|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 3 (August 1), 1999:
pp. 1003-1011
The Interleukin-12-Mediated Pathway of Immune Events Is
Dysfunctional in Human Immunodeficiency Virus-Infected Individuals
By
Jason D. Marshall,
Jihed Chehimi,
Giorgia Gri,
Jay R. Kostman,
Luis J. Montaner, and
Giorgio Trinchieri
From the Wistar Institute of Anatomy and Biology; the Division of
Immunologic and Infectious Diseases of the Children's Hospital of
Philadelphia; and the Philadelphia Field Initiating Group for HIV
Trials, Philadelphia, PA.
 |
ABSTRACT |
Interleukin-12 (IL-12) is a potentially critical factor in the
immune response against human immunodeficiency virus (HIV) because it
is important for regulating proliferation and interferon- (IFN-)
production by T cells and natural killer (NK) cells, antigen presentation and accessory cell function by macrophages and dendritic cells, and cytolytic activities of cytotoxic T-lymphocyte cells and NK
cells, which are all functions known to be dysfunctional in patients
with acquired immune deficiency syndrome. Peripheral blood mononuclear
cells (PBMC) from HIV-infected patients have been previously shown to
be deficient in the ability to produce IL-12 in response to the
bacterial pathogen Staphylococcus aureus Cowan. In this study,
impaired IL-12 production in cells from PBMC of HIV-infected patients
compared with healthy donors was observed across a broad panel of
stimuli derived from infectious pathogens with or without priming with
cytokines such as IFN- and IL-4, which amplify the IL-12 induction
signal. Analysis of p40 and p35 mRNA accumulation showed that
reductions in both subunits contribute to the lower IL-12 secretion of
cells from HIV-infected individuals. PBMC from HIV-infected donors also
failed to upregulate the IL-12 receptor  2 chain (IL-12R2) in
response to mitogenic stimuli. The expression of the IL-12R2 gene
could, however, be restored by in vitro exposure to rIL-12. Thus, it is
possible that a primary IL-12 defect may lead to secondary deficiencies in expression of the genes for IL-12R2 and IFN-, thus amplifying immune deficiency during HIV infection.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
INTERLEUKIN-12 (IL-12) is primarily an
antigen-presenting cell (APC) derived cytokine, most commonly produced
by monocytes/macrophages but also by dendritic cells, neutrophils, and
other phagocytic or APC-like cells.1,2 The IL-12 molecule
is composed of two subunits, p40 and p35, which combine to form the p70
heterodimer, and although both are required for biological activity,
the two components are differentially regulated. Typically, free p40
monomer is produced in great excess to p70 by approximately 10-fold to 100-fold.3 However, it is not apparent whether free p40 can exert biological activity, although p40 homodimers have been shown to
be antagonistic to IL-12 activity in murine systems.4,5 Messenger RNA expression of p40 is difficult to detect from cultures of
unstimulated monocytes but transcriptional activity occurs within 1 hour after stimulation with bacterial products such as lipopolysaccharide (LPS).6 The light chain, p35, is not
released in monomeric form and must be secreted from the same cell as
p40 to form the p70 heterodimer. Low levels of p35 mRNA are detectable constitutively and expression is upregulated by the same stimuli that
induce p40 and with similar kinetics to p40.6
We have previously examined peripheral blood mononuclear cells (PBMC)
from human immunodeficiency virus (HIV)-infected individuals for
Staphylococcus aureus-induced IL-12-producing potential and found a marked deficiency in the production of both p40 and p70 compared with control PBMC.7 This impairment was selective for IL-12 production as no significant variation in the secretion of
tumor necrosis factor- (TNF-), IL-1, or IL-10 could be found between the two groups of subjects. It was especially of interest that
IL-10 levels were equivalent as this belied a potential mechanistic role for IL-10, a notable IL-12 antagonist, in the reduced capacity to
produce IL-12 during HIV infection.8 Subsequently, we found that a 24 hour priming period with IL-4 or IL-13 before the S aureus stimulus nearly amplified IL-12 production to levels set by
primed cultures from healthy controls, indicating that the IL-12
impairment was largely recoverable.9 The authors as well as
other investigators have demonstrated that cells from HIV-infected patients can respond to exogenous IL-12 and that several cellular immune functions, which are often depressed during progressive HIV
infection such as T-cell proliferation, T cell and natural killer (NK)
cell production of IL-2 and interferon- (IFN-), and cytotoxic T
lymphocyte (CTL) and NK lytic activities, can be partially
restored.10,11
Because IL-12 is intimately involved in the promotion and regulation of
many forms of antiviral immune responses, we attempted to more closely
examine and characterize this deficiency of IL-12 production during HIV
infection. We report here that the HIV-mediated dysregulation of IL-12
production is not confined to S aureus stimulation but is
evident across a broad panel of stimuli. This impairment can be
observed at the level of mRNA expression of both p40 and
p35 genes. Furthermore, our data suggest that the underproduction of IFN- commonly observed in HIV-infected cells is
potentially the result of a deficiency in the expression of high-affinity IL-12R on the cell surface, which, in turn, may stem from
the original IL-12 defect.
| |
MATERIALS AND METHODS |
Patients.
HIV-1-seropositive adults at various stages of the disease were
enrolled in this study. HIV-1 serology was confirmed by using commercially available assays. All patients were repeatedly tested positive for HIV-1 antibodies by enzyme-linked immunosorbent assay and
confirmed by Western blot analysis. The HIV+ patient pool
consisted of 22 individuals, 12 men, 10 women, with an average age of
38 and an age range of 21 to 62. When segregated into groups according
to CD4 T-cell count/µL, the group counts were less than 200 CD4
T/µL: 6; 200-500 CD4 T/µL: 7; greater than 500 CD4 T/µL: 6;
unknown: 3. Information on drug therapy for this population was limited; when divided into nucleoside analog
drugs/protease inhibitor numbers, the patient pool consisted of 2/0: 2;
3/0: 1; 1/1: 1; 2/1: 4; 0/0: 4; unknown: 10. Several of the patients had opportunistic infections of some kind: Pneumocystis carinii pneumonia (PCP): 5; Candida albicans: 5; Herpes:
2; Kaposi's sarcoma: 2; sinusitis: 2; tuberculosis: 1. HIV-1 mRNA load
data were available for only a small fraction of the patient blood
samples. Healthy HIV-1-seronegative donors were included as control
subjects and were similar in regards to age range and gender makeup.
Informed consent was obtained from all participants in the study.
Cell separation.
All reagents used in this study were selected for low levels of
endotoxin contamination by the Limulus amoebocyte assay. PBMC were separated by Ficoll-Paque density gradient centrifugation (Pharmacia Biotech AB, Uppsala, Sweden), resuspended in RPMI-1640 complete medium (GIBCO-BRL, Grand Island, NY), and supplemented with
10% heat-inactivated fetal bovine serum (Sigma, St Louis, MO),
L-glutamine, and antibiotics.
Culture conditions and reagents.
To induce IL-12 protein synthesis, PBMC (2 × 106
cells/mL) from HIV-seronegative and HIV-infected individuals were
cultured for 20 to 24 hours in the presence of the following stimuli:
medium alone, 1:10,000 S aureus Cowan strain Pansorbin cells
(Calbiochem, San Diego, CA), 1 µg/mL LPS (Sigma, St. Louis, MO), 10 µg/mL Lipoteichoic acid (LTA) (Sigma), or 1:200 OK432-5KE
streptococcal preparation (Chugai Pharm, Tokyo, Japan). In the
instances in which cultures were primed with IL-4 (10 ng/mL; Genzyme,
Cambridge, MA) or IFN- (100 ng/mL; Endogen, Woburn, MA), cells were
cultured in the presence of the cytokine for 16 to 24 hours before
stimulation. C albicans strains CA-6 and PCA-2 were kindly
provided by Dr Simonetta Mocci (DNAX, Palo Alto, CA) and were grown to
stationary phase at 37°C without CO2 on Sabouraud
Dextrose Agar plates (Becton Dickinson, Cockeysville, MD), rinsed from
the plates with 1× phosphate-buffered saline (PBS) applied with
syringes, washed, counted, and incubated at 65°C for 1 hour for heat
inactivation. Yeast cells were cultured at a 1:2 yeast cell:PBMC ratio
for 24 hours. Stimulations used to induce IFN- production were 10 ng/mL O-tetradecanoylphorbol 13-acetate (Sigma) + 1 µg/mL ionomycin
(Sigma), 5 µg/mL phytohemagglutinin (PHA) (Sigma), 20 U/mL IL-2, 2 ng/mL IL-12 (Genetics Institute, Andover, MA), and 1:1,000 dilutions of
OKT3 (anti-CD3) and CK248 (anti-CD28) antibodies for 48 hours. In some
cases, OKT3 was prebound to 96-well round-bottomed plates at 5 µg/mL
in carbonate/bicarbonate buffer. IFN- (Roche, Milano, Italy) was
used at 1,000 U/mL. Cell-free supernatants were then harvested,
aliquoted, and stored at  80°C until assayed for p40, p70, and
IFN- by radioimmunoassay as described.3
RNA isolation and reverse transcription-polymerase chain reaction
(RT-PCR).
PBMC from patients and healthy individuals were cultured as described
above for the generation of supernatants except for a stimulation
period with LPS/S aureus/LTA/OK432 of 4 hours instead of 24 hours. Total RNA was extracted via the Ultraspec isolation system
(Biotecx, Houston, TX), purified by isopropanol precipitation and
ethanol washes, and quantitated by spectrophotometry. RT reactions were
performed with 3 µg RNA from each sample with 5× first strand buffer, DTT, and Superscript II RT from GIBCO-BRL and RNase inhibitor from Boehringer-Mannheim (Indianapolis, IN) at 37°C/90 minutes and
95°C/10 minutes in a PTC-100 thermal cycler (MJ
Research, Watertown, MA). PCR reactions for p40, p35, TNF-, IFN-,
IL-12R 1 and 2 chains, and hypoxanthine-phosphoribosyl
transferase (HPRT) were performed with 5 µL of a 100-µL volume
containing cDNA reverse transcribed from 3 µg RNA. Other components
of the PCR reaction were 10× PCR buffer, Advantage cDNA polymerase
(Clontech, Palo Alto, CA), 2.5 mmol/L dNTPs (Boehringer-Mannheim), and
200 nmol/L 5' and 3' primers. DNA sequences for the primers were: 5'
p40: CCAAGAACTTGCAGCTGAAG; 3' p40: TGGGTCTATTCCGTTGTGTC; 5' p35:
GATGAGCTGATGCAGGCC; 3' p35: CAAACCTCCCTGGAGCGAA; 5' TNF-; GAGTGATCGGCCCCCAGAGG; 3' TNF-: TGCGGCTGATGGTGTGGGTG; 5' IFN-: AGTTATATCTTGGCTTTTCA; 3' IFN-: ACCGAATAATTAGTCAGCTT; 5'
IL-12R1: ACAGAGAAGTCTCCTGAGGT; 3' IL-12R1:
GGACAGCATGTGGAGCTGTA; 5' IL-12R2: AGAGCGCGACACGTGCGG; 3' IL-12R2:
GGCTGTTCTGGAGCAACAC; 5' HPRT: CCTGCTGGATTACATCAAAGCACTG; 3' HPRT:
TCCAACACTTCGTGGGGTCCT. Thermal cycler conditions were 95°C/5 minutes,
Tm/1 minute, 72°C/1 minute for 1 cycle, and 95°C/40
seconds, Tm/40 seconds, 72°C/40 seconds for 35 cycles
(except HPRT: 40 cycles). These conditions were found to be
subsaturating for all PCR products. Ten microliters of each sample were
electrophoresed through a 1.5% agarose/TAE gel with ethidium bromide
and scanned via a FluorImager (Molecular Dynamics, Sunnyvale, CA). PCR
products were verified by confirming the known base-pair sequence
length. Bands were assigned densitometric values by the ImageQuaNT
program (Molecular Dynamics), and these values were normalized to HPRT values.
Competitor constructs for the IL-12R1 and IL-12R2 PCR assays were
constructed by PCR mutagenesis techniques. Briefly, the IL-12R1 and
IL-12R2 PCR assays were designed to yield a 500-bp PCR product with
a restriction site at the center of the sequence (EcoRI for
IL-12R1, BamHI for IL-12R2), which when cut would yield
two 250-bp fragments. Overlapping primers were designed which amplified
the 500-bp fragment but with a 1-nucleotide substitution mutation in
the restriction site, thus destroying it. This mutant 500-bp sequence
was ligated into the vector pCR2.1 (InVitrogen, Carlsbad, CA) and used
to transform XL-1 Blue Supercompetent cells (Stratagene, La Jolla, CA)
on X-gal (5-bromo-4-chloro-3-indolyl--D-galactopyranoside) plates.
Clones with the mutant sequences were selected, grown up via miniprep,
and quantitated against  H3 marker. Consequently, a titration of
three known concentrations of IL-12R1 or IL-12R2 competitor
(1.372, 0.457, and 0.152 fg, selected from earlier trials) were
amplified in a PCR reaction with 5 µL of sample cDNA under the
conditions described above. EcoRI and BamHI restriction digests were performed on 10 µL of the PCR product for 1 hour at
37°C followed by gel electrophoresis. Uncut competitor bands migrated
to 500 bp and cut wild-type sample bands traveled to 250 bp.
Quantitative values were assigned to the samples via comparison to the
competitor values by proportional calculations.
Statistics.
Statistical significance between groups of data was calculated
via the generation of P values via an unpaired student's
T test.
| |
RESULTS |
IL-12 secretion is deficient in PBMC from HIV-infected patients over a
panel of various stimuli.
We first expanded our initial finding of a defect in IL-12 production
by PBMC from HIV-infected individuals in response to S
aureus7 by measuring the capacity for IL-12 synthesis
in response to a panel of stimuli. These different stimulating regimens have been previously characterized in regards to their IL-12-inducing function and represent several levels of potency. Similar to fixed S aureus, OK432 is also a preparation of killed gram-positive streptococcal bacteria. LPS and LTA are cell-wall components of gram-negative and gram-positive bacteria, respectively. When used by
themselves, these agents are moderate inducers of p40 protein production (102 to 103 pg/mL) and poor inducers
of p70 (100 to 102 pg/mL). However, a 16-hour
priming regimen of IFN- converts stimulation with LPS or LTA to
potent induction of both p40 (104 to 105 pg/mL)
and p70 (103 to 104 pg/mL). Table
1 shows a consistent reduction in the
capacity for p40 production by cells from HIV+ patients
compared with uninfected controls across the entire panel of stimuli.
This disparity reaches statistical significance in the cases of
stimulation with S aureus, OK432, and LTA (preceded by priming
with IFN-), which are all examples of moderate p40 inducers. It
appears that extremely potent stimulating conditions, such as
IFN-/LPS, can maximize the p40 production pathway such that
HIV+ monocytes begin to approach the p40 production
capacity of uninfected cells. On the other hand, agents such as LPS and
LTA provide a much poorer stimulus for p40, which may mask the
disparity between the groups observed with more potent agents. However,
it is important to note that the trend across the entire panel
consistently showed an impairment in p40 production from HIV-infected
cultures.
View this table:
[in this window]
[in a new window]
|
Table 1.
Induction of IL-12 p40 and p70 by a Panel of
Stimuli Is Impaired in PBMC From HIV-Infected Patients Compared
With Healthy Controls
|
|
The secretion of the p70 heterodimer largely parallels the pattern of
expression described above for the p40 monomer. Again, the general
trend is a reduced ability of HIV+ monocytes to produce p70
compared with uninfected cells (Table 1). Moderately potent types of
stimuli such as S aureus and IFN-/LTA show significant p70
deficits for HIV-infected subjects, whereas extreme or weakly inducing
stimuli also indicate a reduction in p70 but less markedly. Because the
p70 heterodimer is produced at much lower concentrations than p40, it
is expected that poor stimuli such as LPS or LTA would not be
sufficient to clearly show the p70 dysregulation. Additionally, no
correlation between CD4 T-cell counts of the patients and IL-12
response was found, indicating that the IL-12 deficiency is induced
early in infection and is maintained throughout disease progression,
which is a finding we reported previously.7
We further explored the deficiency in IL-12 production with regards to
stimulation with an opportunistic agent that infects patients with
acquired immune deficiency syndrome, C albicans. We used two
separate strains of C albicans: CA6, a virulent strain, lethal
in CDF1 mice, which induces a Th2 response in these animals, and PCA2,
a lab-adapted strain that prompts a healing Th1 response in those
mice.12 Both live and heat-killed preparations of C albicans have been used to stimulate cytokine production from murine cells. We found that heat-killed C albicans induced
moderate levels of p40 release from cultures of uninfected PBMC (Fig
1). In contrast, cells from
HIV+ patients reacted poorly to this stimulation in regards
to p40 production, confirming a widespread IL-12 production deficiency. None of the C albicans preparations induced detectable p70
levels in PBMC cultures (data not shown).
View larger version (38K):
[in this window]
[in a new window]
| Fig 1.
PBMC from HIV-infected individuals are deficient in the
p40 response to C albicans. Freshly harvested yeast cells of
strain CA-6 or PCA-2 were washed twice in 1 × PBS and cultured for
24 hours with 2 × 106/mL PBMC from control
subjects or patients. Tests were conducted to find optimal culture
conditions for the use of yeast cells: heat-inactivation at 65°C for
1 hour (heat killed) before addition to culture at a 1:2 yeast
cell:PBMC ratio was found to be a more effective IL-12-stimulus than
addition of live C albicans. Cell-free supernatants were
assayed for p40 content via RIA. n = 16 for
HIV+ group and n = 7 for HIV
group. Bars represent means of each cohort; P values were
calculated via an unpaired student's t-test and compared
HIV+ ( ) and HIV ( ) groups for each
condition; error bars indicate SEM.
|
|
IL-12 mRNA expression in PBMC from HIV-infected patients is
dysfunctionally regulated across a panel of stimuli.
To further define at what level the defect in IL-12 production by PBMC
from HIV-infected patients was taking place, we examined the expression
of p40 and p35 mRNA in HIV+ patients versus controls after
stimulation with several stimuli. Similarly to our evaluation of IL-12
protein secretion, we find that the induction of mRNA expression of
both IL-12 subunits as measured by RT-PCR is reduced in cell cultures
from HIV-infected individuals (Table 2).
Densitometric values were derived from ethidium bromide-stained bands,
normalized to HPRT values, and reported as the fold-increase in
expression of each stimulatory condition compared with the unstimulated
control. Reduced accumulation of both p40 and p35 transcripts is
consistently observed across the panel of stimuli, except in cases of
extremely potent stimuli, such as IFN-/LPS. We observed that this
reduction of IL-12 mRNA levels appeared to be specific for that
cytokine, as TNF- expression was equivalent between the two cohorts
(data not shown). A more substantial reduction in p40 mRNA expression
than in p35 mRNA expression was generally observed in the
HIV+ group, which agreed with the more significant
discrepancy observed for p40 protein production (Table 1) compared with
p70 protein.
IFN- production is depressed in HIV+
patients.
Although some reports have shown the synthesis of IFN- to be
markedly diminished in HIV+ cells from peripheral blood and
in clones derived from blood cells,13-15 controversy still
exists as to whether such a diminishment is truly indicative of
negative regulation of IFN- during infection with HIV. To ascertain
whether an impairment in IFN- production as well as in IL-12
production is observable in our cultures, PBMC from both groups of
subjects were stimulated over 48 hours with a variety of T-cell
mitogens, and IFN- production was recorded. Figure
2A indicates that IFN- production is
indeed depressed in cultures from infected individuals and that this
depression is significant in all cases with the exception of PHA
stimulation. Furthermore, the disparity in IFN- production between
the two groups became more pronounced when the cells were stimulated in the presence of IL-12, which boosted IFN- production by control cultures considerably but induced much less IFN- from infected cultures when stimulated with PHA or anti-CD3 (Fig 2B). This deficiency in the response to IL-12 led us to examine the expression of IL-12R in
the two subject groups.
View larger version (37K):
[in this window]
[in a new window]
| Fig 2.
Induction of IFN- by a panel of T-cell mitogenic
stimuli is impaired in HIV-infected PBMC compared with controls. (A)
PBMC from controls and patients were incubated at 2 × 106/mL for 48 hours with medium alone,  -CD3 (soluble or
platebound) + -CD28, TPA + ionomycin, or PHA. Cell-free
supernatants were harvested and assayed for IFN-. The P
values comparing the control group versus patient group in each
category of stimulation are listed and were calculated via an unpaired
student's t-test. Data are derived from 10 patients and 10 controls. (B) PBMC from controls and patients were cultured for 48 hours with medium, -CD3 (soluble), PHA, or IL-2 in the presence or
absence of IL-12. Cell-free supernatants were harvested and assayed for
IFN-. The P values comparing the control group versus
patient group in each category of stimulation are listed and were
calculated via an unpaired student's t-test. Data are from
individual donors (n = 21 for HIV+ and n = 17 for
HIV).
|
|
Expression of IL-12R2 is defective in HIV-infected
individuals.
Another gene whose expression may be dependent on adequate levels of
IL-12 is that of IL-12R2. Recent reports suggest that although the
IL-12R1 subunit is constitutively expressed on the cell surface and
is only modestly regulated, IL-12R2 is not expressed on naive T
cells or NK cells and must be upregulated by signals that may be at
least partially provided by IL-12 itself.16 To investigate
the expression of IL-12R2 in HIV-infected subjects, we conducted
competitive RT-PCR assays on mitogen-stimulated PBMC cultures that were
stimulated with T-cell mitogens for 20 hours. PCR was conducted on cDNA
samples from these cultures in competition with known concentrations of
a competitor construct. This construct has a sequence virtually
identical with that of the wild-type fragment with one nucleotide
substitution that inactivates a naturally occurring BamHI site.
The close identity of the sequences ensures that they are amplified
with the same efficiency during the PCR reaction. The wild type and
competitor PCR products can be then distinguished by conducting
BamHI restriction digests, which will cut the wild-type and not
the competitor fragments followed by electrophoresis to separate them
on an agarose gel. A representative example of competitive IL-12R2
RT-PCR performed on one control and one patient is shown in Fig
3A. In this way we were able to derive data
that accurately reflect the quantity of IL-12R2 mRNA expressed in
our cultures. Cumulative data from the patient and control groups are
shown in Fig 3B. T-cell mitogens are able to induce on average 3-fold
to 5-fold higher quantities of IL-12R2 message in cells from the
uninfected group compared with HIV-infected cells. In contrast, cells
from patients showed little or no ability to enhance IL-12R2
expression above the minimal constitutive levels observed in
unstimulated cells. IL-12R1 expression, on the other hand, was not
significantly different between the two groups of subjects, nor was its
expression markedly enhanced by mitogen stimulation in either group
(data not shown), indicating that the cultures were not demonstrating
reduced IL-12R2 expression simply through widespread cellular
apoptosis. Thus, expression of IL-12R2, but not IL-12R1, is
markedly diminished in HIV-infected individuals.
View larger version (55K):
[in this window]
[in a new window]
| Fig 3.
Induction of IL-12R2 mRNA is depressed in cells from
HIV-infected individuals. PBMC from nine HIV+ patients
and six healthy controls were cultured at 2 × 106/mL for
20 hours with PHA + TPA, anti-CD3 (OKT3), TPA + ionomycin (Io), or
medium alone. RNA was extracted and competitive RT-PCR for IL-12R2
was performed as described in Materials and Methods. (A) Representative
samples of PHA + TPA-stimulated samples from each cohort are shown to
demonstrate competitive IL-12R2 RT-PCR. Near-equivalent competition
is observed at 0.457 fg IL-12R2 for the control sample and at 0.152 fg for the patient sample. (B) Densitometric values in arbitrary units
were assigned by the ImageQuaNT program to the ethidium bromide-stained
bands of wild-type and competitor fragments, which most closely
approached equivalent competition. IL-12R2 quantities were computed
through the following formula: Unknown Sample Quantity = (ImageQuaNT
Sample Value)(Quantity of Competitor)/(ImageQuaNT Competitor Value).
Data represent the means of values derived from nine patients and six
controls (except patients stimulated with TPA + ionomycin, where
n = 2). The P values comparing patient versus
control group IL-12R2 expression and unstimulated (no stim) versus
stimulated groups are listed and were calculated via an unpaired
student's t-test. n.s., not significant.
|
|
IL-12 can restore the impaired expression of IL-12R2.
As previous reports have indicated a dependence on the presence of
IL-12 for optimal IL-12R2 expression,17 we determined whether exposure of HIV+ PBMC to IL-12 could restore
IL-12R2 message to levels observed in normal individuals. We had
previously determined that a 72-hour exposure to IL-12 or IFN- (also
reported to have IL-12R2-enhancing properties17), could
markedly enhance IL-12R2 mRNA accumulation in PHA-stimulated PBMC
from healthy individuals, although IL-12 was consistently more potent
than IFN- in this respect (data not shown). Thus, PBMC from patients
were similarly stimulated with PHA in the presence of IL-12 or IFN-
for 72 hours then examined for IL-12R1 and IL-12R2 as well as
IFN- expression. As evidenced in Fig 4,
IL-12 was particularly effective at the marked enhancement of
IL-12R2 expression to levels consistent with those observed in
uninfected subjects (data not shown). On the other hand, IFN- showed
a modest capacity to induce IL-12R2, which was somewhat donor
dependent. The lesser ability of IFN- to enhance IL-12R2 compared
with IL-12 was not related to an inability of HIV+ cells to
respond to IFN-, because we observed similar disparities between the
effects of these two cytokines with uninfected subjects (data not
shown). IFN- expression was enhanced by IL-12 or IFN- stimulation
of HIV+ PBMC in similar fashion to IL-12R2, although
levels of IL-12R1 message were modulated very little compared with
control cultures. These data demonstrate that the presence of IL-12 can
restore deficient IFN- production, at least in part, by enhancing
the proportion of high-affinity IL-12Rs on the cell surface, thus allowing for downstream events to occur.
View larger version (55K):
[in this window]
[in a new window]
| Fig 4.
Enhancement of IL-12R2 and IFN- transcript
expression in HIV-infected PBMC by IL-12 and IFN-. PBMC from eight
patients were cultured at 2 × 106/mL for 72 hours with 2 µg/mL PHA ± 2 ng/mL IL-12 or 1,000 U/mL IFN-. (A)
RNA was extracted and RT-PCR was performed for the detection of
IL-12R1, IL-12R2, IFN-, and HPRT mRNA. Representative results
from 4 of 8 donors are shown. (B) Densitometric values were assigned to
bands by ImageQuaNT, normalized to HPRT values, and displayed as fold
induction of message levels compared with PHA stimulation alone. Data
points are from individual donors (n = 8) and the mean is
represented by (+).
|
|
| |
DISCUSSION |
This study confirms and extends our previous observation that IL-12
production as induced by S aureus stimulation is handicapped in
cells from HIV-infected individuals.7 Here, we show that this defect is evident regardless of the type of stimulating agent used. Depressed IL-12 production is shown in the form of reductions in
the amounts of p40 and p70 protein synthesized by HIV-infected cells as
well as in the levels of p40 and p35 mRNA they express. We also find
deficits in the expression of two downstream genes in the
IL-12-initiated cascade of events: IL-12R2 and IFN-. Whether
these reductions are the result of abnormally low levels of IL-12
present in the HIV-infected environment or whether there are separate
but specific HIV-directed mechanisms for those reductions is presently
unclear. Because both CD4 and CD8 T cells can respond to IL-12, it is a
possibility that the depressed IL-12R2 expression in HIV-infected
cells may be related to the differing proportions of CD4:CD8 T cells
between patients and controls. However, the relative expression
patterns of IL-12R2 on CD4 versus CD8 T cells is not yet characterized.
Our first investigation of the IL-12 defect, which examined only S
aureus as a stimulus for IL-12 production, found approximately a
10-fold difference in p40 production between the control and the
infected groups and a 5-fold disparity in p70 levels.7 In
the present study, we report higher means of IL-12 p40/p70 release by
cultures from HIV-infected individuals, which render the differential
production of IL-12 between controls and patients in this study less
dramatic than previously shown. One explanation for this discrepancy
could rely on the different therapy protocols received by the
HIV-infected cohort examined in this study. Initially, our studies drew
on a pool of patients receiving one or two nucleoside-base inhibitors
such as zidovudine or lamivudine. Currently, the cohort is composed of
patients receiving much more aggressive therapies, some for several
years, which routinely include two or three nucleoside analogs as well
as a protease inhibitor such as nevirapine, nelfinavir, indinavir, or
ritonavir. Treatment with nucleoside analogs and protease inhibitors
has been shown to partially restore certain cellular functions such as
HIV-specific proliferation,18,19 and the difference in
IFN- production by T cells between patients and controls has been
observed to be partially ameliorated in correlation with the number of
anti-HIV drugs taken by the infected individual.20
Therefore, it is possible that the drug regimens to which our patient
pool is subjected are responsible for narrowing the IL-12 production
gap between subject groups. However, despite these drug treatments, a
consistent and unmistakable reduced capacity to produce optimal levels
of IL-12 under most stimulatory conditions remains.
Some data from other laboratories are in agreement with our findings.
Reductions in p35 and p40 mRNA in HIV+ cultures in response
to S aureus have been shown by Chougnet et al,21
however, no other stimuli were examined in that case. An
IL-12-deficient response by patients to S aureus and not to LPS was observed in another study,22 although the different experimental protocol involving whole blood cultures may have influenced the capacity for IL-12 production. Harrison and
Levitz23 investigated IFN- priming with S aureus
stimulation of HIV+ PBMC and derived data on p70 protein
levels similar to that generated in the present study with IFN- + LPS as a stimulus. However, unlike the present study, these
investigations did not analyze the IL-12 production defect by using a
broad panel of stimuli while simultaneously examining different
parameters of IL-12 expression including p40 and p70 protein release
and p40 and p35 mRNA accumulation. Another study performed by Harrison
and Levitz24 confirmed the deficient IL-12 production for
PBMC of HIV-infected patients after S aureus stimulation, as we
had previously shown,7 but, in contrast to the data
presented here, found no such deficiency after stimulation with C
albicans. However, in their report the authors examined only p40
mRNA expression via RT-PCR without presenting protein data for C
albicans-stimulated cultures.24 In our
study, we observed that C albicans yeast cells were only
moderate inducers of p40 from uninfected cells and did not support
detectable p70 production. Therefore, it may be difficult to show the
IL-12 impairment at the level of mRNA when using a stimulus of such
mild potency. Furthermore, differences in assay sensitivity may account
for some inconsistencies between the two reports, because Harrison and
Levitz24 additionally failed to detect a p40 mRNA
deficiency after S aureus stimulation, as we did, and only
reported a reduction in p70 protein levels. Finally, our study was
conducted with considerably larger cohorts of subjects, thus better
managing variability between individuals within both subject groups.
IL-12 has been well characterized as an indispensable agent for the
optimal production of IFN- by T cells and NK cells25 and
as a recent report17 also indicates, it may play a role in
the induction and/or enhancement of the 2 chain of its own receptor.
Surface expression of IL-12R2 is required for high-affinity IL-12
binding and for mediation of numerous IL-12 activities, including
T-cell proliferation, IFN- production by T cells and NK cells, and
cytolytic activity,14,26,27 all of which have been observed
to be depressed during progressive HIV infection.28,29 Although there is some controversy that surrounds the issue of impaired
IFN- production during HIV infection,30,31 our data clearly demonstrate a reduced IFN- response by HIV+
PBMC, and other reports that present contrasting data may do so by
examining RNA levels from unstimulated cells that may not reflect a
defect in the IFN- response to stimulation.30 More evidence for an inability of IL-12 to optimally signal in HIV-infected cells comes from a recent report, which noted that expression of the
transcriptional activators STAT5 and STAT1 are selectively decreased in
T cells that are infected in vitro or are derived from HIV+
patients.32 Both of these STATs, as well as STAT4, are
known to be activated after stimulation through the
IL-12R.33 The danger represented by this lack of a proper
IL-12-signaling pathway in HIV-infected individuals is underlined by
studies of some individuals who were found to harbor deficient copies
of IL-12R1 because of inherited mutation and consequently were
immunodeficient and suffered from chronic disseminated mycobacterial
infections.34,35
The stimulatory agents used in this study were those we previously
characterized for their IL-12-inducing properties,3,36 and
most are preparations of or components of gram-positive or -negative bacteria. S aureus and OK432 are heat killed and
pickled preparations of S aureus and Streptococcus
pyogenes gram-positive bacilli, whereas LPS and LTA are purified
cell-wall components of gram-negative and gram-positive bacteria,
respectively. LPS and LTA are known to signal through binding to CD14
on the surface of B cells or monocytes,37 while the
signaling mechanism of S aureus is also largely dependent on
CD14 expression.38 Although IFN- and IL-4, used as
priming agents in our studies, signal through differing mechanisms,
these agents are not directly responsible for activation of p40 or p35
gene transcription, as priming with IFN- or IL-4 alone without
subsequent stimulation has no effect on p40/p35 message
levels.9,39 Thus, it appears that signaling through CD14
may be a common mechanism of the panel of stimuli examined in this
study and, thus, a possible target for HIV-mediated dysfunction.
It does not seem likely that HIV acts to negatively regulate CD14
surface expression on monocytes, as the percentage of CD14+
monocytes from infected subjects has actually been observed to increase
compared with healthy controls.40 In addition, the mechanism of bacterial endotoxin signaling through CD14 is poorly defined. It is known that association with LPS-binding protein transfers LPS to interact with CD14, followed by internalization of LPS
and ultimately the provocation of NF B translocation to the nucleus,
perhaps through a tyrosine kinase cascade.41,42 It is
possible that infection with HIV may interfere at some point in this
sequence of events to hinder the initiation of p40/p35 transcription,
perhaps by preventing the activation of NFB, which has been shown to
positively promote human p40 transcription.43
The reduced IFN- and IL-12R2 levels, which we observe during HIV
infection, may be secondary effects derived from a primary HIV-influenced dysregulation of IL-12. Although different stimuli were
used to induce IL-12 and IFN- production, the T-cell mitogenic stimuli used for IFN- production have been previously observed to be
at least partially dependent on IL-12 (and IL-12R) to activate IFN-
(G.T. unpublished observations). Thus, it follows that
administration of exogenous IL-12 should restore those downstream
deficiencies in IL-12R2 and IFN-, which we proved here for
IL-12R2 and which has been shown previously for IFN-. The
addition of exogenous IFN-, on the other hand, appears to provide a
more modest signal for IL-12R2 enhancement, and a consistent
increase in IL-12R2 expression is not evident with cells from every
subject studied. Earlier reports from our laboratory and others have
clearly indicated that cells from most infected subjects can respond to
IL-12 administration vigorously.10,11 Although addition of
IL-12 to 48-hour cultures of HIV+ PBMCs did not appreciably
enhance IFN- secretion (Fig 2B), we observed that at least 72 hours
of exposure to IL-12 were necessary for restoration of both IFN- and
IL-12R2 mRNA expression, indicating a longer period of culture would
eventually result in increases in IFN- protein production.
This study indicates that the capacity to express high-affinity IL-12R
in response to T-cell mitogenic stimuli is severely diminished in
HIV+ patients. However, we show that IL-12 itself can
circumscribe this impairment by directly enhancing the expression of
IL-12R2, thus allowing high-affinity IL-12R responsiveness and
eventual IFN- production. The mechanism by which IL-12 signals on
cells lacking high-affinity IL-12Rs is unclear. It is known that IL-12 can bind to a low affinity receptor consisting of IL-12R1
alone27 and perhaps can at least partially signal through
it or through an unidentified associated chain to upregulate IL-12R2
expression. On the other hand, IL-12 may be able to signal on
HIV+ cells after sufficient rounds of PHA-instigated
expansion of a proportionally small IL-12R2+ subset have
occurred. Nonetheless, these findings lend further support for a
potentially vital role for IL-12 or an IL-12-agonist as part of a
multidrug therapy. The restoration of the cellular-based HIV-specific
immune response by IL-12 in combination with a direct attack on the
virus itself by protease inhibitors and other drugs might be effective
at reducing viral load simultaneously with establishing long-lasting
anti-HIV immunity.
| |
ACKNOWLEDGMENT |
We are grateful to each of the donor participants for donating blood as
well as to D. Davis, D. McGhee, A. Holloway, R. Anthony, B. Gallagher,
B. McManus, M. Smerkanich, S. Dix-Lassiter, J. Schull, and the Board
and Staff of Philadelphia FIGHT.
| |
FOOTNOTES |
Submitted September 22, 1998; accepted March 29, 1999.
Supported in part by the Public Health Service (PHS) Grants No.
AI34412, CA10815, CA20833, CA32898, AI34758, by the Adult Clinical
Trial Group (ACTG), by funds from Advanced Technology Laboratories, by
AIDS funds from the Commonwealth of Pennsylvania, and by the W.W. Smith
Charitable Trust (J.C.). J.D.M. is supported by the National Institutes
of Health (NIH) postdoctoral fellowship AI09627. These studies were
also, in part, supported by the Philadelphia Foundation and Mrs. M. Stengel Miller's support of the HIV-1 Partnership Program for Basic Research.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Giorgio Trinchieri, MD, The Wistar
Institute, 3601 Spruce St, Philadelphia, PA 19104; e-mail:
trinchieri{at}wista.wistar.upenn.edu.
| |
REFERENCES |
1.
Trinchieri G:
Proinflammatory and immunoregulatory functions of interleukin-12.
Int Rev Immunol
16:365, 1998[Medline]
[Order article via Infotrieve]
2.
Trinchieri G:
Immunobiology of interleukin-12.
Immunol Res
17:269, 1998[Medline]
[Order article via Infotrieve]
3.
D'Andrea A, Rengaraju M, Valiante NM, Chehimi J, Kubin M, Aste M, Chan SH, Kobayashi M, Young D, Nickbarg E, Chizzonite R, Wolf SF, Trinchieri G:
Production of natural killer cell stimulatory factor (interleukin 12) by peripheral blood mononuclear cells.
J Exp Med
176:1387, 1992[Abstract/Free Full Text]
4.
Heinzel FP, Hujer AM, Ahmed FN, Rerko RM:
In vivo production and function of IL-12 p40 homodimers.
J Immunol
158:4381, 1997[Abstract]
5.
Yoshimoto T, Wang CR, Yoneto T, Waki S, Sunaga S, Komagata Y, Mitsuyama M, Miyazaki J, Nariuchi H:
Reduced T helper 1 responses in IL-12 p40 transgenic mice.
J Immunol
160:588, 1998[Abstract/Free Full Text]
6.
Aste-Amezaga M, Ma X, Sartori A, Trinchieri G:
Molecular mechanisms of the induction of IL-12 and its inhibition by IL-10.
J Immunol
160:5936, 1998[Abstract/Free Full Text]
7.
Chehimi J, Starr SE, Frank I, D'Andrea A, Ma X, MacGregor RR, Sennelier J, Trinchieri G:
Impaired interleukin 12 production in human immunodeficiency virus-infected patients.
J Exp Med
179:1361, 1994[Abstract/Free Full Text]
8.
Chehimi J, Ma X, Chouaib S, Zyad A, Nagashunmugam T, Wojcik L, Chehimi S, Nissim L, Frank I:
Differential production of interleukin 10 during human immunodeficiency virus infection.
AIDS Res Hum Retroviruses
12:1141, 1996[Medline]
[Order article via Infotrieve]
9.
Marshall JD, Robertson SE, Trinchieri G, Chehimi J:
Priming with IL-4 and IL-13 during HIV-1 infection restores in vitro IL-12 production by mononuclear cells of HIV-infected patients.
J Immunol
159:5705, 1997[Abstract]
10.
Chehimi J, Valiante NM, D'Andrea A, Rengaraju M, Rosado Z, Kobayashi M, Perussia B, Wolf SF, Starr SE, Trinchieri G:
Enhancing effect of natural killer cell stimulatory factor (NKSF/interleukin-12) on cell-mediated cytotoxicity against tumor-derived and virus-infected cells.
Eur J Immunol
23:1826, 1993[Medline]
[Order article via Infotrieve]
11.
Clerici M, Lucey DR, Berzofsky JA, Pinto LA, Wynn TA, Blatt SP, Dolan MJ, Hendrix CW, Wolf SF, Shearer GM:
Restoration of HIV-specific cell-mediated immune responses by interleukin-12 in vitro.
Science
262:1721, 1993[Abstract/Free Full Text]
12.
Romani L, Cenci E, Menacci A, Bistoni F, Puccetti P:
T helper cell dichotomy to Candida albicans: Implications for pathology, therapy, and vaccine design.
Immunol Res
14:148, 1995[Medline]
[Order article via Infotrieve]
13.
Gazzinelli RT, Bala S, Stevens R, Baseler M, Wahl L, Kovacs J, Sher A:
HIV infection suppresses type 1 lymphokine and IL-12 responses to Toxoplasma gondii but fails to inhibit the synthesis of other parasite-induced monokines.
J Immunol
155:1565, 1995[Abstract]
14.
Clerici M, Balotta C, Meroni L, Ferrario E, Riva C, Trabattoni D, Ridolfo A, Villa M, Shearer GM, Moroni M, Galli M:
Type 1 cytokine production and low prevalence of viral isolation correlate with long-term nonprogression in HIV infection.
AIDS Res Hum Retroviruses
12:1053, 1996[Medline]
[Order article via Infotrieve]
15.
Maggi E, Macchia D, Parronchi P, Mazzetti M, Ravina A, Milo D, Romagnani S:
Reduced production of interleukin 2 and interferon- and enhanced helper activity for IgG synthesis by cloned CD4+ T cells from patients with AIDS.
Eur J Immunol
17:1685, 1987[Medline]
[Order article via Infotrieve]
16.
Wu CY, Warrier RR, Carvajal DM, Chua AO, Minetti LJ, Chizzonite R, Mongini PKA, Stern AS, Gubler U, Presky DH, Gately MK:
Biological function and distribution of human interleukin-12 receptor chain.
Eur J Immunol
26:345, 1996[Medline]
[Order article via Infotrieve]
17.
Rogge L, Barberis-Maino L, Biffi M, Passini N, Presky DH, Gubler U, Sinigaglia F:
Selective expression of an interleukin-12 receptor component by human T helper 1 cells.
J Exp Med
185:825, 1997[Abstract/Free Full Text]
18.
Leandersson AC, Bratt G, Hinkula J, Gilljam G, Cochaux P, Samson M, Sandstrom E, Wahren B:
Induction of specific T-cell responses in HIV infection.
AIDS
12:157, 1998[Medline]
[Order article via Infotrieve]
19.
Carr A, Emery S, Kelleher A, Law M, Cooper DA:
CD8+ lymphocyte responses to antiretroviral therapy of HIV infection.
J AIDS Hum Retrovirol
13:320, 1996[Medline]
[Order article via Infotrieve]
20.
Bailer RT, Holloway A, Anthony R, Lassiter S, Kostman J, Montaner LJ:
Deficiency of IL-13 and IFN- secretion in HIV-infected individuals contributes to overall immune dysfunction.5th Conference on Retroviruses and Opportunistic Infections (vol 193)., 1998, p 602 (abstr)
21.
Chougnet C, Wynn TA, Clerici M, Landay AL, Kessler HA, Rusnak J, Melcher GP, Sher A, Shearer GM:
Molecular analysis of decreased interleukin-12 production in persons infected with human immunodeficiency virus.
J Infect Dis
174:46, 1996[Medline]
[Order article via Infotrieve]
22.
Meyaard L, Hovenkamp E, Pakker N, van der Pouw Kraan TCTM, Miedema F:
Interleukin-12 (IL-12) production in whole blood cultures from human immunodeficiency virus-infected individuals studied in relation to IL-10 and prostaglandin E2 production.
Blood
89:570, 1997[Abstract/Free Full Text]
23.
Harrison TS, Levitz SM:
Priming with IFN- restores deficient IL-12 production by peripheral blood mononuclear cells from HIV-seropositive donors.
J Immunol
158:459, 1997[Abstract]
24.
Harrison TS, Levitz SM:
Role of IL-12 in peripheral blood mononuclear cell responses to fungi in persons with and without HIV infection.
J Immunol
156:4492, 1996[Abstract]
25.
Trinchieri G:
Cytokines acting on or secreted by macrophages during intracellular infection (IL-10, IL-12, IFN-).
Curr Opin Immunol
9:17-23, 1997[Medline]
[Order article via Infotrieve]
26.
Presky DH, Yang H, Minetti LJ, Chua AO, Nabavi N, Wu CY, Gately MK, Gubler U:
A functional interleukin 12 receptor complex is composed of two -type cytokine receptor subunits.
Proc Natl Acad Sci USA
93:14002, 1996[Abstract/Free Full Text]
27.
Wu C, Warrier RR, Wang X, Presky DH, Gately MK:
Regulation of interleukin-12 receptor 1 chain expression and interleukin-12 binding by human peripheral blood mononuclear cells.
Eur J Immunol
27:147, 1997[Medline]
[Order article via Infotrieve]
28.
Clerici M, Hakim FT, Venzon DJ, Blatt S, Hendrix CW, Wynn TA, Shearer GM:
Changes in interleukin-2 and interleukin-4 production in asymptomatic human immunodeficiency virus-seropositive individuals.
J Clin Invest
91:759, 1993
29.
Chehimi J, Starr SE, Frank I, Rengaraju M, Jackson SJ, Llanes C, Kobayashi M, Perussia B, Young D, Nickbarg E, Wolf SF, Trinchieri G:
Natural killer (NK) cell stimulatory factor increases the cytotoxic activity of NK cells from both healthy donors and human immunodeficiency virus-infected patients.
J Exp Med
175:789, 1992[Abstract/Free Full Text]
30.
Fan J, Bass HZ, Fahey JL:
Elevated IFN- and decreased IL-2 gene expression are associated with HIV infection.
J Immunol
151:5031, 1993[Abstract]
31.
Meyaard L, Hovenkamp E, Keet IP, Hooibrink B, de Jong IH, Otto SA, Miedema F:
Single cell analysis of IL-4 and IFN- production by T cells from HIV-infected individuals: Decreased IFN- in the presence of preserved IL-4 production.
J Immunol
157:2712, 1996[Abstract]
32.
Pericle F, Pinto LA, Hicks S, Kirken RA, Sconocchia G, Rusnak J, Dolan MJ, Shearer GM, Segal DM:
Cutting Edge: HIV-1 infection induces a selective reduction in STAT5 protein expression.
J Immunol
160:28, 1998[Abstract/Free Full Text]
33.
Gollob JA, Murphy EA, Mahajan S, Schnipper CP, Ritz J, Frank DA:
Altered interleukin-12 responsiveness in Th1 and Th2 cells is associated with the differential activation of STAT5 and STAT1.
Blood
91:1341, 1998[Abstract/Free Full Text]
34.
Altare F, Durandy A, Lammas D, Emile JF, Lamhamedi S, Le Deist F, Drysdale P, Jouanguy E, Doffinger R, Bernaudin F, Jeppsson O, Gollob JA, Meinl E, Segal AW, Fischer A, Kumararatne D, Casanova JL:
Impairment of mycobacterial immunity in human interleukin-12 receptor deficiency.
Science
280:1432, 1998[Abstract/Free Full Text]
35.
Jong R, Altare F, Haagen IA, Elferink DG, de Boer T, van Breda Vriesman PJC, Kabel PJ, Draaisma JMT, van Dissel JT, Kroon FP, Casanova JL, Ottenhoff THM:
Severe mycobacterial and salmonella infections in interleukin-12 receptor-deficient patients.
Science
280:1435, 1998[Abstract/Free Full Text]
36.
D'Andrea A, Aste-Amézaga M, Valiante NM, Ma X, Kubin M, Trinchieri G:
Interleukin 10 (IL-10) inhibits human lymphocyte interferon -production by suppressing natural killer cell stimulatory factor/IL-12 synthesis in accessory cells.
J Exp Med
178:1041, 1993[Abstract/Free Full Text]
37.
Schumann RR, Rietschel ET, Loppnow H:
The role of CD14 and lipopolysaccharide-binding protein (LBP) in the activation of different cell types by endotoxin.
Med Microbiol Immunol
183:279, 1994[Medline]
[Order article via Infotrieve]
38.
Kusunoki T, Hailman E, Juan TS, Lichenstein HS, Wright SD:
Molecules from Staphylococcus aureus that bind CD14 and stimulate innate immune responses.
J Exp Med
182:1673, 1995[Abstract/Free Full Text]
39.
Ma X, Chow JM, Gri G, Carra G, Gerosa F, Wolf SF, Dzialo R, Trinchieri G:
The interleukin 12 p40 gene promoter is primed by interferon in monocytic cells.
J Exp Med
183:147, 1996[Abstract/Free Full Text]
40.
Nockher WA, Bergmann L, Scherberich JE:
Increased soluble CD14 serum levels and altered CD14 expression of peripheral blood monocytes in HIV-infected patients.
Clin Exp Immunol
98:369, 1994[Medline]
[Order article via Infotrieve]
41.
Kitchens RL, Munford RS:
CD14-dependent internalization of bacterial lipopolysaccharide (LPS) is strongly influenced by LPS aggregation but not by cellular responses to LPS.
J Immunol
160:1920, 1998[Abstract/Free Full Text]
42.
Herrera-Velit P, Reiner NE:
Bacterial lipopolysaccharide induces the association and coordinate activation of p53/56lyn and phosphatidylinositol 3-kinase in human monocytes.
J Immunol
156:1157, 1996[Abstract]
43.
Gri G, Savio D, Trinchieri G, Ma X:
Synergistic regulation of the human interleukin-12 p40 promoter by NFB and Ets transcription factors in Epstein-Barr virus-transformed B cells and macrophages.
J Biol Chem
273:6431, 1998[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
W. Ma, S. Mishra, N. Gajanayaka, J. B. Angel, and A. Kumar
HIV-1 Nef Inhibits Lipopolysaccharide-induced IL-12p40 Expression by Inhibiting JNK-activated NF{kappa}B in Human Monocytic Cells
J. Biol. Chem.,
March 20, 2009;
284(12):
7578 - 7587.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Buonaguro, M. L. Tornesello, R. C. Gallo, F. M. Marincola, G. K. Lewis, and F. M. Buonaguro
Th2 Polarization in Peripheral Blood Mononuclear Cells from Human Immunodeficiency Virus (HIV)-Infected Subjects, as Activated by HIV Virus-Like Particles
J. Virol.,
January 1, 2009;
83(1):
304 - 313.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. A. Byrnes, D. M. Harris, S. F. Atabani, B. P. Sabundayo, S. J. Langan, J. B. Margolick, and C. L. Karp
Immune activation and IL-12 production during acute/early HIV infection in the absence and presence of highly active, antiretroviral therapy
J. Leukoc. Biol.,
December 1, 2008;
84(6):
1447 - 1453.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. R. de Arquer, R. Pena, C. Cabrera, G. Coma, R. Ruiz-Hernandez, R. Guerola, B. Clotet, L. Ruiz, J. A. Este, M. L. Calle, et al.
Skewed expression and up-regulation of the IL-12 and IL-18 receptors in resting and activated CD4 T cells from HIV-1-infected patients
J. Leukoc. Biol.,
July 1, 2007;
82(1):
72 - 78.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Teleshova, J. Kenney, G. Van Nest, J. Marshall, J. D. Lifson, I. Sivin, J. Dufour, R. Bohm, A. Gettie, and M. Robbiani
Local and Systemic Effects of Intranodally Injected CpG-C Immunostimulatory-Oligodeoxyribonucleotides in Macaques
J. Immunol.,
December 15, 2006;
177(12):
8531 - 8541.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Smed-Sorensen, K. Lore, L. Walther-Jallow, J. Andersson, and A.-L. Spetz
HIV-1-infected dendritic cells up-regulate cell surface markers but fail to produce IL-12 p70 in response to CD40 ligand stimulation
Blood,
November 1, 2004;
104(9):
2810 - 2817.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J.-M. Doisne, A. Urrutia, C. Lacabaratz-Porret, C. Goujard, L. Meyer, M.-L. Chaix, M. Sinet, and A. Venet
CD8+ T Cells Specific for EBV, Cytomegalovirus, and Influenza Virus Are Activated during Primary HIV Infection
J. Immunol.,
August 15, 2004;
173(4):
2410 - 2418.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Zhang, C. J. Fichtenbaum, D. A. Hildeman, J. D. Lifson, and C. Chougnet
CD40 Ligand Dysregulation in HIV Infection: HIV Glycoprotein 120 Inhibits Signaling Cascades Upstream of CD40 Ligand Transcription
J. Immunol.,
February 15, 2004;
172(4):
2678 - 2686.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Chougnet
Role of CD40 Ligand dysregulation in HIV-associated dysfunction of antigen-presenting cells
J. Leukoc. Biol.,
November 1, 2003;
74(5):
702 - 709.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Mirani, I. Elenkov, S. Volpi, N. Hiroi, G. P. Chrousos, and T. Kino
HIV-1 Protein Vpr Suppresses IL-12 Production from Human Monocytes by Enhancing Glucocorticoid Action: Potential Implications of Vpr Coactivator Activity for the Innate and Cellular Immunity Deficits Observed in HIV-1 Infection
J. Immunol.,
December 1, 2002;
169(11):
6361 - 6368.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Losana, C. Bovolenta, L. Rigamonti, I. Borghi, F. Altare, E. Jouanguy, G. Forni, J.-L. Casanova, B. Sherry, M. Mengozzi, et al.
IFN-{gamma} and IL-12 differentially regulate CC-chemokine secretion and CCR5 expression in human T lymphocytes
J. Leukoc. Biol.,
October 1, 2002;
72(4):
735 - 742.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. A. Ansari, A. E. Mayne, J. B. Sundstrom, P. Bostik, B. Grimm, J. D. Altman, and F. Villinger
Administration of Recombinant Rhesus Interleukin-12 during Acute Simian Immunodeficiency Virus (SIV) Infection Leads to Decreased Viral Loads Associated with Prolonged Survival in SIVmac251-Infected Rhesus Macaques
J. Virol.,
February 15, 2002;
76(4):
1731 - 1743.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Luft, M. Jefford, P. Luetjens, H. Hochrein, K.-A. Masterman, C. Maliszewski, K. Shortman, J. Cebon, and E. Maraskovsky
IL-1{beta} Enhances CD40 Ligand-Mediated Cytokine Secretion by Human Dendritic Cells (DC): A Mechanism for T Cell-Independent DC Activation
J. Immunol.,
January 15, 2002;
168(2):
713 - 722.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Pacanowski, S. Kahi, M. Baillet, P. Lebon, C. Deveau, C. Goujard, L. Meyer, E. Oksenhendler, M. Sinet, and A. Hosmalin
Reduced blood CD123+ (lymphoid) and CD11c+ (myeloid) dendritic cell numbers in primary HIV-1 infection
Blood,
November 15, 2001;
98(10):
3016 - 3021.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Blazevic, S. Jankelevich, S. M. Steinberg, F. Jacobsen, R. Yarchoan, and G. M. Shearer
Highly Active Antiretroviral Therapy in Human Immunodeficiency Virus Type 1-Infected Children: Analysis of Cellular Immune Responses
Clin. Vaccine Immunol.,
September 1, 2001;
8(5):
943 - 948.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. C. Braun, J. M. Wang, E. Lahey, R. L. Rabin, and B. L. Kelsall
Activation of the formyl peptide receptor by the HIV-derived peptide T-20 suppresses interleukin-12 p70 production by human monocytes
Blood,
June 1, 2001;
97(11):
3531 - 3536.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. J. Hewson, J. J. Logie, P. Simmonds, and S. E. M. Howie
A CCR5-Dependent Novel Mechanism for Type 1 HIV gp120 Induced Loss of Macrophage Cell Surface CD4
J. Immunol.,
April 15, 2001;
166(8):
4835 - 4842.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. M. Leutenegger, F. S. Boretti, C. N. Mislin, J. N. Flynn, M. Schroff, A. Habel, C. Junghans, S. A. Koenig-Merediz, B. Sigrist, A. Aubert, et al.
Immunization of Cats against Feline Immunodeficiency Virus (FIV) Infection by Using Minimalistic Immunogenic Defined Gene Expression Vector Vaccines Expressing FIV gp140 Alone or with Feline Interleukin-12 (IL-12), IL-16, or a CpG Motif
J. Virol.,
November 15, 2000;
74(22):
10447 - 10457.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
R. S. Kornbluth
The emerging role of CD40 ligand in HIV infection
J. Leukoc. Biol.,
September 1, 2000;
68(3):
373 - 382.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
X. Ma and L. J. Montaner
Proinflammatory response and IL-12 expression in HIV-1 infection
J. Leukoc. Biol.,
September 1, 2000;
68(3):
383 - 390.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Naniche, A. Yeh, D. Eto, M. Manchester, R. M. Friedman, and M. B. A. Oldstone
Evasion of Host Defenses by Measles Virus: Wild-Type Measles Virus Infection Interferes with Induction of Alpha/Beta Interferon Production
J. Virol.,
August 15, 2000;
74(16):
7478 - 7484.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
M. De Brabander
HIV-associated dysfunction of in vitro IL-12 production depends on the nature of the stimulus and on the CD4 T-cell count of the patient
Blood,
March 15, 2000;
95(6):
2185 - 2187.
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION