|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 4 (August 15), 1999:
pp. 1254-1260
Dyskeratosis Congenita Caused by a 3' Deletion: Germline and
Somatic Mosaicism in a Female Carrier
By
T.J. Vulliamy,
S.W. Knight,
N.S. Heiss,
O.P. Smith,
A. Poustka,
I. Dokal, and
P.J. Mason
From the Department of Haematology, Imperial College School of
Medicine, Hammersmith Hospital, London, UK; Deutches
Krebsforschungszentrum, Department of Molecular Genome Analysis,
Heidelberg, Germany; and the Department of Paediatric Haematology,
National Childrens Hospital, Dublin, Ireland.
 |
ABSTRACT |
X-linked dyskeratosis congenita (DC) is a bone marrow failure
syndrome caused by mutations in the DKC1 gene located at Xq28. By 20 years of age, most affected boys develop bone marrow failure, whereas female carriers show a skewed pattern of X-chromosome inactivation. The gene product, dyskerin, is homologous to a yeast protein involved in ribosomal RNA biogenesis, providing a unique insight into a cause of aplastic anemia. Whereas most causative mutations are single amino acid substitutions, and nonsense or frameshift mutations have not been observed, we present here a case of
DC caused by a 2-kb deletion that removes the last exon of the gene.
Normal levels of mRNA are produced from the deleted gene, with the
transcripts using a cryptic polyadenylation site in the antisense
strand of the adjacent MPP1 gene, normally located 1 kb
downstream of DKC1 in a tail to tail orientation. The predicted truncated protein lacks a lysine-rich peptide that is less conserved than the rest of the dyskerin molecule and is dispensable in yeast, supporting the contention that it may retain some activity and that
null mutations at this locus may be lethal. The affected boy had an
unaffected brother with the same haplotype around the DKC1 gene
and a sister who was heterozygous for the deletion. We conclude
therefore that the mother must be a germline mosaic with respect to
this deletion. Investigation of her blood cells and other somatic
tissues showed that a small proportion of these cells also carried the
deletion, making her a somatic mosaic and indicating that the deletion
took place early in development.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
A TRIAD OF CLINICAL features define the
phenotype of dyskeratosis congenita (DC): nail dystrophy, leukoplakia,
and skin pigmentation abnormalities.1-3 It has become clear
that bone marrow failure is also commonly associated with the disease and is the principal cause of premature death.4 It seems
that tissues that need continual renewal (skin, nails, and bone marrow) are most affected by the genetic lesion underlying the disorder.
Through a positional cloning strategy, the DKC1 gene
responsible for the X-linked form of DC (MIM 305000) has recently been identified.5 This turns out to be a highly conserved gene, showing 61% protein sequence identity to the yeast centromere binding
factor 5 (Cbf5p6) and 78% identity to the rat
nucleolar-associated protein, NAP57.7 Functional studies
indicate a role for these proteins in rRNA processing, specifically in
the pseudouridylation of rRNA precursors.8 They may also be
involved in centromere/microtubule binding6 or as ribosomal
chaperones.7 It has been suggested, therefore, that DC
represents a human ribosomopathy.9
Five of the original mutations described in the DKC1 gene give
rise either to single amino acid substitutions or a single amino acid
deletion.5 Subsequent mutation analysis has not shown any
frameshift or nonsense mutations (Knight et al9a). The only gross change to the DKC1 gene observed so
far is the 3' end deletion, detected in a single case of DC, that
facilitated the localization of the DKC1 gene in the candidate
region.5 We report here on the characterization of this
deletion and show that transcription of the DKC1 gene in this
individual is rescued by a polyadenylation signal found on the
noncoding strand of the closely neighboring MPP1 gene. We also
demonstrate that the mother of the affected individual is a germline
and somatic mosaic for the mutation.
| |
MATERIALS AND METHODS |
DNA and RNA extraction and Southern blot analysis were performed using
standard techniques. Linkage analysis was performed by the analysis of
radiolabeled polymerase chain reaction (PCR) products on 6%
polyacrylamide gel electrophoresis (PAGE) gels for the
Xq28 markers DXS8061, p39, DXS1073, and DXS1108 using the primer
combinations described at the Genome Database
(http://gdbwww.gdb.org).
The sequences of the primers (from GIBCO-BRL, Paisley, UK)
used for PCR amplification of the DKC1/MPP1 genes from genomic DNA as well as cDNA are shown in Table 1,
and their location and orientation with respect to each gene is shown
in Fig 1. Standard PCR conditions were
employed using a commercially supplied buffer (Advanced
Biotechnologies, Epsom, UK), a magnesium concentration of
2.0 mmol/L, dNTPs at 0.2 mmol/L (Pharmacia, Uppsala,
Sweden), and an annealing temperature of 58°C.
View larger version (9K):
[in this window]
[in a new window]
| Fig 1.
The location of a deletion that removes the last exon of
the DKC1 gene. The upper line shows the last exons of DKC1
and MPP1 genes on the normal chromosome, with the direction
of transcription indicated by the long arrows. The vertical bars show
the position of the breakpoints of the deletion that gives rise to the
deleted chromosome in patient HO, shown on the lower line. The DNA
sequence at these breakpoints is shown. Solid boxes indicate coding
sequences; shaded boxes indicate 3'UTR sequences. The location,
direction, and names of the oligonucleotides used in various PCR
experiments are shown as arrowheads.
|
|
3' RACE PCR was performed as described elsewhere.10
Briefly, first-strand DNA synthesis from total RNA was performed using the primer
(dT)n-R1-R0(5'AAGGATCCGTCGACATCGATAATACGACTCACTATAGGGATTTTTTTTTTTTTTTTT3'). Two rounds of PCR amplification were performed using primers XAP101F1 and the outer adapter primer Ro
(5'AAGGATCCGTCGACATC3') and then the primer 931F and the
inner adapter primer R1
(5'GACATCGATAATACGAC3'). The product of this reaction was
gel purified, cut with the restriction enzymes Pst I and
Cla I, and cloned into M13 before sequencing.
Bubble PCR, a one-sided PCR technique to amplify breakpoints, was
performed as described.11 A duplex bubble oligo that
contains 12 complementary bp at each end and 29 bp of noncomplementary sequence in the middle was obtained by annealing together the oligos
BUB-T
(5'AAGGATCCTAGTCTAGCTGTCTGTCGAAGGTAAGGAACGGACGAGCACTGAG3') and BUB-B
(5'CTCAGTGCTCGTAGTAATCGTTCGCACGAGAATCGCAAGATCTAGGATCCTT3'). A total of 1.5 µg of this oligo was ligated to 5 µg of genomic DNA
that had been digested with Rsa I. After heating to 95°C
for 5 minutes and removing excess oligonucleotide using a gene clean kit (Bio 101 Inc, La Jolla, CA), 2 rounds of PCR were
performed with the primer XAP101F1 and the outer bubble oligo NVAMP-1
(5'TGCTCGTAGTAATCGTTCGCAC3') and then the primer 931F and
the inner bubble oligo NVAMP-2
(5'GTTCGCACGAGAATCGCAAGAT3').
Analysis of the X-chromosome inactivation patterns (XCIP) was performed
using the repeat polymorphism and methylation-sensitive Hpa II
site at the androgen receptor gene locus (HUMARA) as described elsewhere.12,13 Sequencing was performed directly on gel
purified PCR products (Qiagen, Crawley, UK) or on M13 DNA
templates using an ABI automated sequencing machine (ABI, Foster City, CA).
| |
RESULTS |
A partial deletion of DKC1 in patient HO.
During the screening by Southern blot analysis of positional candidate
genes for the DKC1 locus, a deletion affecting the 3' end
of cDNA XAP10114 was identified in 1 affected individual (patient HO) in pedigree DCR-015 (Fig 2A,
lane 3). Through the identification of point mutations in this gene in
other unrelated patients with DC, it was established that these
mutations do indeed cause DC, and the gene was accordingly named
DKC1.5
View larger version (81K):
[in this window]
[in a new window]
| Fig 2.
Southern blot analysis showing the inheritance of a
deletion at the 3' end of the DKC1 gene. (A)
Hybridization of a DKC1 probe 31g1K17 (cDNA nucleotides
744-1565) to Taq I digests of genomic DNA from the following
family members: lane 1, mother of patient HO (I-1); lane 2, sister of
patient HO (II-1); lane 3, patient HO (II-7); lane 4, niece of patient
HO (III-1); and lane 5, nephew of patient HO (III-2). Numbers in
brackets refer to the pedigree in Fig 5. Note that the 1.6-kb fragment
produced by the deletion is not detected in the mother. (B)
Hybridization of an MPP1 probe 39g1B21 (cDNA nucleotides
1117-1822) to Taq I digests of genomic DNA from the following:
lane 1, patient HO; and lane 2, a normal control. Note that both
probes hybridize to fragments of the same size. Two fragments of
coincidental size are seen in the normal sample, 1 of which is deleted
in patient HO.
|
|
To try and establish the extent of this deletion and because the
orientation of the gene in Xq28 was unknown, both available flanking
probes (DXYS64 and MPP1) were hybridized to Southern filters of
the affected individual and a normal control. Although the DXYS64 probe
showed only normal fragments, the cDNA probe 39g1B21, which covers the
last 3 exons of the MPP1 gene (nt 1117-1822), not only showed
an abnormal fragment of the same size as seen with the DKC1
probe in the affected individual, but also normal fragments of the same
size (Fig 2B). This suggested that the DKC1 gene and the
MPP1 gene are located close to one another in a tail to tail
configuration and that the deletion may also affect the 3' end of
the MPP1 gene. A probe to a more central region of the MPP1 cDNA (nt 565-1171) showed only normal fragments in the
affected individual (not shown).
The deletion breakpoints.
The 5' breakpoint of the deletion was established using a bubble
PCR: the bubble oligonucleotide11 was ligated onto an
Rsa I digest of genomic DNA from patient HO. Nested PCR
amplification was performed using oligonucleotides complementary to the
bubble sequence and primers XAP101F11 and 931F from the DKC1
gene. These 2 oligonucleotides were known to be present in the
partially deleted DKC1 gene because a probe that is located
toward the 3' end of the gene (nt 1523-2143) had shown a very
faint deleted restriction fragment in Southern blot analysis of the
patient (not shown). This PCR gave rise to a discrete fragment of
approximately 240 bp. The sequence of this fragment was found to
diverge from the normal DKC1 genomic sequence (Knight et
al9a) 50 bp into the last intron of the gene (Fig
1).
Having seen the coincidental restriction fragments in Southern blots
with probes to the 3' end of the MPP1 and the
DKC1 genes and predicting therefore that the genes lay tail to
tail, a PCR was attempted between the 2 genes in patient HO. Using the
primers 931F and MPAF (located on the sense strand of the MPP1
3'UTR), a fragment of approximately 1 kb was obtained, whereas no
product was seen from a normal control. Sequencing of this fragment
confirmed the 5' breakpoint of the deletion established through
the bubble PCR and showed that the other end of the deletion was 379 bp
downstream of the 3' end of the MPP1 gene (Fig 1). The
sequence at each end of the deletion does not show any evidence of a
repeat apart from sharing a TGG trinucleotide at the breakpoint.
Normal DKC1 and MPP1 are located tail to tail and
separated by only 1 kb.
A new primer (MP3G) was derived from the sequence downstream of the
MPP1 gene, determined from the inter DKC1-MPP1 PCR
product obtained from patient HO. This was used in conjunction with the DKC1 primer 931F on normal genomic DNA in a PCR to show a clear band of approximately 1.8 kb. From this fragment, it was possible to
complete the normal intergenic sequence between the 3' ends of
the DKC1 gene and the MPP1 gene. It is 988 bp in length
and contains a stretch of 25 As. Knowing the normal sequence between MPP1 and DKC1, we can conclude that the deletion in
patient HO has removed 1,931 bp (Fig 1).
The deleted DKC1 gene is transcribed and overlaps
MPP1 at the 3' end.
Insufficient RNA was obtained from the patient's blood sample to
perform Northern blot analysis. We therefore attempted semiquantitative reverse transcriptase-PCR (RT-PCR) of the DKC1
gene from this RNA alongside a normal control sample that had been
processed at the same time and in the same way, using a forward primer
(XAP101F9) that spans an intron and a reverse primer XAP101R9. RT-PCR
was performed for 21, 24, 27, and 30 cycles. Starting from equivalent amounts of cDNA, a fragment of the appropriate size was not seen at 24 cycles, was just visible after 27 cycles, and was clearly visible after
30 cycles in both the normal control and the patient HO
(Fig 3). We conclude that patient HO does
have a DKC1 transcript, which is detectable in peripheral blood
at levels equivalent to normal. A similar experiment using primers for
the MPP1 gene (MPBF and MP3R2) showed that patient HO also
expresses this gene at levels equivalent to normal: a fragment of the
appropriate size was just seen after 24 cycles and became clearly
visible in both normal and patient after 27 cycles of amplification
(Fig 3).
View larger version (61K):
[in this window]
[in a new window]
| Fig 3.
RT-PCR amplification of the DKC1 and MPP1
genes from patient HO (p) and a control sample (c). The number of
PCR cycles is shown. The molecular weight marker (m) is the plasmid
pEMBL8 cut with Taq I and Pvu II.
|
|
3' RACE cloning established the nature of the 3' end of the
DKC1 transcript from the partially deleted gene. Nested
amplification using primers XAP101F11 and 931F for the DKC1
gene gave rise to a fragment of approximately 640 bp. As predicted from
the size of this fragment, as well as from a search for a possible
polyadenylation signal in the genomic sequence downstream of the
DKC1 breakpoint in patient HO, sequence analysis showed that it
overlaps the 3' end of the MPP1 gene
(Fig 4). A perfect polyadenylation signal, 5'AAUAAA3', is found 11 bases from the polyA tail. Thus, as
shown in Fig 4, the 2 genes overlap by 132 bp, which are transcribed from opposite strands to form the 3' ends of the 2 genes.
View larger version (54K):
[in this window]
[in a new window]
| Fig 4.
The sequence of the 3' end of the DKC1 gene
in patient HO. The last 45 nucleotides of the penultimate normal exon
of the DKC1 gene, encoding amino acids 478-492, are shown in
normal type. The nucleotides from the last intron of the DKC1
gene and the amino acids they encode are shown in bold type. The
underlined sequence shows the overlap with the MPP1
3'UTR. The asterisk indicates the position where the polyA
tail is added to the mRNA.
|
|
A truncated dyskerin.
The sequence derived from the deletion in patient HO predicts that the
protein, dyskerin, encoded by his DKC1 gene will be truncated.
Presuming that translation continues in frame beyond the penultimate
exon and into the last intron, a stop codon is encountered after 39 bp
(Fig 4). Twelve new amino acids (VCGNTFRFLGLA) will replace the 22 that
are encoded in the last exon of the normal gene, which includes a
remarkable stretch of eight consecutive lysine residues (DSDTTKKKKKKKKAKEVELVSE).
Family studies.
Patient HO is a sporadic case of DC. He has the classical mucocutaneous
triad of skin pigmentation, nail dystrophy, and leukoplakia. He also
has short stature, microcephaly, hypoplastic testes, and bone marrow
failure (hemoglobin level, 8 g/dL; white blood cell count, 2.9 × 109/L; and platelet count, 20 × 109/L).
Other members of this family, including the proband's mother and sibs,
had normal blood counts. Linkage analysis was performed on family
members before the identification of the molecular lesion in the
DKC1 gene in this family. Informative markers spanning Xq28
(Fig 5) showed that the haplotype of the
affected boy (II:7) was shared by 1 of his sisters (II:1) but not the
other (II:4). The analysis of XCIP, which are consistently skewed in
carriers of X-linked DC,15,16 showed that II:1 did have the
skewed pattern of a carrier (Fig 6, lanes 3 and 4), whereas II:4 did not (Fig 6, lanes 5 and 6), consistent with
the haplotype data. This would imply that the mother, who showed an
incompletely skewed XCIP (Fig 6, lanes 1 and 2), was a carrier of the
disease. However, a sample from an unaffected brother of the patient
(Fig 5, II:5) was found to share the affected haplotype.
View larger version (110K):
[in this window]
[in a new window]
| Fig 6.
Analysis of X-chromosome inactivation patterns.
Amplification of the CAG repeat polymorphism at the HUMARA locus either
without ( ) or with (+) prior Hpa II digestion. Lanes 1 and
2, the mother of patient HO (I-1); lanes 3 through 6, the 2 sisters of
patient HO (II-1 in lanes 3 and 4; II-4 in lanes 5 and 6). Note the
completely skewed pattern in the carrier (lane 4), the random pattern
in the normal sister (lane 6), and the incompletely skewed pattern in
the mother (lane 2).
|
|
Having identified the DKC1 deletion in this family, Southern
blot analysis confirmed that the sister (II.1) who had been predicted to be a carrier indeed was (Fig 2A, lane 2). In addition, her daughter
and son were both shown to have inherited the deletion (Fig 2A, lanes 4 and 5), as predicted by the linkage analysis (Fig 5, III:1 and III:2).
However, only normal fragments were seen in the mother of the index
case (Fig 2A, lane 1); she is therefore not a
heterozygote for this mutation and yet has passed the affected allele
to 2 of her children, whereas an affected and unaffected boy share the
same haplotype. We conclude that she is a germline mosaic.
PCR amplification across the deletion breakpoint using primers 931F and
MP3G gives rise to a deletion-specific fragment of approximately 200 bp. Testing all family members, we found that this fragment could be
amplified from those shown to have the deletion but not from the
unaffected sibs (Fig 7). However,
a faint band was also seen from the mother of the index case (Fig 5,
I:1) after 30 cycles of amplification, but not at 25 cycles, when it is
clearly visible in the patient. This was true for DNA extracted from
peripheral blood and mouthwash from the mother, and so we conclude that
she is also a somatic mosaic for the mutation. The fact that we did not
see a deletion-specific fragment in the Southern blot analysis of her
DNA (Fig 2) indicates that less than 5% of the peripheral blood cells
carry the deletion. Indeed, dilution experiments suggest that to get
the level of signal seen in the PCR experiments (Fig 7),
between 1:100 and 1:1,000 cells carry the deletion (data not shown).
The proportion of cells bearing the deletion among the somatic tissues
therefore appears to be smaller than the proportion present in the
germline tissue, from which 2 of 3 chromosomes passed to her children
(with the DXS8061:1, DXS1073:1, and DXS1108:3 haplotype, shown in Fig
5) carry the deletion.
View larger version (71K):
[in this window]
[in a new window]
| Fig 7.
Amplification of a deletion-specific product from genomic
DNA of the mother of patient HO. The number of PCR cycles is shown at
the top. Family members are drawn above the appropriate lanes. C, a
control sample. Note the faint product seen in the mother after 30 cycles of PCR, using primers that flank the deletion.
|
|
| |
DISCUSSION |
There are several interesting things about the deletion described in
this report. First, its very existence led to the identification of the
DKC1 gene that causes X-linked dyskeratosis congenita. Second,
a transcript is still detected from the partially deleted gene, despite
the fact that the last exon of the DKC1 gene has been lost.
Third, the neighboring gene, MPP1, is normally located only
approximately 1 kb away from the DKC1 gene and is arranged in a
tail to tail configuration. Fourth, the mutant transcript overlaps the
MPP1 gene at its 3' end to terminate on the antisense strand of the MPP1 3' UTR. Fifth, the mother of the
affected boy is both a germline and somatic mosaic for this mutation.
Having defined a region for the X-linked DKC1 gene of about 1.4 Mb in the distal part of chromosome Xq28,17 there remained some 28 known genes within the region.18-20 Whereas some
could be discounted on the basis of a known disease association, the identification of the DKC1 gene resulted from the detection of a deletion by Southern blot analysis in a single patient with DC. In 5 additional patients for whom RNA was available, RT-PCR analysis of this
gene led to the identification of 5 different mutations giving rise to
4 single amino acid substitutions and 1 single amino acid
deletion.5 Subsequent mutation analysis using genomic DNA
has led to the characterization of 11 additional mutations, which
comprise 10 missense mutations (1 of which is found in 11 unrelated
subjects) and 1 splice site mutation (Knight et al9a). None
of them affects the 100 C-terminal amino acids of the protein; there is
a small cluster of mutations around amino acids 36 to 41, but the
functional significance of this is not yet clear
(Fig 8).
View larger version (10K):
[in this window]
[in a new window]
| Fig 8.
The location of mutations identified in the
DKC1 gene. Amino acid substitutions are drawn over and
under a scale drawing of the DKC1 gene. Exons are shown as
numbered solid boxes; untranslated regions are shown as shaded boxes.
Data from Heiss et al,5 Knight et
al,9a and this report.
|
|
It is therefore of significant interest that the deleted DKC1
gene in the patient described here still gives rise to a presumably functional transcript. It seems reasonable to suggest that only relatively minor alterations to the gene can be tolerated and that a
null phenotype may not be viable. By analogy with its highly conserved
homologues in other species,7,8 the protein encoded by the
DKC1 gene, called dyskerin, is likely to be involved in the
nucleolus and possibly in the modification of rRNAs. We note that the
CBF5 gene, encoding the yeast homologue, Cbf5p, is an essential
gene in Saccharomyces cerevisiae, whereas the C-terminal KKD/E
domain of this protein is dispensable in Kluyveromyces
lactis.21 Conservation among the C-terminal amino acids
is greatly reduced compared with the rest of this highly conserved
protein.5 It may be that the loss of the last 22 amino
acids in the predicted mutant dyskerin of patient HO, like the
truncated K lactis protein, still retains sufficient function
to be viable, whereas a complete null mutation would not.
The very close proximity of the DKC1 gene and the MPP1
gene in the normal configuration has interesting implications for the termination of transcription and regulation of these ubiquitously expressed genes.6,22 Genes in this region of Xq28 do appear to be tightly packed,19 with, for example, the tail to tail Transketolase 2 and filamin genes separated by 4 kb, plexin and ITBA2
separated by 5 kb, and the QM protein and DNaseX genes separated by
only 825 bp. Elsewhere, close tail to tail genes include the human
histone H2A.X and hydroxymethylbilan genes, which are transcribed towards each other with their polyadenylation sites 330 bp
apart,23 while the polyadenylation signals of human
tuberous sclerosis 2 and polycystic kidney disease 1 genes lie just 60 bp apart24 and adjacent genes at the Surfeit locus are
separated by very small distances, with 2 of the genes overlapping at
their 3' ends.25
Genes that overlap at their 3' ends, as seen for the deleted
DKC1 and the MPP1 genes in the patient described here,
are uncommon in eukaryotes. Examples of normal genes that do this are
the signal transducer and activator of transcription 6 (Stat6) and the
immediate-early transcription factor NGF1-A binding protein (Nab2)
genes that overlap by 58 bp in a region that is absolutely conserved
between mouse and human.26 The mouse protein kinase gene
PKN has a short transcript that overlaps the 3'UTR of the EP1
prostanoid receptor gene by 280 bp as well as a long alternatively
spliced transcript that overlaps the whole gene.27
Transcriptional interference is suggested here with a possible
regulatory function of the antisense transcript. We presume that the
overlap seen in our patient cannot unduly interfere with the
transcription of either gene in that both appear to be transcribed at
near normal levels. Whether both can be transcribed in the same cell
has not been established, but if dyskerin is indispensable as suggested
by the absence of null mutations, it would imply that they can.
A final point of interest is that the mother of this DC patient is a
germline mosaic. In addition, a small number of her somatic cells also
carry the mutation as detected by PCR but not by Southern blot
analysis, implying that the mutation must have occurred early in
development in a cell that contributed to both germline and somatic
tissues. It may be that this is not such a rare event as previously
suspected (reviewed in Zlotogora28). For example, 19% of
all reported sporadic cases of the autosomal dominant disease facioscapulohumeral muscular dystrophy have a mosaic
parent.29 Other X-linked disorders in which mosaicism has
been demonstrated by molecular methods include X-linked severe combined
immunodeficiency,30 the androgen insensitivity
syndrome,31 Hunter syndrome,32 hemophilia
A,33 and Duchenne muscular dystrophy.34 In one third of these cases, the mother was also found to be a somatic mosaic.
There are important implications for genetic counselling here:
although the mother of the patient described here showed only an
incompletely skewed pattern of X-inactivation, we had assumed that she
was a carrier of DC, having an affected boy and a daughter with a
completely skewed XCIP sharing the haplotype of the affected chromosome. Only when an unaffected brother sharing this haplotype became available did we suspect that the situation may be more complicated, as it indeed turned out to be.
| |
ACKNOWLEDGMENT |
The authors thank Lisa Lowery for running the automated sequencing
facility and Dr Nick Cross for help with bubble and RACE PCR techniques.
| |
FOOTNOTES |
Submitted November 30, 1998; accepted April 15, 1999.
Supported by The Wellcome Trust, Action Research, the Deutsche
Forschungsgemeinschaft (DFG), and European Community (EU) Genome Analysis Program.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to T.J. Vulliamy, PhD,
Department of Haematology, Imperial College School of Medicine,
Hammersmith Hospital, Ducane Road, London W12 0NN, UK; e-mail:
t.vulliamy{at}rpms.ac.uk.
| |
REFERENCES |
1.
Davidson HR, Connor JM:
Dyskeratosis congenita.
J Med Genet
25:843, 1988[Free Full Text]
2.
Drachtman RA, Alter BP:
Dyskeratosis-congenita Clinical and genetic-heterogeneityReport of a new case and review of the literature.
Am J Pediatr Hematol Oncol
14:297, 1992[Medline]
[Order article via Infotrieve]
3.
Dokal I:
Dyskeratosis-congenitaAn inherited bone-marrow failure syndrome.
Br J Haematol
92:775, 1996[Medline]
[Order article via Infotrieve]
4.
Knight SW, Vulliamy TJ, Copplestone A, Gluckman E, Mason PJ, Dokal I:
Dyskeratosis congenita (DC) registry: Identification of new features of DC.
Br J Haematol
103:990, 1998[Medline]
[Order article via Infotrieve]
5.
Heiss NS, Knight SW, Vulliamy TJ, Klauck SM, Wiemann S, Mason PJ, Poustka A, Dokal I:
X-linked dyskeratosis congenita is caused by mutations in a highly conserved gene with putative nucleolar functions.
Nat Genet
19:32, 1998[Medline]
[Order article via Infotrieve]
6.
Jiang WD, Middleton K, Yoon HJ, Fouquet C, Carbon J:
An essential yeast protein, CBF5p, binds in-vitro to centromeres and microtubules.
Mol Cell Biol
13:4884, 1993[Abstract/Free Full Text]
7.
Meier UT, Blobel G:
NAP57, a mammalian nucleolar protein with a putative homolog in yeast and bacteria.
J Cell Biol
127:1505, 1994[Abstract/Free Full Text]
8.
Lafontaine D, BousquetAntonelli C, Henry Y, CaizerguesFerrer M, Tollervey D:
The box H+ACA snoRNAs carry Cbf5p, the putative rRNA pseudouridine synthase.
Genes Dev
12:527, 1998[Abstract/Free Full Text]
9.
Luzzatto L, Karadimitris A:
Dyskeratosis and ribosomal rebellion.
Nat Genet
19:6, 1998[Medline]
[Order article via Infotrieve]
9a. Knight SW, Heiss NS, Vulliamy TJ, Greschner S, Stavrides G, Pai
GS, Lestringant G, Varma N, Mason PJ, Dokal I, Poustka A: X-linked
dyskeratosis congenita is predominantly caused by missense mutations in
the DKC1 gene. Am J Hum Genet (in press)
10.
Frohman MA:
Rapid amplification of complementary-DNA ends for generation of full-length complementary DNAs-thermal race.
Methods Ezymol
218:340, 1993
11.
Zhang JG, Lin F, Chase A, Goldman JM, Cross NCP:
Comparison of genomic DNA and cDNA for detection of residual disease after treatment of chronic myeloid-leukemia with allogeneic bone-marrow transplantation.
Blood
87:2588, 1996[Abstract/Free Full Text]
12.
Allen RC, Zoghbi HY, Moseley AB, Rosenblatt HM, Belmont JW:
Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-receptor gene correlates with X-chromosome inactivation.
Am J Hum Genet
51:1229, 1992[Medline]
[Order article via Infotrieve]
13.
Gale RE, Mein CA, Linch DC:
Quantification of X-chromosome inactivation patterns in hematological samples using the DNA PCR-based HUMARA assay.
Leukemia
10:362, 1996[Medline]
[Order article via Infotrieve]
14.
Heiss NS, Korn B, Rogner UC, Poustka A:
Generation of specific exon trap probes from YACs by using Alu long-range PCR products.
Methods Mol Cell Biol
5:337, 1995
15.
Devriendt K, Matthijs G, Legius E, Schollen E, Blockmans D, vanGeet C, Degreef H, Cassiman JJ, Fryns JP:
Skewed X-chromosome inactivation in female carriers of dyskeratosis congenita.
Am J Hum Genet
60:581, 1997[Medline]
[Order article via Infotrieve]
16.
Vulliamy TJ, Knight SW, Dokal I, Mason PJ:
Skewed X-inactivation in carriers of X-linked dyskeratosis congenita.
Blood
90:2213, 1997[Abstract/Free Full Text]
17.
Knight SW, Vulliamy TJ, Heiss NS, Matthijs G, Devrendt K, Connor JM, D'Urso M, Poustka A, Mason PJ, Dokal I:
1.4Mb candidate gene region for X-linked dyskeratosis congenita defined by combined haplotype and X-chromosome inactivation analysis.
J Med Genet
35:993, 1998[Abstract/Free Full Text]
18.
Bione S, Tamanini F, Maestrini E, Tribioli C, Poustka A, Torri G, Rivella S, Toniolo D:
Transcriptional organization of a 450-kb region of the human X chromosome in Xq28.
Proc Natl Acad Sci USA
90:10977, 1993[Abstract/Free Full Text]
19.
Chen EY, Zollo M, Mazzarella R, Ciccodicola A, Chen CN, Zuo L, Heiner C, Burough F, Repetto M, Schlessinger D, DqUrso M:
Long-range sequence analysis in Xq28: Thirteen known and six candidate genes in 219.4 kb of high GC DNA between the RCP/GCP and G6PD loci.
Hum Mol Genet
5:659, 1996[Abstract/Free Full Text]
20.
Rogner UC, Heiss NS, Kioschis P, Wiemann S, Korn B, Poustka A:
Transcriptional analysis of the candidate region for incontinentia pigmenti (IP2) in Xq28.
Genome Res
6:922, 1996[Abstract/Free Full Text]
21.
Winkler AA, Bobok A, Zonneveld BJ, Steensma HY, Hooykaas PJ:
The lysine-rich C-terminal repeats of the centromere-binding factor 5 (Cbf5) of Kluyveromyces lactis are not essential for function.
Yeast
14:37, 1998[Medline]
[Order article via Infotrieve]
22.
Kim AC, Metzenberg AB, Sahr KE, Marfatia SM, Chishti AH:
Complete genomic organization of the human erythroid p55 gene (MPP1), a membrane-associated guanylate kinase homologue.
Genomics
31:223, 1996[Medline]
[Order article via Infotrieve]
23.
Ivanova VS, Zimonjic D, Popescu N, Bonner WM:
Chromosomal localization of the human histone H2A.X gene to 11q23.2-q23.3 by fluorescence in situ hybridization.
Hum Genet
94:303, 1994[Medline]
[Order article via Infotrieve]
24.
Harris PC, Ward CJ, Peral B, Hughes J:
Autosomal-dominant polycystic kidney-diseaseMolecular analysis.
Hum Mol Genet
4:1745, 1995[Abstract]
25.
Garson K, Duhig T, Armes N, Colombo P, Fried M:
Surf5A gene in the tightly clustered mouse surfeit locus is highly conserved and transcribed divergently from the rpL7A (Surf3) gene.
Genomics
30:163, 1995[Medline]
[Order article via Infotrieve]
26.
Svaren J, Apel ED, Simburger KS, Jenkins NA, Gilbert DJ, Copeland NA, Milbrandt J:
The Nab2 and Stat6 genes share a common transcription termination region.
Genomics
41:33, 1997[Medline]
[Order article via Infotrieve]
27.
Batshake B, Sundelin J:
The mouse genes for the EP(1) prostanoid receptor and the PKN protein-kinase overlap.
Biochem Biophys Res Commun
227:70, 1996[Medline]
[Order article via Infotrieve]
28.
Zlotogora J:
Germ line mosaicism.
Hum Genet
102:381, 1998[Medline]
[Order article via Infotrieve]
29.
Kohler J, Rupilius B, Otto M, Bathke K, Koch MC:
Germline mosaicism in 4q35 facioscapulohumeral muscular-dystrophy (FSHD1A) occurring predominantly in oogenesis.
Hum Genet
98:485, 1996[Medline]
[Order article via Infotrieve]
30.
Puck JM, Pepper AE, Bedard PM, Laframboise R:
Female germ-line mosaicism as the origin of a unique IL2 receptor gamma-chain mutation causing X-linked severe combined immunodeficiency.
J Clin Invest
95:895, 1995
31.
Boehmer AL, Brinkmann AO, Niermeijer MF, Bakker L, Halley DJ, Drop SL:
Germ-line and somatic mosaicism in the androgen insensitivity syndrome: Implications for genetic counseling.
Am J Hum Genet
60:1003, 1997[Medline]
[Order article via Infotrieve]
32.
Froissart R, Maire I, Bonnet V, Levade T, Bozon D:
Germline and somatic mosaicism in a female carrier of Hunter disease.
J Med Genet
34:137, 1997[Abstract/Free Full Text]
33.
Levinson B, Lehesjoki AE, Delachapelle A, Gitschier J:
Molecular analysis of hemophilia A mutations in the Finnish population.
Am J Hum Genet
46:53, 1990[Medline]
[Order article via Infotrieve]
34.
Bakker E, Veenema H, Dendunnen JT, Vanbroeckhoven C, Grootscholten PM, Bonten EJ, Vanommen GJ, Pearson PL:
Germinal mosaicism increases the recurrence risk for `new' Duchenne muscular-dystrophy mutations.
J Med Genet
26:553, 1989[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
B.-W. Gu, M. Bessler, and P. J. Mason
A pathogenic dyskerin mutation impairs proliferation and activates a DNA damage response independent of telomere length in mice
PNAS,
July 22, 2008;
105(29):
10173 - 10178.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. J. Vulliamy, A. Marrone, S. W. Knight, A. Walne, P. J. Mason, and I. Dokal
Mutations in dyskeratosis congenita: their impact on telomere length and the diversity of clinical presentation
Blood,
April 1, 2006;
107(7):
2680 - 2685.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION