|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 3 (August 1), 1999:
pp. 875-883
Loss of CCR2 Expression and Functional Response to Monocyte Chemotactic
Protein (MCP-1) During the Differentiation of Human Monocytes: Role of
Secreted MCP-1 in the Regulation of the Chemotactic Response
By
Laura Fantuzzi,
Paola Borghi,
Veniero Ciolli,
George Pavlakis,
Filippo Belardelli, and
Sandra Gessani
From the Laboratory of Virology, Istituto Superiore di Sanità,
Rome; Drug Discovery Department, Istituto di Ricerca Cesare Serono,
Ardea, Italy; and the Human Retrovirus Section, National Cancer
Institute-Frederick Cancer Research and Development Center, ABL-Basic
Program, Frederick, MD.
 |
ABSTRACT |
Human peripheral blood monocytes differentiate into macrophages when
cultured in vitro for a few days. In the present study, we investigated
the expression of C-C chemokine and CXCR4 receptors in monocytes at
different stages of differentiation. Culturing of monocytes for 7 days
resulted in a progressive decrease of the mRNA that encodes for CCR2
and CCR3, whereas the expression of mRNA for other chemokine receptors
(CCR1, CCR4, CCR5, and CXCR4) was not substantially affected. The loss
of CCR2 mRNA expression in 7-day-cultured macrophages was associated
with a strong reduction in the receptor expression at the plasma
membrane, as well as in the monocyte chemotactic protein (MCP-1)
binding, as compared with freshly isolated monocytes. Furthermore, the
biologic response to MCP-1, as measured by intracellular calcium ions
increase and chemotactic response, was lost in 7-day-cultured
macrophages. Differentiation of monocytes into macrophages also
resulted in an increased secretion of MCP-1 that, at least in part, was
responsible for the downmodulation of its receptor (CCR2). The loss of
CCR2 expression and the parallel increase of MCP-1 secretion triggered by differentiation may represent a feedback mechanism in the regulation of the chemotactic response of monocytes/macrophages.
© 1999 by The American Society of Hematology.
 |
INTRODUCTION |
HUMAN PERIPHERAL BLOOD monocytes mature
in different types of tissue histiocytes when they migrate from the
bloodstream to various tissues. This differentiation is essential for
their functional competence and is probably triggered by environmental signals. In vitro cultivation of blood monocytes results in their adherence to the plastic surface and in the initiation of a series of
functional changes that closely resemble their in vivo maturation to
macrophages.1-4 Recruitment of monocytes from the blood
compartment into tissues is an important process in the inflammatory
response and immunity.5 The recruitment of monocytes to
inflammatory foci is a 2-step process. The cells first adhere to the
vascular endothelium, then they migrate to sites of inflammation in
response to specific chemoattractants.
Directional migration of monocytes is regulated by locally produced
cell-secreted proteins, bacterial peptides and products of phospholipid
metabolism.6,7 In the past few years, a new superfamily of
low-molecular-weight chemotactic proteins has been described.5-10 A common feature of these molecules is the
presence of 4 conserved cysteine residues.5,8-12 According
to the space of the first 2 cysteines, chemokines can be grouped in 2 main subfamilies: the C-X-C (or ) chemokines and the C-C (or )
chemokines.5,7,11-13 New chemokine families have been
recently identified, which maintain overall sequence homology, but lack
the typical cysteine distribution (C, or , and CX3C, or ,
chemokines).8,10 The chemokines are primarily active on
neutrophils, but some activity has also been reported on T
lymphocytes.9,10,13 On the other hand, the chemokines
exhibit a wider spectrum of action, in that they are active on multiple
leukocyte populations, including monocytes, granulocytes, T and B
lymphocytes, and natural killer (NK) and dendritic
cells.9,12,13 Lymphotactin, the only chemokine described thus far, exerts its action on T lymphocytes and NK cells,10,14 whereas fractalkine is active on T cells and
monocytes.8 Chemokines activate their functions through
interaction with a family of rhodopsin-like guanosine triphosphate
(GTP)-binding protein-coupled 7-transmembrane domain
receptors.5,15-18 To date, 8 receptors have been defined
for the chemokines (CCR1 to 8) and 5 for the chemokines (CXCR1
to 5), together with several putative CC or CXC receptors for which the
ligands remain to be determined.5
The CC chemokine monocyte chemotactic protein 1 (MCP-1) was originally
described as a potent chemoattractant for monocytes.19 MCP-1 is produced by a variety of cell types, including endothelial cells and cells of the monocytic lineage in response to different signals (typically tumor necrosis factor-alpha [TNF- ],
interleukin-1 [IL-1], interferon- [IFN- ], bacterial
lipopolysaccharide [LPS], platelet-derived growth
factor, and oxidized low-density lipoproteins).20-22 Many
activities have been subsequently assigned to this protein, including
induction of mononuclear phagocytes, basophils, T- and NK-cell
migration,12,23 suppression of tumor growth in animal models,24 and neutralization of human immunodeficiency
virus type 1 (HIV-1).25-27 MCP-1 exerts its action mostly
through the interaction with CCR2, a chemokine receptor that is present
in 2 isoforms, named a and b.28-30 The 2 isoforms represent
alternatively spliced variants of a single MCP-1 receptor gene that
differ only in their carboxyl tails.29,30 The biologic
significance of the existence of 2 CCR2 variants has not yet been
elucidated.29,30 CCR2 gene expression is highly regulated.
In fact, it has been previously described that the expression of CCR2
in primary monocytes can be inhibited by bacterial LPS and other
microbial agents.31 Moreover, cytokines have also been
shown to modulate either negatively (IFN- , TNF- , and IL-1) or
positively (IL-2 and IL-10) the expression of this
receptor.32,33
In this study, we investigated the expression of -chemokine
receptors during the differentiation of human peripheral blood monocytes to macrophages. Our results indicate that CCR2, the major
receptor for MCP-1, is progressively downmodulated when freshly
isolated monocytes are maintained in vitro for a few days. The
inhibition of CCR2 mRNA expression is associated with a parallel reduction in the expression of receptors at the plasma membrane, as
well as in the binding of and biologic response to MCP-1. These findings may reflect the differences in the chemotactic response of
monocytes versus macrophages and provide further evidence that CCR2/MCP-1 interactions represent important events in the functional regulation of these cells.
 |
MATERIALS AND METHODS |
Isolation and culture of peripheral blood monocytes.
PBMC were obtained from 18- to 40-year-old healthy men as previously
described.4 Monocytes were separated from lymphocytes by
Percoll gradient centrifugation.34 Cells were then cultured in endotoxin-free Iscove's medium containing 15% fetal calf serum (FCS; 0.22 µm filtered) for 24 hours (defined here as day 1 freshly isolated monocytes) or 7 days (7-day-cultured macrophages). Some monocytes were used immediately after isolation to avoid their adherence to plastic (defined here as day 0 monocytes). After different
times of culture, both adherent and nonadherent cells were recovered
and analyzed as described elsewhere.4 Cytochemical (ie,
sodium fluoride-inhibited esterase activity) and surface marker (ie,
CD14 antigen) analysis showed that Percoll-purified, as
well as adherent cell populations, consisted of greater than 96%
monocytes. Monocyte preparations that exhibited less than 95%
CD14+ cells have always been discarded.
Chemokines and reagents.
Human recombinant MCP-1, RANTES, and polyclonal antibody to MCP-1 were
purchased from Pepro Tech EC (London, UK). Phycoerythrin (PE)-conjugated mouse anti-human monoclonal antibodies to CCR5 (clone
2D7) and CXCR4 (clone 12G5) were purchased from PharMingen (San Diego,
CA). Monoclonal anti-human CCR2 antibody (clone 48607.121) was obtained
from R&D Systems (Minneapolis, MN). Human recombinant [125I]-MCP-1 and [125I]-RANTES were
purchased from NEN Life Science Products (Boston, MA). FMLP was
obtained from Nova Biochem (Laufelfingen, Switzerland). Control IgG2a
and IgG1k isotypes were obtained from Becton Dickinson (San Jose, CA)
and Dako (Glostrup, Denmark), respectively. Antibody to transferrin
receptor (CD71) was purchased from Dako. Fluorescein isothiocyanate
(FITC) goat anti-mouse IgG antibody was purchased from Sigma (St Louis, MO).
Analysis of chemokine receptors mRNA.
For the RNase protection assay, total RNA was extracted by the method
of Chirgwin et al.35 For C-C chemokine receptors mRNA analysis, 5 µg of total RNA was hybridized to a radiolabeled
multiprobe produced by an in vitro transcription kit (PharMingen) as
indicated in the manufacturer's instructions. For RNA quantification,
the amount of mRNA corresponding to CCR1, CCR2a, CCR2b, and CCR5
present in each sample was normalized to the control
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using a densitometer
(UltroScan XL; Pharmacia LKB, Milwaukee, WI). Values are given as
chemokine receptor/GAPDH mRNA ratio.
For the RNA-polymerase chain reaction (PCR) assay, total RNA was
reverse-transcribed as previously described.4 A 1:10
dilution of the cDNA product was amplified in a 20-µL reaction that
contained 0.1 µg of 32P-labeled sense primer and the same
amount of antisense primer and 0.5 U of Taq Polymerase (Perkin Elmer,
Foster City, CA). PCR amplification was performed for 30 cycles of 45 seconds at 94°C, 1 minute at 60°C, and 2 minutes at 72°C.
PCR products were separated on 5% polyacrylamide gel. The sequence of
the primers were as follows: porphobilinogen deaminase (PBGD) sense
5'CTGCAACGGCGGAAGAAA; antisense 5'GGCATGTTCAAGCTCCTTGG;
CCR1 sense 5'CTTCCCTTCTGGATCGACTAC; antisense
5'AAGAGGTTCAGTTTCAGAGCCT; CCR2 (A + B) sense
5'ATTCACAGGGCTGTATCAC; antisense 5' GTGGAAAATAAGGGCCACAGAC;
CCR3 sense 5'CAGTGCTCTTTACCCAGAGGATAC; antisense
5'TTGGTCCCTCCTCTTTAGG; CCR4 sense 5'ATGGTCAGTGGCTGTGTTCG; antisense 5'TGGATGGCATAGTCCAAGTATC; CCR5 sense 5'
TTCTCTTCTGGGCTCCCTACA; antisense 5'GGAAGAAGACTAAGAGGTAGTT;
CXCR4 sense 5'CTATGCAAGGCAGTCCATGT; antisense
5'AGGCAGCCAACAGGCGAAGA.
Flouresence-activated cell sorter analysis of chemokine receptors.
A quantity of 5 × 105 cells was washed with
Ca2+-and Mg2+-free phosphate-buffered saline
(PBS) that contained 10% human AB serum (Flow Laboratories, McLean,
VA). Cells were incubated for 20 minutes at 4°C in
Ca2+- and Mg2+-free PBS 10% human AB serum in
the presence of an appropriate dilution of PE-conjugated anti-CCR5
(1:20) and anti-CXCR4 (1:20) antibodies or FITC-conjugated anti-CD71
(1:10) or unlabeled anti-CCR2 antibodies (1:20). For direct
immunofluorescence studies, cells were then washed with
Ca2+- and Mg2+-free PBS 1% human AB serum and
fixed in 1% formaldehyde. For indirect fluorescence studies, cells
were further incubated for 20 minutes at 4°C with the appropriate
secondary antibody and processed as described earlier. To evaluate the
level of nonspecific binding, cells were incubated with IgG2a or IgG1k
control monoclonal antibodies. Samples were analyzed by
fluorescence-activated cell sorting (FACS) on a FACSort (Becton
Dickinson) using the Lysis software (Becton Dickinson).
For each determination, 10,000 cells were analyzed.
Receptor binding assays.
For MCP-1 and RANTES binding studies, 1 × 106 cells
were incubated for 2 hours at 4°C with 0.25 nmol/L
125I-MCP-1 or 0.1 nmol/L 125I-RANTES (specific
activity, 2,200 Ci/mmol) in the presence of a 200-fold excess of
unlabeled chemokines as previously described.36
Migration assay.
Cell migration was evaluated using a chemotaxis microchamber
technique37 as previously described.34 A
25-µL quantity of chemoattractant diluted in Iscove's medium with
1% FCS was loaded in the lower compartment of the chemotaxis chamber
(Neuroprobe, Pleasanton, CA). A polycarbonate filter (5-µm pore size;
Neuroprobe) was used to separate the 2 compartments. A 50-µL quantity
of monocytes suspension (1 × 106) was seeded in the
upper chamber. The chamber was incubated at 37°C in air with 5%
CO2 for 90 minutes. At the end of incubation, filters were
removed, fixed, and stained with Diff-Quick (Baxter S.p.A., Rome,
Italy) and 5 high-power oil-immersion fields were counted.
Measurement of intracellular Ca2+ concentration.
Changes in the [Ca2+]i were monitored using the
fluorescent probe Indo-1 (Molecular Probes, Eugene OR) in PBS as
described elsewhere.34 Samples were analyzed in a
spectrophotometer (Perkin Elmer LS-50B) continuously stirred at
37°C.
MCP-1 titration.
MCP-1 released in the culture medium was measured by enzyme-linked
immunosorbent assay (ELISA; R&D Systems; detection limit, 5 pg/mL).
Statistical analysis.
Statistical analysis of data was performed by using parametric
(analysis of variance) and nonparametric (Kruskall-Wallis) tests. A
P value less than .05 was considered significant.
 |
RESULTS |
In a first set of experiments, we analyzed the expression of a panel of
chemokine receptor mRNA in monocytes at different stages of
differentiation by a sensitive radioactive RNA-PCR assay. As shown in
Fig 1A, freshly isolated monocytes
expressed mRNA for all the receptors investigated. Although the
expression of the majority of these transcripts remained constant with
time in culture, a significant decrease in the expression of CCR2 mRNA expression was already observed after 3 days with virtually no detectable expression at day 7. Likewise, the accumulation of CCR3 mRNA
was also markedly decreased at day 7, even though with a slower
kinetics than that observed for CCR2 mRNA. To better quantify
differences in the steady-state levels of chemokine receptor mRNA, the
expression of these transcripts was analyzed by a multiprobe RNase
protection assay system. Although this method allows a more precise
quantification of the mRNA level, its detection limit is lower than
RNA-PCR, and thus does not allow the detection of low-abundance mRNA.
As shown in Fig 1B, by using a multiprobe specific for -chemokine
receptor mRNA, the expression of CCR1, CCR2 (isoform a and b), and CCR5
was clearly detected in RNA samples from day 1 monocytes. In contrast,
CCR3 and CCR4 mRNA were not visible under the same conditions, which
suggests a low level of expression of these transcripts. In particular,
as shown in Fig 1B and C, CCR2 mRNA that corresponded to the a and b
isoforms were expressed in day 1 monocytes. An apparent loss in the
expression of the b isoform was observed after 7 days of in vitro
culture, whereas expression of the a isoform was not significantly
modulated. The lack of expression of the CCR2b mRNA, as well as the
maintenance of the CCR2a mRNA levels in 7-day-cultured macrophages, is
better appreciated in Fig 1C, which shows a longer exposure of the gel in the region that corresponds to the CCR2 isoforms. The expression of
other transcripts (CCR1, CCR5, and CXCR4) was generally not affected,
even though a slight reduction in the CCR5 and CXCR4 mRNA levels at day
7 was occasionally found in some donors (data not shown). The
densitometric analysis of the autoradiography shown in Fig 1B revealed
that the steady-state levels of CCR2b mRNA were strongly decreased
(CCR2b/GAPDH day 1, 1.33; day 7: no detectable CCR2b signal) during
monocyte differentiation. No significant changes were detected in the
steady-state levels of mRNA encoding CCR1 (CCR1/GAPDH day 1, 1.55; day
7, 2.5), CCR2a (CCR2a/GAPDH day 1, 0.44; day 7, 0.67) and CCR5
(CCR5/GAPDH day 1, 3.22; day 7, 3.51). To investigate whether the
strong reduction in the CCR2 mRNA accumulation observed during monocyte
differentiation was associated with a parallel decrease of the
corresponding protein, we monitored the expression of this receptor at
the cell surface. The expression of CCR2, CCR5, CXCR4, and
CD71 was examined by FACS analysis (Fig
2). In the same experiments, the expression of CD71 was monitored as control for monocyte
differentiation.1-4 As expected, the expression of this
differentiation marker was progressively increased with time in
culture, thus confirming a time-dependent differentiation of monocytes
into macrophages. CCR2 was expressed at the cell surface in day 0 monocytes (ie, before cell seeding). A marked decrease in expression of
CCR2 occurred within 24 hours of culture, with undetectable
expression at day 7 (Fig 2). CXCR4 was expressed at comparable level in
day 0 and day 1 monocytes, but it became undetectable at day 7. In contrast, CCR5 was not expressed in day 0 monocytes, but a marked expression occurred within 24 hours of culture. The expression of this
receptor was not maintained with time in culture and a significant
reduction was observed at day 7. Similar results were obtained using
monocytes/macrophages from 3 different donors.

View larger version (50K):
[in this window]
[in a new window]
| Fig 1.
Expression of chemokine receptors during monocyte
differentiation. (A) RNA-PCR assay; 1 µg of total RNA extracted from
monocytes at different stages of differentiation (day 1, 3, and 7) was
retrotranscribed and amplified as described in Materials and Methods.
Porphobilinogen deaminase was used as internal control.
Results are representative of 4 independent experiments. (B,C) RNase
protection assay; 5 µg of total RNA extracted after 1 and 7 days of
monocytes culture was hybridized to the hCR5 multiprobe (P) as
described in Materials and Methods. Autoradiographs were exposed for 24 hours (B) or 4 days (C) to better visualize the CCR2 mRNA isoforms.
Representative results from 6 independent experiments are shown.
|
|

View larger version (21K):
[in this window]
[in a new window]
| Fig 2.
Surface expression of CCR2, CCR5, CXCR4, and CD71 in
monocytes at different stages of differentiation. Monocytes (day 0, 1, and 7) were directly or indirectly stained with specific antibodies and
analyzed by FACS. The immunofluorescence profile obtained for each
antibody was compared with that of its corresponding control and the
result is shown as an open curve. The level of expression of each
surface antigen is calculated by differences between the level of
staining with a specific antibody and the baseline of the control
antibody. Similar profiles were obtained with 3 different donors.
|
|
MCP-1 binds CCR2 at high affinity and represents its major ligand in
monocyte.28 Therefore, we examined the binding of
125I-MCP-1 to freshly isolated monocytes before adherence
(day 0) and 24 hours after adherence (day 1), as well as to
7-day-cultured macrophages. As shown in Fig
3A, the specific binding of
125I-MCP-1 was significantly decreased in 3 of 4 donors
after 24 hours of culture as compared with freshly isolated monocytes
(day 0), while no specific binding was detected in 7-day-cultured
macrophages from all donors. To investigate whether monocyte
differentiation was associated with a generalized reduction in the
binding of other chemokines, we examined the binding of
125I-RANTES to monocytes from the same donors used for
MCP-1 binding studies. This chemokine was chosen among others since it
binds to a variety of chemokine receptors but not to CCR2. As shown in
Fig 3B, the specific binding of 125I-RANTES was
significantly increased to a variable extent in 7-day-cultured macrophages as compared with freshly isolated monocytes (day 0 and day
1).

View larger version (19K):
[in this window]
[in a new window]
| Fig 3.
Specific binding of 125I-MCP-1 and
125I-RANTES to monocytes/macrophages at different stages of
differentiation. Cells from 4 different donors (1 × 106)
were incubated with 0.25 nmol/L 125I-MCP-1 (A) or 0.1 nmol/L 125I-RANTES (B). After incubation for 2 hours at
4°C, cell pellets were extensively washed and the radioactivity was
measured in a counter. Specific binding was defined as the
differences between total binding and nonspecific binding in the
presence of a 200-fold excess of unlabeled chemokines; nonspecific
binding never exceeded 20% of total binding. Each point represents the
average of duplicate measurements. Statistical analysis showed that the
differences in the binding of MCP-1 and RANTES observed in monocytes at
different stages of differentiation were statistically significant
(1-way analysis of variance P = .009 for MCP-1 and P
= .0397 for RANTES; Kruskall-Wallis test P = .0125 for
MCP-1 and P = .0097 for RANTES).
|
|
To investigate the functional relevance of the downmodulation of CCR2
receptor expression, we performed experiments aimed to establish
whether early or late steps in the responsiveness to MCP-1 were
modified during monocyte differentiation. In a first series of
experiments, we measured the effect of MCP-1 on the concentration of
calcium ions ([Ca2+]i). Thus, monocytes were preloaded
with the fluorescent calcium-sensitive probe indo-2, and changes in
fluorescence were monitored by fluorimetry. As shown in
Fig 4A, the addition of MCP-1 to day 1 monocytes induced a rapid (50 seconds) and transient (1.4 minute)
increase in cytosolic [Ca2+]i. In contrast, no induction
of intracellular [Ca2+]i was detected in 7-day-cultured
macrophages. As shown in Fig 4B, where the average values from 3 independent experiments were illustrated, the maximum
[Ca2+]i value measured in day 0 monocytes was 345 ± 36 nmol/L. Twenty-four hours later (day 1 monocytes), this
value was already decreased to 159 ± 59 nmol/L and became almost
undetectable at day 7 (65 ± 8 nmol/L). However, under the same
experimental conditions, FMLP caused a high increase in the
[Ca2+]i independently of the differentiation stages of
monocytes/macrophages. Notably, 7-day-cultured macrophages responded
to RANTES treatment to a greater extent than day 0 monocytes (168 ± 37 nmol/L v 50 ± 12 nmol/L). As expected,
7-day-cultured macrophages exhibited a loss of chemotactic response to
MCP-1. In particular, the addition of MCP-1 to freshly isolated
monocytes (1 and 24 hours after adherence) resulted in a consistent
increase (6.5- to 3.3-fold) in the number of migrating cells, whereas
no chemotactic response to MCP-1 was observed in 7-day-cultured
macrophages (data not shown). No significant reduction in the response
to other chemoattractants, such as FMLP and RANTES, was observed in
7-day-cultured macrophages with respect to day 0 and day 1 monocytes
(data not shown).

View larger version (22K):
[in this window]
[in a new window]
| Fig 4.
Effect of MCP-1 on intracellular [Ca2+]i
in differentiating monocytes. Cells (5 × 106/mL) were
incubated with Indo-1 probe (2 µg/mL final) at 37°C for 30 minutes, washed, and exposed in cuvette (1 × 106/mL) to
recombinant MCP-1 (10 ng/mL) or RANTES (10 ng/mL) or FMLP (1 × 10 7 mol/L) in the presence of 1 mmol/L extracellular
Ca2+. One representative experiment of 3 is shown in (A).
(B) Average values obtained in 3 independent experiments with monocytes
from different donors.
|
|
To define the mechanism(s) involved in the downmodulation of CCR2
observed during monocyte differentiation, we performed experiments aimed to clarify the possible role of endogenous MCP-1. In fact, it is
well known that this chemokine can be produced by mononuclear phagocytes.34,35 The expression of MCP-1 was analyzed by
measuring the amount of protein present in the culture supernatants of
day 1 monocytes and 7-day-cultured macrophages. As shown in Fig
5A, basal levels of MCP-1 were detected in
day 1 monocyte cultures. Despite some variability among donors in the
MCP-1 basal expression, a marked increase in the secretion of this
chemokine was consistently observed in 7-day-cultured macrophages as
compared with day 1 monocytes. No MCP-1 was detected intracellularly in
freshly isolated monocytes (day 0) soon after cell seeding (data not
shown), which indicates that MCP-1 protein expression was probably
induced by adherence. In a second series of experiments, we attempted
to clarify the role of this spontaneous release of MCP-1 in the
downmodulation of CCR2 expression. The binding of
125I-MCP-1 was measured in day 1 monocytes and
7-day-cultured macrophages maintained in the continuous presence of
antibody to MCP-1. Figure 5B shows the mean value of results obtained
with monocytes from 4 different donors. The results of these
experiments indicated that neutralization of endogenous MCP-1
significantly reduced the spontaneous decrease of MCP-1 binding
observed in day 1 monocytes. A slight increase in MCP-1 binding was
also observed in 7-day-cultured macrophages maintained in the presence
of antibody to MCP-1 with respect to control untreated cultures. These
results suggest that, at least at early times of culture, endogenous
MCP-1 can play a role in the downmodulation of CCR2 expression on the
cell membrane.

View larger version (22K):
[in this window]
[in a new window]
| Fig 5.
Secretion of MCP-1 by monocytes/macrophages and its role
in the downmodulation of MCP-1-specific binding sites. (A) Secretion
of MCP-1 during monocytes differentiation. MCP-1 was measured by ELISA
in the culture supernatants of freshly isolated monocytes (day 1) and
7-day-cultured macrophages. Results obtained with 3 different donors
are shown. (B) Effect of antibody to MCP-1 on the specific binding of
125I-MCP-1 to differentiating monocytes. Cells from 4 different donors were cultured in the presence ( ) or in the absence
( ) of polyclonal antibody to MCP-1 (5 µg/mL) for 1 or 7 days,
extensively washed to remove the unbound antibody, and processed for
binding studies as described in Fig 3. The mean percentage values
(±SD) versus day 0 MCP-1 specific binding are shown. Statistical
analysis showed that the differences in the binding of MCP-1 in
monocytes cultured in the presence of antibody to MCP-1 were
statistically significant (2-way analysis of variance P = .0194) with respect to untreated control cultures.
|
|
 |
DISCUSSION |
The regulated interaction of chemokines with their respective receptors
is thought to mediate the controlled recruitment of specific
subpopulations required during host defense and
inflammation.37,38 The specific biologic
functions of chemokines and their receptors have been difficult to
predict, since most receptors recognize more than 1 chemokine, and
several chemokines bind to more than 1 receptor in vitro. Among the
-chemokine receptors, CCR2 appears to be rather specific for ligands
that belong to the MCP family. Even though MCP-1 binds only CCR2 with
high affinity, CCR2 also serves as receptor for MCP-1, MCP-3, and
MCP-5.39-41 The analysis of CCR2 /
mutant mice has been useful for determining some of its specific physiologic functions. These studies clearly demonstrated that this
receptor exhibits a nonredundant function as a major mediator of
macrophage recruitment and trafficking and host defense to bacterial
infections.42-44 The chemokine ligand MCP-1 is a potent in
vitro monocyte activator that is abundantly expressed in a number of
pathologic conditions characterized by monocytic
infiltration.45 In spite of the existence of many C-C
chemokines that attract monocytes in vitro, it has been recently
demonstrated that loss of MCP-1 alone by targeted gene disruption is
sufficient to impair monocyte trafficking in several inflammation
models.46
In this study, we have reported that monocyte differentiation results
in a marked downmodulation in the expression of CCR2 and CCR3 mRNA.
Some changes in the expression of CCR2 and CCR3 mRNA during the
spontaneous differentiation of human peripheral blood monocytes have
been reported by Di Marzio et al.47 However, no studies on
the possible biologic relevance of this phenomenon have yet been
published. In contrast to CCR2 and CCR3 mRNA, the expression of
transcripts codifying other chemokine receptors (CCR1, CCR4, CCR5, and
CXCR4) was not substantially affected during monocyte differentiation.
In this regard, recent results have shown that monocyte differentiation
is associated with a differential expression of some chemokine
receptors that may contribute to the selectivity of these cells to HIV
entry.47-49 In particular, it has been reported that
differentiation of monocytes to macrophages results in a significant
increase in the number of cells that express CCR5.48 In
parallel, a progressive decrease in the expression of CXCR4 at the
plasma membrane was also observed.47-49 In agreement with
these results, we found that CXCR4 expression at the plasma membrane
decreases with time in culture, but we failed to detect any significant
increase in the surface expression of CCR5 in 7-day-cultured
macrophages with respect to day 1 monocytes. In fact, CCR5 was not
expressed in day 0 monocytes, but a marked expression occurred within
24 hours of culture, likely due to adherence activation. However, the
expression of this receptor was not maintained with time in culture and
a significant reduction was observed after 7 days of culture. In
addition, treatment of monocytes with IL-10 resulted in a marked
increase in the expression of CCR5 at the plasma membrane (data not
shown) in agreement with previously published results,33
which indicates that the expression of CCR5 can be up-modulated
following an appropriate stimulation. The apparent discrepancy between
our results and those published by other groups47-49 can
likely be explained by differences in the method of monocyte
preparation. In particular, in these studies, monocytes were purified
by plastic adherence,47 elutriation,49 or
Percoll gradient followed by culture in the presence of
granulocyte-macrophage colony-stimulating factor
(GM-CSF).48 It is well known that the methods used for
monocytes/macrophages separation and culture may have variable effects
on cell functions and/or result in the isolation of different cell
subpopulations.50 Moreover, the method of isolation of
monocytes/macrophages has been shown to have effects on the levels of
expression of certain cell surface molecules.51,52 Thus, it
is not unexpected that the chosen method of separation can influence
subsequent results about physiology and biochemistry of
monocytes/macrophages.
The most important finding reported in this work is the progressive
loss of functional MCP-1 receptors at the cell surface of monocytes
differentiating into macrophages. The downmodulation of CCR2 mRNA was
associated with a strong reduction in the receptor expression at the
plasma membrane and MCP-1-specific binding. Of interest, the biologic
response to MCP-1, as measured by intracellular calcium ions increase
and MCP-1-induced chemotaxis, was totally lost in differentiated
macrophages. Notably, neither RANTES-specific binding nor biologic
response to RANTES or FMLP was affected. In this study, we have also
provided evidence that monocyte differentiation results in a consistent
increase in the secretion of MCP-1 that is likely triggered by
adherence. In this regard, it is worth mentioning that, in spite of a
consistent expression of MCP-1 mRNA in freshly isolated monocytes
before plastic adherence, we failed to detect any intracellular MCP-1
(data not shown). These results would suggest that monocytes are
"committed" to produce MCP-1, but an additional signal is
required to trigger protein synthesis and secretion. In contrast with
our results, Gruss et al reported a reduction in the production of
MCP-1 during monocyte differentiation.53 This discrepancy
can at least in part be explained by the fact that monocytes were
cultured in Teflon (Heraeus, Germany) bags that allows
monocyte cultivation under loosely adherent conditions.
Neutralization of MCP-1, spontaneously produced during in vitro culture
of monocytes, reduces the initial downmodulation of CCR2 receptors at
the plasma membrane in day 1 monocytes, but only marginally in
differentiated macrophages, which suggests that, at least at early
stages of differentiation, macrophage-derived MCP-1 plays a role in the
down-regulation of CCR2 expression at the cell surface. However, in
this regard, it is worth noting that the loss of CCR2 mRNA expression
in cultured monocytes is likely due to cellular events linked to the
macrophage differentiation process itself and cannot be simply
explained by a ligand-induced down-regulation of CCR2 receptors. This
conclusion is also supported by the finding that the MCP-1
neutralization by specific antibodies does not affect the levels of
CCR2 mRNA in monocytes/macrophages cultured for 1 to 7 days in vitro
(data not shown).
Taking into account the ensemble of our results, as well as data from
the literature, we can envisage the following multistep scenario: (1)
peripheral blood circulating monocytes express high levels of CCR2
receptors that are activated by chemoattractant stimuli released at
inflammatory sites; (2) monocytes recruitment and subsequent adhesion
to vascular endothelium induce an initial downmodulation of CCR2
receptors and a concomitant enhancement of MCP-1 production, while at
the same time, adherence also triggers monocyte differentiation; (3)
monocyte differentiation further results in a CCR2 downmodulation,
which is likely due to both an increased release of MCP-1
(ligand-induced downmodulation of receptor expression) and a
differentiation dependent shut-down of CCR2 mRNA; (4) the disappearance
of CCR2 in differentiated macrophage results in the unresponsiveness of
these cells to MCP-1, which provides an efficient regulatory system for
controlling the extent of macrophage recruitment and activation. Thus,
the inhibition of CCR2 expression and the parallel increase of MCP-1 secretion triggered by differentiation may represent novel feedback mechanisms in the regulation of the chemotactic response of these cells.
 |
ACKNOWLEDGMENT |
We are indebted to Sabrina Tocchio for excellent editorial assistance
and to Roberto Gilardi for preparing drawings. We are grateful to Lucia
Gabriele, Mauro Biffoni, and Robert Balderas for technical advice and
helpful discussion. We thank Alberto Mantovani, Carlo Federico Perno,
and Monica Napolitano for helpful discussion and suggestions. We are
indebted to Istituto di Ricerca Cesare Serono for technological
resources utilization.
 |
FOOTNOTES |
Submitted November 10, 1998; accepted April 1, 1999.
Supported by grants from the Italian Ministry of Health (no. 40B/H and
40B/D, The National Research Program on AIDS, 1998). L.F. was the
holder of a fellowship on AIDS research from the Italian Ministry of Health.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Sandra Gessani, PhD,
Laboratory of Virology, Istituto Superiore di Sanità, Viale
Regina Elena, 299-00161 Rome, Italy; e-mail:
gessani{at}virus1.net.iss.it.
 |
REFERENCES |
1.
Musson RA:
Human serum induces maturation of human monocytes in vitro. Changes in cytolytic activity, intracellular lysosomal enzymes, and nonspecific esterase activity.
Am J Pathol
111:331, 1983[Abstract]
2.
Andreesen R, Osterholz J, Bodemann H, Bross KJ, Costabel U, Lohr GW:
Expression of transferrin receptors and intracellular ferritin during terminal differentiation of human monocytes.
Blut
49:195, 1984[Medline]
[Order article via Infotrieve]
3.
Testa U, Conti L, Sposi NM, Varano B, Tritarelli E, Malorni W, Samoggia P, Rainaldi G, Peschle C, Belardelli F, Gessani S:
IFN- selectively down-modulates transferrin receptor expression in human peripheral blood macrophages by a post-translational mechanism.
J Immunol
155:427, 1995[Abstract]
4.
Gessani S, Testa U, Varano B, Di Marzio P, Borghi P, Conti L, Barberi T, Tritarelli E, Martucci R, Seripa D, Peschle C, Belardelli F:
Enhanced production of LPS-induced cytokines during differentiation of human monocytes to macrophages.
J Immunol
151:3758, 1993[Abstract]
5.
Baggiolini M:
Chemokines and leukocyte traffick.
Nature
392:565, 1998[Medline]
[Order article via Infotrieve]
6.
Ben-Baruch A, Michiel DF, Oppenheim JJ:
Signals and receptors involved in the recruitment of inflammatory cells.
J Biol Chem
270:11703, 1995[Free Full Text]
7.
Rollins BJ:
Chemokines.
Blood
90:909, 1997[Free Full Text]
8.
Bazan JF, Bacon KB, Hardiman G, Wang W, Soo K, Rossi D, Greaves DR, Zlotnik A, Schall TJ:
A new class of membrane-bound chemokine with a CX3C motif.
Nature
385:640, 1997[Medline]
[Order article via Infotrieve]
9.
Baggiolini M, Dewald B, Moser B:
Interleukin-8 and related chemotactic cytokines-CXC and CC chemokines.
Adv Immunol
55:99, 1994
10.
Kelner GS, Kennedy J, Bacon KB, Kleyensteuber S, Largaespada DA, Jenkins NA, Copeland NG, Bazan JF, Moore KW, Schall TJ, Zlotnik A:
Lymphotactin: A cytokine that represents a new class of chemokine.
Science
266:1395, 1994[Abstract/Free Full Text]
11.
Miller MD, Krangel MS:
Biology and biochemistry of the chemokines: A family of chemotactic and inflammatory cytokines.
Crit Rev Immunol
12:17, 1992[Medline]
[Order article via Infotrieve]
12.
Mantovani A, Sozzani S, Proost P, Van Damme J:
The monocyte chemoactractant protein family, in
Horuk R
(ed):
Chemoattractant Ligands and Their Receptors. Boca Raton, FL, CRC, 1996, p 169.
13.
Shall TJ:
The chemokines, in
Thomson A
(ed):
The Chemokines Handbook. London, UK, Academic, 1994, p 419.
14.
Bianchi G, Sozzani S, Zlotnik A, Mantovani A, Allavena P:
Migratory response of human NK to lymphotactin.
Eur J Immunol
26:3238, 1996[Medline]
[Order article via Infotrieve]
15.
Murphy PM:
The molecular biology of leukocyte chemoattractant receptors.
Annu Rev Immunol
12:593, 1994[Medline]
[Order article via Infotrieve]
16.
Gerard C, Gerard NP:
C5A anaphylotoxin and its seven transmembrane-segment receptor.
Annu Rev Immunol
12:775, 1994[Medline]
[Order article via Infotrieve]
17.
Mackay CR:
Chemokine receptors and T cell chemotaxis.
J Exp Med
184:799, 1996[Free Full Text]
18.
Yoshida R, Imai T, Hieshima K, Kusuda J, Baba M, Kitaura M, Nishimura M, Kakizaki M, Nomiyama H, Yoshie O:
Molecular cloning of a novel human CC chemokine EBII-ligand that is a specific functional ligand for EBII, CCR7.
J Biol Chem
272:13803, 1997[Abstract/Free Full Text]
19.
Matsushima K, Larsen CG, DuBois GC, Oppenheim JJ:
Purification and characterization of a novel monocyte chemotactic and activating factor produced by a human myelomonocytic cell line.
J Exp Med
169:1485, 1989[Abstract/Free Full Text]
20.
Colotta F, Borrè A, Wang JM, Tattanelli M, Maddalena F, Polentarutti N, Peri G, Mantovani A:
Expression of a monocyte chemotactic cytokine by human mononuclear phagocytes.
J Immunol
148:760, 1992[Abstract]
21.
Sylvester I, Suffredini AF, Boujoukoss AJ, Martich GD, Danner RL, Yoshimura T, Leonard EJ:
Neutrophil attractant protein-A1 and monocyte chemoattractant protein-1 in human serum. Effects of intravenous lipopolysaccharide on free attractants, specific IgG autoantibodies and immune complexes.
J Immunol
151:3292, 1993[Abstract]
22.
Van Damme J, Proost P, Put W, Arens S, Lenaerts JP, Conings R, Opdenakker G, Heremans H, Billiau A:
Induction of monocyte chemotactic proteins MCP-1 and MCP-2 in human fibroblasts and leukocytes by cytokines and cytokine inducers. Chemical synthesis of MCP-2 and development of a specific RIA.
J Immunol
152:5495, 1994[Abstract]
23.
Carr MW, Roth SJ, Luther E, Rose SS, Springer TA:
Monocyte chemoattractant protein-1 acts as a T lymphocyte chemoattractant.
Proc Natl Acad Sci USA
91:3652, 1994[Abstract/Free Full Text]
24.
Flory CM, Jones ML, Warren JS:
Pulmonary granuloma formation in the rat is partially dependent on the monocyte chemoattractant protein-1.
Lab Invest
69:396, 1993[Medline]
[Order article via Infotrieve]
25.
Frade JMR, Llorente M, Medallo M, Alcamì J, Gutierrez-Ramos JC, Zaballos A, del Real G, Martinez AC:
The amino-terminal domain of the CCR2 chemokine receptor acts as a coreceptor for HIV-1 infection.
J Clin Invest
100:497, 1997[Medline]
[Order article via Infotrieve]
26.
Doranz BJ, Rucker J, Yi Y, Smyth RJ, Samson M, Peiper SC, Parmentier M, Collman RG, Doms RW:
A dual-tropic primary HIV-1 isolates that uses fusin and the -chemokine receptors CKR-5, CKR-3, and CKR-2b as fusion cofactors.
Cell
85:1149, 1996[Medline]
[Order article via Infotrieve]
27.
Sozzani S, Introna M, Bernasconi S, Polentarutti N, Cinque P, Poli G, Sica A, Mantovani A:
MCP-1 and CCR2 in HIV infection: Regulation of agonist and receptor expression.
J Leuk Biol
62:30, 1997[Abstract]
28.
Yoshimura T, Leonard EJ:
Identification of high affinity receptors for human monocyte chemoattractant protein-1 on human monocytes.
J Immunol
145:292, 1990[Abstract]
29.
Charo IF, Myers SJ, Herman A, Franci C, Connolly AJ, Coughlin SR:
Molecular cloning and functional expression of two monocyte chemoattractant protein-1 receptors reveals alternative splicing of the carboxyl-terminal tails.
Proc Natl Acad Sci USA
91:2752, 1994[Abstract/Free Full Text]
30.
Wong L-M, Myers SJ, Tsou C-L, Gosling J, Arai H, Charo IF:
Organization and differential expression of the human monocyte chemoattractant protein 1 receptor gene.
J Biol Chem
272:1038, 1997[Abstract/Free Full Text]
31.
Sica A, Saccani A, Borsatti A, Power CA, Wells TNC, Luini W, Polentarutti N, Sozzani S, Mantovani A:
Bacterial lipopolysaccharide rapidly inhibits expression of C-C chemokine receptors in human monocytes.
J Exp Med
185:969, 1997[Abstract/Free Full Text]
32.
Penton-Rol G, Polentarutti N, Luini W, Borsatti A, Mancinelli R, Sica A, Sozzani S, Mantovani A:
Selective inhibition of expression of the chemokine receptor CCR2 in human monocytes by IFN- .
J Immunol
160:3869, 1998[Abstract/Free Full Text]
33.
Sozzani S, Ghezzi S, Iannolo G, Luini W, Borsatti A, Polentarutti N, Sica A, Locati M, Mackay C, Wells TNC, Biswas P, Vicenzi E, Poli G, Mantovani A:
Interleukin 10 increases CCR5 expression and HIV infection in human monocytes.
J Exp Med
187:439, 1998[Abstract/Free Full Text]
34.
Sozzani S, Luini W, Molino M, Jilek P, Bottazzi B, Cerletti C, Matsushima K, Mantovani A:
The signal transduction pathway involved in the migration induced by a monocyte chemotactic cytokine.
J Immunol
147:2215, 1991[Abstract]
35.
Chirgwin JM, Przybyla AE, MacDonald RJ, Rytter WJ:
Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease.
Biochemistry
18:5294, 1979[Medline]
[Order article via Infotrieve]
36.
Fantuzzi L, Eid P, Malorni W, Rainaldi G, Gauzzi MC, Pellegrini S, Belardelli F, Gessani S:
Post-transcriptional up-regulation of the cell surface-associated component of the human type I interferon receptor during differentiation of peripheral blood monocytes: Role in the biological response to type I interferon.
Eur J Immunol
27:1075, 1997[Medline]
[Order article via Infotrieve]
37.
Falk W, Goodwin RH Jr, Leonard EJ:
A 48-well microchemotaxis assembly for rapid and accurate measurement of leukocyte migration.
J Immunol Methods
33:239, 1980[Medline]
[Order article via Infotrieve]
38.
Premack BA, Schall TJ:
Chemokine receptors: Gateways to inflammation and infection.
Nat Med
2:1174, 1996[Medline]
[Order article via Infotrieve]
39.
Combadiere C, Ahuja SK, Van Damme J, Tiffany HL, Gao JL, Murphy PM:
Monocyte chemoattractant protein-3 is a functional ligand for CC chemokine receptors 1 and 2B.
J Biol Chem
270:29671, 1995[Abstract/Free Full Text]
40.
Franci C, Wong LM, Van DJ, Proost P, Charo IF:
Monocyte chemoattractant protein-3, but not monocyte chemoattractant protein-2, is a functional ligand of the human monocyte chemoattractant protein-1 receptor.
J Immunol
154:6511, 1995[Abstract]
41.
Sarafi MN, Garcia-Zepeda EA, MacLean JA, Charo IF, Luster AD:
Murine monocyte chemottractant protein (MCP)-5: A novel CC chemokine that is a structural and functional homologue of human MCP-1.
J Exp Med
185:99, 1997[Abstract/Free Full Text]
42.
Kuziel WA, Morgan SJ, Dawson TC, Griffin S, Smithies O, Ley K, Maeda N:
Severe reduction in leukocyte adhesion and monocyte extravasation in mice deficient in CC chemokine receptor 2.
Proc Natl Acad Sci USA
94:12053, 1997[Abstract/Free Full Text]
43.
Boring L, Goslin J, Chensue SW, Kunkel SL, Farese RV Jr, Broxmeyer H, Charo IF:
Impaired monocyte migration and reduced type 1 (Th1) cytokine responses in C-C chemokine receptor 2 knockout mice.
J Clinic Invest
100:2552, 1997[Medline]
[Order article via Infotrieve]
44.
Kurihara T, Warr G, Loy J, Bravo R:
Defects in macrophage recruitment and host defence in mice lacking the CCR2 chemokine receptor.
J Exp Med
186:1757, 1998[Abstract/Free Full Text]
45.
Rollins BJ:
Monocyte chemoattractant protein 1: A potential regulator of monocyte recruitment oin inflammatory disease.
Mol Med Today
2:198, 1996[Medline]
[Order article via Infotrieve]
46.
Lu B, Rutledge BJ, Gu L, Fiorillo J, Lukacs NW, Kunkel SL, North R, Gerard C, Rollins BJ:
Abnormalities in monocyte recruitment and cytokine expression in monocyte chemoattractant protein 1-deficient mice.
J Exp Med
187:601, 1998[Abstract/Free Full Text]
47.
Di Marzio P, Tse J, Landau NR:
Chemokine receptor regulation and HIV type 1 tropism in Monocytes-macrophages.
AIDS Res Hum Retroviruses
14:129, 1998[Medline]
[Order article via Infotrieve]
48.
Tuttle LD, Harrison JK, Anders C, Sleasman JW, Goodenow MM:
Expression of CCR5 increases during monocyte differentiation and directly mediates macrophage susceptibility to infection by human immunodeficiency virus type 1.
J Virol
72:4962, 1998[Abstract/Free Full Text]
49.
Naif HM, Li S, Alali M, Sloane A, Wu L, Kelly M, Lynch G, Lloyd A, Cunningham AL:
CCR5 expression correlates with susceptibility of maturing monocytes to human immunodeficiency virus type 1 infection.
J Virol
72:830, 1998[Abstract/Free Full Text]
50.
Gessani S, Fantuzzi L, Puddu P, Belardelli F:
Purification of macrophages in Paulnock D (ed): Macrophage Methodology: A Practical Approach. Oxford, UK, Oxford University Press, 1999 (in press)
51.
Stent G, Crowe SM:
Effect of monocyte purification and culture on integrin expression.
APMIS
105:663, 1997[Medline]
[Order article via Infotrieve]
52.
Fearon DT, Collins LA:
Increased expression of C3b receptors on polymorphonuclear monocytes induced by chemotactic factors and by purification procedures.
J Immunol
130:370, 1983[Medline]
[Order article via Infotrieve]
53.
Gruss H-J, Brach MA, Schumann RR, Herrmann F:
Regulation of MCP-1/JE gene expression during monocytic differentiation.
J Immunol
153:4907, 1994[Abstract]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
E. Cassol, L. Cassetta, C. Rizzi, M. Alfano, and G. Poli
M1 and M2a Polarization of Human Monocyte-Derived Macrophages Inhibits HIV-1 Replication by Distinct Mechanisms
J. Immunol.,
May 15, 2009;
182(10):
6237 - 6246.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Hams, C. S. Colmont, V. Dioszeghy, V. J. Hammond, C. A. Fielding, A. S. Williams, M. Tanaka, A. Miyajima, P. R. Taylor, N. Topley, et al.
Oncostatin M Receptor-{beta} Signaling Limits Monocytic Cell Recruitment in Acute Inflammation
J. Immunol.,
August 1, 2008;
181(3):
2174 - 2180.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Arias, G. Jaramillo, Y. P. Lopez, N. Mejia, C. Mejia, A. E. Pantoja, R. J. Shattock, L. F. Garcia, and G. E. Griffin
Mycobacterium tuberculosis Antigens Specifically Modulate CCR2 and MCP-1/CCL2 on Lymphoid Cells from Human Pulmonary Hilar Lymph Nodes
J. Immunol.,
December 15, 2007;
179(12):
8381 - 8391.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Barlic, Y. Zhang, J. F. Foley, and P. M. Murphy
Oxidized Lipid-Driven Chemokine Receptor Switch, CCR2 to CX3CR1, Mediates Adhesion of Human Macrophages to Coronary Artery Smooth Muscle Cells Through a Peroxisome Proliferator-Activated Receptor {gamma}-Dependent Pathway
Circulation,
August 22, 2006;
114(8):
807 - 819.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Stamatovic, R. F. Keep, M. Mostarica-Stojkovic, and A. V. Andjelkovic
CCL2 Regulates Angiogenesis via Activation of Ets-1 Transcription Factor
J. Immunol.,
August 15, 2006;
177(4):
2651 - 2661.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Murdoch, A. Giannoudis, and C. E. Lewis
Mechanisms regulating the recruitment of macrophages into hypoxic areas of tumors and other ischemic tissues
Blood,
October 15, 2004;
104(8):
2224 - 2234.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Chazaud, C. Sonnet, P. Lafuste, G. Bassez, A.-C. Rimaniol, F. Poron, F.-J. Authier, P. A. Dreyfus, and R. K. Gherardi
Satellite cells attract monocytes and use macrophages as a support to escape apoptosis and enhance muscle growth
J. Cell Biol.,
December 8, 2003;
163(5):
1133 - 1143.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A.-S. W. Moller, R. Ovstebo, A.-B. Westvik, G. B. Joo, K.-B. F. Haug, and P. Kierulf
Effects of bacterial cell wall components (PAMPs) on the expression of monocyte chemoattractant protein-1 (MCP-1), macrophage inflammatory protein-1{alpha} (MIP-1{alpha}) and the chemokine receptor CCR2 by purified human blood monocytes
Innate Immunity,
December 1, 2003;
9(6):
349 - 360.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Fantuzzi, F. Spadaro, G. Vallanti, I. Canini, C. Ramoni, E. Vicenzi, F. Belardelli, G. Poli, and S. Gessani
Endogenous CCL2 (monocyte chemotactic protein-1) modulates human immunodeficiency virus type-1 replication and affects cytoskeleton organization in human monocyte-derived macrophages
Blood,
October 1, 2003;
102(7):
2334 - 2337.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Salentin, D. Gemsa, H. Sprenger, and A. Kaufmann
Chemokine receptor expression and chemotactic responsiveness of human monocytes after influenza A virus infection
J. Leukoc. Biol.,
August 1, 2003;
74(2):
252 - 259.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Guo, M. Van Eck, J. Twisk, N. Maeda, G. M. Benson, P. H.E. Groot, and T. J.C. Van Berkel
Transplantation of Monocyte CC-Chemokine Receptor 2-Deficient Bone Marrow Into ApoE3-Leiden Mice Inhibits Atherogenesis
Arterioscler. Thromb. Vasc. Biol.,
March 1, 2003;
23(3):
447 - 453.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. K. Ambati, A. Anand, A. M. Joussen, W. A. Kuziel, A. P. Adamis, and J. Ambati
Sustained Inhibition of Corneal Neovascularization by Genetic Ablation of CCR5
Invest. Ophthalmol. Vis. Sci.,
February 1, 2003;
44(2):
590 - 593.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. A. Dzenko, A. V. Andjelkovic, W. A. Kuziel, and J. S. Pachter
The Chemokine Receptor CCR2 Mediates the Binding and Internalization of Monocyte Chemoattractant Protein-1 along Brain Microvessels
J. Neurosci.,
December 1, 2001;
21(23):
9214 - 9223.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Geminder, O. Sagi-Assif, L. Goldberg, T. Meshel, G. Rechavi, I. P. Witz, and A. Ben-Baruch
A Possible Role for CXCR4 and Its Ligand, the CXC Chemokine Stromal Cell-Derived Factor-1, in the Development of Bone Marrow Metastases in Neuroblastoma
J. Immunol.,
October 15, 2001;
167(8):
4747 - 4757.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-J. ANDERS, V. VIELHAUER, M. KRETZLER, C. D. COHEN, S. SEGERER, B. LUCKOW, L. WELLER, H.-J. GRÖNE, and D. SCHLÖNDORFF
Chemokine and Chemokine Receptor Expression during Initiation and Resolution of Immune Complex Glomerulonephritis
J. Am. Soc. Nephrol.,
May 1, 2001;
12(5):
919 - 931.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
L. Fantuzzi, I. Canini, F. Belardelli, and S. Gessani
HIV-1 gp120 Stimulates the Production of {{beta}}-Chemokines in Human Peripheral Blood Monocytes Through a CD4-Independent Mechanism
J. Immunol.,
May 1, 2001;
166(9):
5381 - 5387.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Kaufmann, R. Salentin, D. Gemsa, and H. Sprenger
Increase of CCR1 and CCR5 expression and enhanced functional response to MIP-1{alpha} during differentiation of human monocytes to macrophages
J. Leukoc. Biol.,
February 1, 2001;
69(2):
248 - 252.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. SEGERER, Y. CUI, K. L. HUDKINS, T. GOODPASTER, F. EITNER, M. MACK, D. SCHLÖNDORFF, and C. E. ALPERS
Expression of the Chemokine Monocyte Chemoattractant Protein-1 and Its Receptor Chemokine Receptor 2 in Human Crescentic Glomerulonephritis
J. Am. Soc. Nephrol.,
December 1, 2000;
11(12):
2231 - 2242.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
L. Fantuzzi, L. Conti, M. C. Gauzzi, P. Eid, M. Del Corno, B. Varano, I. Canini, F. Belardelli, and S. Gessani
Regulation of chemokine/cytokine network during in vitro differentiation and HIV-1 infection of human monocytes: possible importance in the pathogenesis of AIDS
J. Leukoc. Biol.,
September 1, 2000;
68(3):
391 - 399.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Sano, D. K. Hsu, L. Yu, J. R. Apgar, I. Kuwabara, T. Yamanaka, M. Hirashima, and F.-T. Liu
Human Galectin-3 Is a Novel Chemoattractant for Monocytes and Macrophages
J. Immunol.,
August 15, 2000;
165(4):
2156 - 2164.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|