific to the vector itself. Thus,
HOXA5 expression in CD34+ progenitors caused a
shift toward myelopoiesis at the expense of erythropoiesis.
View larger version (32K):
[in this window]
[in a new window]
| Fig 3.
Immunophenotypic analysis of HOXA5 and control
cultures initiated with MC192+CD34+ cells.
Nonadherent cells from 4-week-old cultures were harvested and incubated
with CD11b-PE and glycophorin-FITC to measure myeloid and erythroid
differentiation, respectively. HOXA5 transduction increased
CD11b and decreased glycophorin expression relative to control
transduction. The percentages of cells in the two quadrants are
shown.
|
|
View larger version (20K):
[in this window]
[in a new window]
| Fig 4.
CD11b expression is increased in HOXA5-transduced
cultures. (A) In 6 of a total of 6 experiments in which
MC192+CD34+ cells were cultured in
erythroid conditions (P = .03 by Wilcoxon Rank test) and (B)
6 of 9 experiments cultured in myeloid conditions, HOXA5
increased the frequency of cells expressing CD11b (P = .009).
( ) HOX A5; ( ) control.
|
|
Morphologic analysis of lineage differentiation.
To confirm the immunophenotypic shift in differentiation patterns
induced by HOXA5 expression, HOXA5 and control cultures were also analyzed morphologically using cytospin preparations from the
total nonadherent cell population (Fig 5).
Again, HOXA5 expression significantly increased the proportion
of cells with myeloid morphology and decreased cells with erythroid
morphology (P < .0001, using Wilcoxon Rank Sign test to
analyze the difference in myeloid morphology between HOXA5 and
control cultures, n = 19).
View larger version (32K):
[in this window]
[in a new window]
| Fig 5.
Morphologic analysis of HOXA5 and control
cultures. Percentages of cells of myeloid and erythroid lineage were
determined morphologically using cytospin preparations of cultures. In
17 of total of 19 experiments, HOXA5-transduced cultures
contained a higher frequency of myeloid cells than control cultures
(P = .0001). () HOX A5; () control.
|
|
In addition, to confirm the lineage specificity of the above-noted
immunophenotypic analyses, CD11b+ and
glycophorin+ cells were isolated from culture by FACS and
examined morphologically using cytospin preparations and Wright
Giemsa staining. CD11b+ sorted populations
contained 76.7% ± 2.8% myeloid cells, 18.6% ± 3.0%
undifferentiated blasts, and 8.9% ± 2.5% pronormoblasts (n = 9). Glycophorin+ sorted populations contained 96.4% ± 1.5% erythroid cells, 5.3% ± 2.2% undifferentiated blasts,
and 0.2% ± 0.1% myeloid cells (n = 15). Thus, CD11b and
glycophorin expression correlated closely with cell morphology within
each culture.
HOXA5 expression in
CD34+CD38 cells.
The effect of inducing HOXA5 expression in CD34+
cells produced reproducible but relatively modest differences in the
proportions of myeloid and erythroid cells in the experiments described
to date. Reasoning that the variability seen in the experiments may be
due to the high frequency of CD34+ progenitors already
committed to erythroid or myeloid lineage before transduction, we next
explored whether HOXA5 expression in a more primitive and
uncommitted progenitor population might cause a greater effect on
differentiation. In 6 of 6 experiments targeting
CD34+CD38 cells, HOXA5 again
caused a shift toward myelopoiesis and away from erythropoiesis
relative to control cultures (Fig 6A and
B). The effect on differentiation pattern was significantly greater when CD34+CD38 cells were transduced
than when CD34+ cells were transduced (24.0% ± 5.1%
v 4.2% ± 3.1% increase in CD11b+ cells and
22.4% ± 5.6% v 4.6% ± 3.5% decrease in glycophorin expression in CD34+CD38 [n = 6] and
CD34+ cultures [n = 15], respectively; P = .006 by Wilcoxon Rank-Sum test; Fig 6C).
View larger version (32K):
[in this window]
[in a new window]
| Fig 6.
Effects of HOXA5 overexpression in
CD34+CD38 cells. (A) CD11b and (B)
glycophorin expression from 4-week-old cultures of
CD34+CD38 cells transduced with either
HOXA5 or control vectors (n = 6 independent experiments). (C)
The effect of HOXA5 expression on CD11b and glycophorin
expression is greater when CD34+CD38 cells
are transduced than when CD34+ cells are transduced
(P = .006). Shown are the mean ± SEM of the increase in the
percentage of CD11b+ cells (% HOXA5 % control) and the decrease in the percentage of
glycophorin+ cells (% control % HOXA5; n
= 6 CD34+CD38 experiments and n = 15 CD34+ experiments).
|
|
Clonal analysis of HOXA5-transduced progenitors.
We next studied the effect of HOXA5 expression on progenitor
differentiation at a clonal level. Erythroid culture conditions (IL-3,
IL-6, SF, and EPO) were chosen to determine to what extent HOXA5 could induce myeloid differentiation in the absence of
GM-CSF. CD34+ cells were transduced on days 0 and 1 on
fibronectin with either L-A5-PGK-tNGFR or the control vector
L-X-PGK-tNGFR. On day 4, CD34+MC192+ cells were
analyzed either in semisolid medium for CFU-C content or deposited by
FACS as single cells in each well of a 96-well plate prepared with
irradiated stroma for clonal analysis.
The frequency of erythroid progenitors (BFU-E) was consistently
decreased in CD34+ cells transduced with HOXA5
(P = .016, n = 7; Fig 7). Colonies containing both erythroid and myeloid cells (CFU-GEMM) were also reduced in the HOXA5-transduced cells and pure myeloid colonies (CFU-GM) were increased, but the results did not reach statistical significance. It is noteworthy that the total number of CFU-C (erythroid and myeloid) was not significantly different between HOXA5- and control-transduced cultures.
View larger version (41K):
[in this window]
[in a new window]
| Fig 7.
HOXA5 expression in CD34+ cells
decreases the frequency of erythroid progenitors (BFU-E).
CD34+tNGFR+ cells were isolated after
transduction and immediately plated in semisolid medium to enumerate
and characterize CFU-C content. Shown are data from seven independent
experiments. *P < .016. () HOX A5; () control.
|
|
Similar results were obtained in the assay of single clonogenic
CD34+ cells cocultured with stroma in liquid culture with
identical growth factors. Total cloning efficiency was not altered by
HOXA5 expression; after 14 days of erythroid culture, a total
of 21 HOXA5-transduced clones and 22 control-transduced clones
were visible. The color of each clone was reported as red or white by
direct visualization of the plates. Eight of 21 (38.1%) of the
HOXA5 clones were red (hemoglobinized), compared with 16 of 22 (72.3%) of control clones (Fig 8A).
Nineteen HOXA5 clones and 20 control clones contained
sufficient cells for analysis of morphology (performed by a second
observer who was blinded to the particular vector used in transduction
and to the color previously noted for each clone; Fig 8B). One clone in
each of the HOXA5 and control groups contained myeloid cells
(both had been scored as white). Most (11 of 19 [57.9%]) of the
HOXA5 clones contained only undifferentiated blasts. In
contrast, 3 of 20 (15%) control clones contained only undifferentiated
blasts, and most (16/20 [80%]) of the control clones contained a
mixture of blasts and mature erythroid precursors (polychromatophilic
normoblasts and orthochromic normoblasts). These two analyses of
erythroid differentiation (clone color and cell morphology) were
validated by the strong correlation of the analyses within each clone
studied by independent, blinded observers. All red clones contained at
least some mature erythroid precursors (a mean of 57% ± 6.5%
polychromatophilic normoblasts and orthochromic normoblasts were found
in each red clone). White clones, in contrast, consisted almost
entirely (94.7% ± 2.8%) of undifferentiated blasts, with only 2 of the total 14 white clones containing any mature erythroid
precursors. Thus, by two independent but strongly correlated analyses,
clones expressing HOXA5 contained cells at a more
morphologically primitive stage than control clones. It cannot be
determined from these studies whether the morphologically
undifferentiated blasts were committed at a molecular level to either
the myeloid or erythroid lineage. However, it can be concluded that
HOXA5 was not sufficient to increase differentiation to a
mature myeloid phenotype in the absence of GMCSF, but appeared at least
to inhibit erythroid differentiation.
View larger version (23K):
[in this window]
[in a new window]
| Fig 8.
Analysis of clones derived from single
MC192+CD34+ cells after transduction with
HOXA5 or control vectors. (A) Percentage of clones scored as
red (hemoglobinized) or white (nonhemoglobinized) by direct
visualization. Over each bar is shown the actual number of clones of
each color over the total analyzed. (B) The percentage of clones scored
by morphology as undifferentiated, erythroid, or myeloid. (C) Cell
proliferation of clones according to cell morphology. The number of
clones analyzed is shown over each bar.
|
|
Finally, the cell number within each clone was measured to determine
whether the inhibition of erythroid differentiation was associated with
inhibition of proliferation. HOXA5 and control clones with
mature erythroid morphology had similar cell proliferation. In
contrast, cell proliferation of undifferentiated clones was higher in
the HOXA5 group than in the control group, suggesting that the
inhibition of erythropoiesis with HOXA5 was not accompanied by
inhibition of total cell proliferation and in fact may be associated with increased cell proliferation (Fig 8C).
| |
DISCUSSION |
HOXA5 is one of several HOX genes implicated in
regulating hematopoietic decision-making. Studies have shown
HOXA5 expression to be restricted to cells of the
myelomonocytic lineage and absent in cells of the erythroid
lineage.17,27 It has also been observed that the level of
HOXA5 message in a subpopulation of human CD34+
cells displaying erythroid potential is lower than that found in more
primitive cells or CD34+ cells displaying granulocytic
potential.20 In other work, we have shown that the
HOXA5 gene is expressed early in myeloid development and that
manipulation of this gene's expression in normal hematopoietic cells
and cell lines results in a significant alteration in the relative
levels of erythroid and myeloid cell
development.21 Considered together, these
studies suggest that HOXA5 is expressed in a stage- and
lineage-specific manner and that this pattern of expression may
influence the fate of the developing blood cell.
In our current work, we have extended previous studies by expressing
HOXA5 in normal human hematopoietic progenitor cells, using
retroviral transduction, in an attempt to further define the role for
this gene during blood cell development. Ectopic expression of
HOXA5 in human CD34+ hematopoietic cells resulted
in a reproducible increase in myelopoiesis in the culture conditions
used, as measured by cell surface expression of CD11b and cell
morphology. This increase in myelopoiesis was accompanied by an
equivalent decrease in erythropoiesis, as measured by cell surface
glycophorin expression and cell morphology. This reciprocal effect
suggests that HOXA5 is influencing lineage commitment events at
a common myeloid/erythroid progenitor stage. Transduction of
HOXA5 into the more primitive
CD34+CD38 cells resulted in a more
pronounced shift from erythroid to myeloid development, further
suggesting that HOXA5 functions at a crucial early stage in
lineage commitment. These findings correlate well with our previous
work showing that inhibition of HOXA5 expression in human
CD34+ cells resulted in increased erythropoiesis and
decreased myelopoiesis. Together, these data support a role for
HOXA5 as part of the molecular mechanism that directs a
multipotent progenitor cell towards myeloid versus erythroid fates. In
this role, erythroid lineage commitment and development would require
downregulation of HOXA5 expression, whereas myeloid development
requires and is potentiated by HOXA5.
Shifting lineage commitment by manipulating the expression of a single
Hox gene has been observed previously. Thorsteinsdottir et
al28 transduced murine bone marrow cells with
HoxA10. Clonogenic assays showed a significant increase in
megakaryocytic colonies, coupled to an inhibition of
monocyte/macrophage colony formation, supporting the notion that normal
hematopoiesis requires the precise and coordinated control of several
Hox genes.
In the experiments reported here, there were no differences in the
levels of proliferation of committed myeloid or erythroid progenitors
transduced with HOXA5, suggesting that the proliferation of
cells already committed to these lineages is refractory to the effects
of HOXA5 expression. However, clones transduced with HOXA5 that remained undifferentiated in vitro displayed over
twice the level of proliferation as undifferentiated clones containing the control vector. These data indicate that the inhibition of erythropoiesis seen in the HOXA5-transduced cells is not caused by the reduced proliferation of an erythroid-committed progenitor, but
rather, appears to result in a molecular block of erythroid maturation.
Equally intriguing, these data indicate that HOXA5 may play a
role in regulating the self-renewal and/or proliferation of progenitor cells.
Such an effect on proliferation has been observed in similar
experiments in which primitive murine bone marrow cells have been
transduced to ectopically express Hox genes. Perkins and Cory29 demonstrated that HoxB8-transduced murine
bone marrow could generate immortalized myeloid cell lines in the
presence of high amounts of IL-3. Transplantation of the
HoxB8-expressing marrow produced an acute leukemia in recipient
mice. Sauvageau et al30 transplanted mice with
HoxB4-transduced bone marrow cells, resulting in mice that
exhibited a normal peripheral blood count but showed a 50- to 100-fold
expansion of stem cell numbers. When HoxB3 was expressed in
murine bone marrow, the numbers of myeloid progenitors in the marrow
increased, and the mice eventually developed a myeloproliferative
disorder.31 Based on these observations, it has been
postulated that the temporal pattern of Hox gene expression follows blood cell lineage commitment; a large number of highly expressed Hox genes are present in early uncommitted
progenitors, and lineage commitment is characterized by a restriction
in the number and levels of HOX genes expressed in committed
progenitors and mature cells.32,33 Our data further support
this model, because it appears that by enforcing expression of
HOXA5 at a certain early stage of hematopoietic development,
the cell is maintained in an uncommitted and highly proliferative state.
Because the precise downstream effectors of the HOX genes
remain largely undefined, explaining how ectopic expression of
HOXA5 produces the observed phenotype is difficult. One
possible explanation arises from the evidence for the existence of a
system of transcriptional cross-regulation between hox proteins and the
promoter elements of other homeobox genes.34,35 For
instance, Lobe35 demonstrated that exogenous expression of
HoxA5 activated the expression of numerous endogenous
Hox genes, and HoxA5 has been shown to bind to its own
promoter. Therefore, enforced expression of human HOXA5 may
alter the expression of other HOX genes. Additionally, the hox proteins heterodimerize with a non-hox family of
homeodomain-containing proteins called Pbx.36-38 The
formation of this heterodimer pair results in altered binding
specificity and affinity for target sequences.38,39
Consequently, ectopic expression of HOXA5 may serve to titrate
Pbx proteins away from the hox partners normally found during
hematopoiesis, thereby altering the expression of numerous downstream genes.
This is the first report describing the experimental overexpression of
a homeobox gene in normal human hematopoietic progenitor cells. A full
understanding of how HOX genes regulate human hematopoiesis requires similar studies with more members of this gene family, both
singly and in combination with each other, and the discovery of
specific downstream effectors for these genes.
| |
ACKNOWLEDGMENT |
The authors are very grateful to Lora Barsky for technical assistance
with flow cytometry, Karen Pepper for vector production, Earl Leonard
for biostatistical analysis, and Kaiser Permanente Sunset Hospital for
collection of cord blood.
| |
FOOTNOTES |
Submitted June 30, 1998; accepted March 16, 1999.
Supported by National Institutes of Health SCOR Grant No. HL54850.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Gay M. Crooks, MD, Division of Research
Immunology/BMT, MS#62, Childrens Hospital Los Angeles, 4650 Sunset Blvd
LA, CA 90027.
| |
REFERENCES |
1.
Lawrence H, Largman C:
Homeobox genes in normal hematopoiesis and leukemia.
Blood
80:2445, 1992[Free Full Text]
2.
Bridges C, Morgan T:
The third chromosome group of mutant characters of Drosophila melanogaster.
Carnegie Inst Wash
327:93, 1923
3.
Garber R, Kuroiwa A, Gehring WJ:
Genomic and cDNA clones of the homeotic locus Antennapedia in Drosophila.
EMBO J
2:2027, 1983[Medline]
[Order article via Infotrieve]
4.
Akam M:
HOX and HOM: Homologous gene clusters in insects and vertebrates.
Cell
57:347, 1989[Medline]
[Order article via Infotrieve]
5.
De Robertis E, Oliver G, Wright C:
Homeobox genes and the analysis of vertebrate development.
Sci Am
262:46, 1990[Medline]
[Order article via Infotrieve]
6.
Gehring W:
Homeoboxes in the study of development.
Science
236:1245, 1987[Abstract/Free Full Text]
7.
Krumlauf R:
Evolution of the vertebrate HOX homeobox genes.
Bioessays
14:245, 1992[Medline]
[Order article via Infotrieve]
8.
Kenyon C:
If birds can fly, why can't we? Homeotic genes and evolution.
Cell
78:175, 1994[Medline]
[Order article via Infotrieve]
9.
Gehring W, Affolter M, Burglin T:
Homeodomain Proteins.
Annu Rev Biochem
63:487, 1994[Medline]
[Order article via Infotrieve]
10.
Han K, Levine M, Manley J:
Synergistic activation and repression of transcription by Drosophila homeobox proteins.
Cell
56:573, 1989[Medline]
[Order article via Infotrieve]
11.
Scott MP:
A rational nomenclature for vertebrate homeobox (HOX) genes.
Nucleic Acids Res
21:1687, 1993[Abstract/Free Full Text]
12.
Hatano M, Roberts CWM, Minden M, Crist WM, Korsmeyer SJ:
Deregulation of a homeobox gene, HOX11, by the t(10;14) in T cell leukemia.
Science
253:79, 1991[Abstract/Free Full Text]
13.
Kongsuwan K, Webb E, Housiaux P, Adams JM:
Expression of multiple homeobox genes within diverse mammalian haematopoietic lineages.
EMBO J
7:2131, 1988[Medline]
[Order article via Infotrieve]
14.
Shen WF, Largman C, Lowney P, Corral J, Detmer K, Hauser C, Simonitch T, Hack FM, Lawrence HJ:
Lineage-restricted expression of homeobox-containing genes in human hematopoietic cell lines.
Proc Natl Acad Sci USA
86:8536, 1989[Abstract/Free Full Text]
15.
Deguchi Y, Kehrl JH:
Selective expression of two homeobox genes in CD34-positive cells from human bone marrow.
Blood
78:323, 1991[Abstract/Free Full Text]
16.
Deguchi Y, Kirschenbaum A, Kehrl JH:
A diverged homeobox gene is involved in the proliferation and lineage commitment of human hematopoietic progenitors and highly expressed in acute myelogenous leukemia.
Blood
79:2841, 1992[Abstract/Free Full Text]
17.
Magli M, Barba P, Celetti A, De Vita G, Cillo C, Boncinelli E:
Coordinate regulation of HOX genes in human hematopoietic cells.
Proc Natl Acad Sci
88:6348, 1991[Abstract/Free Full Text]
18.
Shen W-F, Detmer K, Mathews CHE, Hack FM, Morgan DA, Largman C, Lawrence HJ:
Modulation of homeobox gene expression alters the phenotype of human hematopoietic cell lines.
EMBO J
11:983, 1992[Medline]
[Order article via Infotrieve]
19.
Lill MC, Fuller JF, Crooks GM, Gasson JC:
The role of the homeobox gene HOXB7 in human myelomonocytic differentiation.
Blood
85:692, 1995[Abstract/Free Full Text]
20.
Sauvageau G, Lansdorp PM, Eaves CJ, Hogge DE, Dragowska WH, Reid DS, Largman C, Lawrence HJ, Humphries RK:
Differential expression of homeobox genes in functionally distinct CD34+ subpopulations of human bone marrow cells.
Proc Natl Acad Sci USA
91:12223, 1994[Abstract/Free Full Text]
21. Fuller JF, Sakaguchi M, Fraser JK, Gasson JC: Characterization
of HOX gene expression during myelopoiesis: Role of HOX A5 in
lineage commitment and maturation. Blood (in press)
22.
Malik P, McQuiston SA, Yu XJ, Pepper KA, Krall WJ, Podsakoff GM, Kurtzman GJ, Kohn DB:
Recombinant adenoassociated virus (rAAV) mediates a high level of gene transfer but less efficient integration in the K562 human hematopoietic cell line.
J Virol
71:1776, 1997[Abstract]
23.
Miller AD, Rosman GJ:
Improved retroviral vectors for gene transfer and expression.
Biotechniques
7:980, 1989[Medline]
[Order article via Infotrieve]
24.
Adra CN, Boer PH, McBurney MW:
Cloning and expression of the mouse PGK1 gene and the nucleotide sequence of its promoter.
Gene
60:65, 1987[Medline]
[Order article via Infotrieve]
25.
Jang SK, Krausslich HG, Nicklin MJ, Duke GM, Palmenberg AC, Wimmer E:
A segment of the 5' nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation.
J Virol
62:2636, 1988[Abstract/Free Full Text]
26.
Hao QL, Shah AJ, Thiemann FT, Smogorzewska EM, Crooks GM:
A functional comparison of CD34+CD38 cells in cord blood and bone marrow.
Blood
86:3745, 1995[Abstract/Free Full Text]
27.
Vieille GI, Roullot V, Courtois G:
Lineage and stage specific expression of HOX1 genes in the human hematopoietic system.
Biochem Biophys Res Commun
183:1124, 1992[Medline]
[Order article via Infotrieve]
28.
Thorsteinsdottir U, Sauvageau G, Hough MR, Dragowska W, Lansdorp PM, Lawrence HJ, Largman C, Humphries RK:
Overexpression of HoxA10 in murine hematopoietic cells perturbs both myeloid and lymphoid differentiation and leads to acute myeloid leukemia.
Mol Cell Bio
17:495, 1997[Abstract]
29.
Perkins A, Cory S:
Conditional immortalization of mouse myelomonocytic, megakaryocytic and mast cell progenitors by the HOX2.4 homeobox gene.
EMBO J
12:3835, 1993[Medline]
[Order article via Infotrieve]
30.
Sauvageau G, Thorsteinsdottir U, Eaves CJ, Lawrence HJ, Largman C, Lansdorp PM, Humphries RK:
Overexpression of HoxB4 in hematopoietic cells causes the selective expansion of more primitive populations in vitro and in vivo.
Genes Dev
9:1753, 1995[Abstract/Free Full Text]
31.
Sauvageau G, Thorsteinsdottir U, Hough MR, Hugo P, Lawrence HJ, Largman C, Humphries RK:
Overexpression of HoxB3 in hematopoietic cells causes defective lymphoid development and progressive myeloproliferation.
Immunity
6:13, 1997[Medline]
[Order article via Infotrieve]
32.
Lawrence HJ, Sauvageau G, Ahmadi N, Lopez AR, Le Beau MM, Link M, Humphries RK, Largman C:
Stage and lineagespecific expression of the HOXA10 homeobox gene in normal and leukemic hematopoietic cells.
Exp Hematol
23:1160, 1995[Medline]
[Order article via Infotrieve]
33.
Care A, Testa U, Bassani A, Tritarelli E, Montesoro E, Samoggia P, Cianetti L, Peschle C:
Coordinate expression and proliferative role of HOXB genes in activated adult T lymphocytes.
Mol Cell Biol
14:4872, 1994[Abstract/Free Full Text]
34.
Faiella A, Zappavigna V, Mavilio R, Boncinelli E:
Inhibition of retinoic acid induced activation of 3' human HOXB genes by antisense oligonucleotides affects sequential activation of genes located upstream in the four HOX clusters.
Proc Natl Acad Sci USA
91:5335, 1994[Abstract/Free Full Text]
35.
Lobe C:
Activation of Hox gene expression by Hoxa5.
DNA Cell Biol
14:817, 1995[Medline]
[Order article via Infotrieve]
36.
Chang C, Shen W, Rozenfeld S, Lawrence HJ, Largman C, Cleary ML:
Pbx proteins display hexapeptide dependent cooperative DNA binding with a subset of hox proteins.
Genes Dev
9:663, 1995[Abstract/Free Full Text]
37.
Lu Q, Knoepfler P, Scheele J, Wright DD, Kamps MP:
Both Pbx1 and E2APbx1 bind the DNA motif ATCAATCAA cooperatively with the products of multiple murine Hox genes, some of which are themselves oncogenes.
Mol Cell Biol
15:3786, 1995[Abstract]
38.
Phelan M, Rambaldi I, Featherstone MS:
Cooperative interactions between hox and pbx proteins mediated by a conserved peptide motif.
Mol Cell Biol
15:3989, 1995[Abstract]
39.
Chang C, Brocchieri L, Shen W, Largman C, Cleary ML:
Pbx modulation of hox homeodomain aminoterminal arms establishes different DNA binding specificities across the hox locus.
Mol Cell Biol
16:1734, 1996[Abstract]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
C. Liongue, C. J. Hall, B. A. O'Connell, P. Crosier, and A. C. Ward
Zebrafish granulocyte colony-stimulating factor receptor signaling promotes myelopoiesis and myeloid cell migration
Blood,
March 12, 2009;
113(11):
2535 - 2546.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. S. Oakley, T. F. McCutchan, V. Anantharaman, J. M. Ward, L. Faucette, C. Erexson, B. Mahajan, H. Zheng, V. Majam, L. Aravind, et al.
Host Biomarkers and Biological Pathways That Are Associated with the Expression of Experimental Cerebral Malaria in Mice
Infect. Immun.,
October 1, 2008;
76(10):
4518 - 4529.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. Bruns, U. Steidl, J. C. Fischer, A. Czibere, G. Kobbe, S. Raschke, R. Singh, R. Fenk, M. Rosskopf, S. Pechtel, et al.
Pegylated granulocyte colony-stimulating factor mobilizes CD34+ cells with different stem and progenitor subsets and distinct functional properties in comparison with unconjugated granulocyte colony-stimulating factor
Haematologica,
March 1, 2008;
93(3):
347 - 355.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. P. S. Rawat, S. Thoene, V. M. Naidu, N. Arseni, B. Heilmeier, K. Metzeler, K. Petropoulos, A. Deshpande, L. Quintanilla-Martinez, S. K. Bohlander, et al.
Overexpression of CDX2 perturbs HOX gene expression in murine progenitors depending on its N-terminal domain and is closely correlated with deregulated HOX gene expression in human acute myeloid leukemia
Blood,
January 1, 2008;
111(1):
309 - 319.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Strathdee, T. L. Holyoake, A. Sim, A. Parker, D. G. Oscier, J. V. Melo, S. Meyer, T. Eden, A. M. Dickinson, J. C. Mountford, et al.
Inactivation of HOXA Genes by Hypermethylation in Myeloid and Lymphoid Malignancy is Frequent and Associated with Poor Prognosis
Clin. Cancer Res.,
September 1, 2007;
13(17):
5048 - 5055.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Magnusson, A. C. M. Brun, N. Miyake, J. Larsson, M. Ehinger, J. M. Bjornsson, A. Wutz, M. Sigvardsson, and S. Karlsson
HOXA10 is a critical regulator for hematopoietic stem cells and erythroid/megakaryocyte development
Blood,
May 1, 2007;
109(9):
3687 - 3696.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Strathdee, A. Sim, R. Soutar, T. L. Holyoake, and R. Brown
HOXA5 is targeted by cell-type-specific CpG island methylation in normal cells and during the development of acute myeloid leukaemia
Carcinogenesis,
February 1, 2007;
28(2):
299 - 309.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Y. Chung, G. Morrone, J. J. Schuringa, M. Plasilova, J.-H. Shieh, Y. Zhang, P. Zhou, and M. A.S. Moore
Enforced Expression of NUP98-HOXA9 in Human CD34+ Cells Enhances Stem Cell Proliferation
Cancer Res.,
December 15, 2006;
66(24):
11781 - 11791.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. A. Shivdasani
MicroRNAs: regulators of gene expression and cell differentiation
Blood,
December 1, 2006;
108(12):
3646 - 3653.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Tanaka, I. Matsumura, K. Itoh, A. Hatsuyama, M. Shikamura, Y. Satoh, T. Heike, T. Nakahata, and Y. Kanakura
HOX Decoy Peptide Enhances the Ex Vivo Expansion of Human Umbilical Cord Blood CD34+ Hematopoietic Stem Cells/Hematopoietic Progenitor Cells
Stem Cells,
November 1, 2006;
24(11):
2592 - 2602.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Toren, B. Bielorai, J. Jacob-Hirsch, T. Fisher, D. Kreiser, O. Moran, S. Zeligson, D. Givol, A. Yitzhaky, J. Itskovitz-Eldor, et al.
CD133-Positive Hematopoietic Stem Cell "Stemness" Genes Contain Many Genes Mutated or Abnormally Expressed in Leukemia
Stem Cells,
September 1, 2005;
23(8):
1142 - 1153.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Chen, E. Rubin, H. Zhang, S. Chung, C. C. Jie, E. Garrett, S. Biswal, and S. Sukumar
Identification of Transcriptional Targets of HOXA5
J. Biol. Chem.,
May 13, 2005;
280(19):
19373 - 19380.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. M. Ferrell, S. T. Dorsam, H. Ohta, R. K. Humphries, M. K. Derynck, C. Haqq, C. Largman, and H. J. Lawrence
Activation of Stem-Cell Specific Genes by HOXA9 and HOXA10 Homeodomain Proteins in CD34+ Human Cord Blood Cells
Stem Cells,
May 1, 2005;
23(5):
644 - 655.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Manfredini, R. Zini, S. Salati, M. Siena, E. Tenedini, E. Tagliafico, M. Montanari, T. Zanocco-Marani, C. Gemelli, T. Vignudelli, et al.
The Kinetic Status of Hematopoietic Stem Cell Subpopulations Underlies a Differential Expression of Genes Involved in Self-Renewal, Commitment, and Engraftment
Stem Cells,
April 1, 2005;
23(4):
496 - 506.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. J. Wermuth and A. M. Buchberg
Meis1-mediated apoptosis is caspase dependent and can be suppressed by coexpression of HoxA9 in murine and human cell lines
Blood,
February 1, 2005;
105(3):
1222 - 1230.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. A. Stasinopoulos, Y. Mironchik, A. Raman, F. Wildes, P. Winnard Jr., and V. Raman
HOXA5-Twist Interaction Alters p53 Homeostasis in Breast Cancer Cells
J. Biol. Chem.,
January 21, 2005;
280(3):
2294 - 2299.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. C. M. Brun, J. M. Bjornsson, M. Magnusson, N. Larsson, P. Leveen, M. Ehinger, E. Nilsson, and S. Karlsson
Hoxb4-deficient mice undergo normal hematopoietic development but exhibit a mild proliferation defect in hematopoietic stem cells
Blood,
June 1, 2004;
103(11):
4126 - 4133.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Schiedlmeier, H. Klump, E. Will, G. Arman-Kalcek, Z. Li, Z. Wang, A. Rimek, J. Friel, C. Baum, and W. Ostertag
High-level ectopic HOXB4 expression confers a profound in vivo competitive growth advantage on human cord blood CD34+ cells, but impairs lymphomyeloid differentiation
Blood,
March 1, 2003;
101(5):
1759 - 1768.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Thompson, M. F. Quinn, D. Grimwade, C. M. O'Neill, M. R. Ahmed, S. Grimes, M. F. McMullin, F. Cotter, and T. R. J. Lappin
Global down-regulation of HOX gene expression in PML-RARalpha + acute promyelocytic leukemia identified by small-array real-time PCR
Blood,
February 15, 2003;
101(4):
1558 - 1565.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. B. Ivanova, J. T. Dimos, C. Schaniel, J. A. Hackney, K. A. Moore, and I. R. Lemischka
A Stem Cell Molecular Signature
Science,
October 18, 2002;
298(5593):
601 - 604.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. M. Owens and R. G. Hawley
HOX and Non-HOX Homeobox Genes in Leukemic Hematopoiesis
Stem Cells,
September 1, 2002;
20(5):
364 - 379.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Buske, M. Feuring-Buske, C. Abramovich, K. Spiekermann, C. J. Eaves, L. Coulombel, G. Sauvageau, D. E. Hogge, and R. K. Humphries
Deregulated expression of HOXB4 enhances the primitive growth activity of human hematopoietic cells
Blood,
July 18, 2002;
100(3):
862 - 868.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. M. Bjornsson, E. Andersson, P. Lundstrom, N. Larsson, X. Xu, E. Repetowska, R. K. Humphries, and S. Karlsson
Proliferation of primitive myeloid progenitors can be reversibly induced by HOXA10
Blood,
December 1, 2001;
98(12):
3301 - 3308.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Buske, M. Feuring-Buske, J. Antonchuk, P. Rosten, D. E. Hogge, C. J. Eaves, and R. K. Humphries
Overexpression of HOXA10 perturbs human lymphomyelopoiesis in vitro and in vivo
Blood,
April 15, 2001;
97(8):
2286 - 2292.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. A. Golpon, M. W. Geraci, M. D. Moore, H. L. Miller, G. J. Miller, R. M. Tuder, and N. F. Voelkel
HOX Genes in Human Lung : Altered Expression in Primary Pulmonary Hypertension and Emphysema
Am. J. Pathol.,
March 1, 2001;
158(3):
955 - 966.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. T. La Celle and R. R. Polakowska
Human Homeobox HOXA7 Regulates Keratinocyte Transglutaminase Type 1 and Inhibits Differentiation
J. Biol. Chem.,
August 24, 2001;
276(35):
32844 - 32853.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION