|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 4 (August 15), 1999:
pp. 1300-1312
Synthesis and Ultrastructural Localization of Protein C Inhibitor in
Human Platelets and Megakaryocytes
By
Maria J. Prendes,
Edith Bielek,
Margareta Zechmeister-Machhart,
Erika Vanyek-Zavadil,
Veronica A. Carroll,
Johannes Breuss,
Bernd
R. Binder, and
Margarethe Geiger
From the Department of Vascular Biology and Thrombosis Research, and
the Department of Histology and Embryology, University of Vienna,
Vienna, Austria.
 |
ABSTRACT |
The occurrence of protein C inhibitor (PCI) in human platelets and
megakaryocytes was analyzed. As judged from enzyme-linked immunosorbent
assays (ELISAs), PCI was present in platelets at a concentration of 160 ng/2 × 109 cells. Its specific activity was 5 times
higher than that of plasma PCI. Consistently, mainly the 57-kD form
(active PCI) and some high molecular weight
(Mr) forms, but no bands corresponding to
cleaved PCI, were detected when platelet lysates were
immunoprecipitated with monoclonal anti-PCI-IgG and analyzed by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and
Western blotting. The localization of PCI in platelets was studied by
immunofluorescence histochemistry and immunotransmission electron
microscopy: PCI was detected in granules, in the open
canalicular system, and on the plasma membrane. At these sites,
colocalization with plasminogen activator inhibitor-1 was seen. Studies
were performed to clarify whether platelet PCI is endogenously
synthesized or taken up from plasma. Internalization of
biotinylated-PCI was analyzed using platelets in suspension and
gold-labeled streptavidin for visualization of incorporated biotin.
Dose- and time-dependent uptake of PCI was found. PCI mRNA was detected
in platelets by reverse transcriptase-polymerase chain reaction
(RT-PCR) and Southern blotting, as well as in
megakaryocytes by in situ hybridization of human bone marrow
cryosections. We therefore conclude that platelets contain a
functionally active PCI pool that is derived from both endogenous
synthesis as well as internalization.
© 1999 by The American Society of Hematology.
 |
INTRODUCTION |
IT IS GENERALLY ACCEPTED that cell
surfaces are essential for blood clotting reactions to take place.
Platelets provide a surface that allows coagulation factors to align in
a way to optimize their specific interactions (for reviews see Bloom et al1). Many of these interactions are performed by specific proteins present on the surface of platelets. Protein reactions that
implicate the platelets in the process of hemostasis are those of
adhesion to the cut end of a blood vessel, spreading of the adherent
platelets on the exposed subendothelial surface, secretion of platelet
constituents, formation of a mass of aggregated platelets, and
acceleration of plasma coagulation, resulting in the formation of a
fibrin clot. Subsequently, the formed fibrin clot retracts to a smaller
volume, a process that is also platelet-dependent. Three principal
effects result from platelet activation: secretion of the contents of
intracellular granules, exposure of latent surface receptors for plasma
proteins, and alterations in lipid structure of the platelet surface
membrane, leading to acceleration of plasma coagulation. Platelets
contain a variety of granules in which intracellular substances are
selectively sequestered, including dense bodies, granules, and
lysosomes.1-3 It has been shown that not all of the
proteins present in the granules are derived from endogenous
synthesis.4-6 Megakaryocytes, the precursors of platelets,
and platelets themselves, incorporate proteins (eg, fibrinogen and
albumin) from the surrounding medium and fuse them into granules.2,5,7-10 Thus, platelets appear to contain a
unique type of secretory granules, with contents originating both from
endogenous synthesis in megakaryocytes and from endocytosis by
megakaryocytes and platelets.
The protein C system is an important anticoagulant regulator of blood
coagulation.11,12 The complex thrombin-thrombomodulin bound
to the surface of the endothelial cells activates protein C by limited
proteolysis, leading to the formation of activated protein C (APC), a
serine protease. APC binds to protein S, which acts as receptor and
cofactor for APC on the membrane of platelets and endothelial cells.
The APC-protein S complex on the cell membrane inactivates coagulation
cofactor proteins, factors Va and VIIIa, by
limited proteolysis.1
The presence in plasma of an inhibitor of APC was first described by
Marlar and Griffin in 1980.13 Subsequently, this inhibitor was purified from human plasma and characterized by Suzuki et al.14,15 Protein C inhibitor (PCI) is a single-chain
polypeptide with a molecular weight (Mr) of
57,000. PCI is thought to be the primary regulator of the protein C
system, although 2-macroglobulin and
1-antitrypsin also appear to play a role when large
amounts of APC are generated in pathological settings.16-23
Comparing the inhibition rate constants, PCI is a better inactivator of
APC than 1-antitrypsin or
2-macroglobulin, but these 2 inhibitors are present in
plasma at much higher concentrations than PCI. Furthermore, baboon
models suggest that, in vivo, PCI is the preferred APC inhibitor until
its concentration becomes limiting, and then 1-antitrypsin becomes the predominant
inhibitor.24 However, there is no direct evidence for a
role of PCI in APC regulation, because patients deficient in the
protein have not been described. In addition to APC, PCI also inhibits
thrombin and several other procoagulant and profibrinolytic
proteinases, such as factor Xa, factor XIa,
urokinase plasminogen activator (u-PA), tissue plasminogen activator
(t-PA), and plasma kallikrein.25-27 Tissue kallikrein is
also inhibited by PCI as well as acrosin and prostate-specific antigen.28-31 The inhibition of each enzyme is accompanied
by formation of an enzyme-inhibitor complex and by the cleavage of the
reactive site peptide bond of PCI. PCI is found in plasma at a
concentration of 3.6 to 6.8 µg/mL in normal
individuals.19 PCI is also present in urine25
and in several other body fluids (eg, tears, saliva, milk,
cerebrospinal fluid, synovial fluid, amniotic fluid, and Graaf
follicular fluid).32 The highest concentrations have been described in seminal plasma (200 µg/mL).32 PCI synthesis
has been shown in liver cells, in organs of the male and female
reproductive tracts, in the pancreas, and in tubular cells of the
kidney.32,33 PCI belongs to the subgroup of heparin-binding
serpins, and heparin and other glycosaminoglycans can modulate the
inhibitory activity of PCI.14,15,25,26,34
The presence in human platelets of an inhibitor of APC was described in
1989; this inhibitor, if released, interfered with the
ability of phospholipid and washed platelet membranes to catalyze the
anticoagulant effects of APC.35 It has also been shown that platelet releases significantly reduced the activated partial thromboplastin time (aPTT) in the presence of APC.36
Furthermore, platelets contain substances capable of binding PCI (as,
for example, fibrinogen),37 of being inhibited by PCI (as
tPA or, after platelet activation, thrombin, APC, factor
Xa, factor XIa, and plasma kallikrein), or of
regulating the PCI activity.14,26,27,38 We
therefore analyzed the possibility of whether PCI might be present in
platelets. In this report, we can show that platelets in fact contain
PCI, which is functionally active and which is derived from endogenous synthesis as well as from endocytotic uptake.
 |
MATERIALS AND METHODS |
Aprotinin (Trasylol) was obtained from Bayer-Austria
(Vienna, Austria). Apyrase, benzamidine, prostaglandin
E1, and heparin sodium salt from porcine intestinal mucosa
were obtained from Sigma-Aldrich Chemicals (Vienna,
Austria). Purified urinary PCI, rabbit-anti-PCI-IgG,
peroxidase-conjugated rabbit-anti-PCI-IgG, and monoclonal-anti-PCI-IgG
(4PCI) were prepared as described previously.30,31,39 The
protein concentration of purified PCI was determined by amino acid
analysis performed by Toplab (Munich, Germany). Biotinylated PCI was
prepared using biotinyl- -amino caproic-N-hydroxysuccinimide ester
from Boehringer Mannheim (Vienna, Austria), following the
manufacturer's instructions. The efficiency of the labeling as well as
the inhibitory activity of the biotin-labeled PCI were controlled.
Preparation of platelet extracts.
Fresh venous blood from 5 healthy volunteers was collected on
acid-citrate-dextrose solution (ACD; 130 mmol/L citric acid, 124 mmol/L
trisodium citrate, 110 mmol/L dextrose; pH 6.5) at a ratio of 9 parts
blood to 1 part anticoagulant. Platelet-rich plasma (PRP) was obtained
by centrifugation at 120g for 10 minutes at 26°C. Seven
parts PRP were diluted with 1 part calcium-free Tyrode's buffer (137 mmol/L NaCl, 3 mmol/L KCl, 0.4 mmol/L NaH2PO4, 1 mmol/L MgCl2, 14 mmol/L NaHCO3, 5.5 mmol/L
dextrose, 10 mmol/L HEPES; pH 7.4) containing 100 KIU/mL aprotinin, 2.5 U/mL apyrase, 10 mmol/L benzamidine, and 29 mg/L soybean-trypsin
inhibitor and were further centrifuged at 1,060g for 10 minutes
at 26°C to obtain a platelet pellet. Subsequently, platelets were
washed 5 times and pelleted by centrifugation at 2,040g for 15 minutes at 26°C. The pellet containing washed human platelets was
finally resuspended in modified calcium-free Tyrode's buffer, and the
platelet concentration was adjusted to 2 × 109
cells/mL as determined in a standard hemacytometer. The isolation procedure was always completed within 2 hours.
To prepare platelet lysates, washed platelets (2 × 109 cells/mL) were centrifuged and resuspended in
phosphate-buffered saline (PBS; 10 mmol/L phosphate buffer and 140 mmol/L NaCl; pH 7.4) containing 1% Triton X-100, 100 KIU/mL aprotinin,
10 mmol/L benzamidine, and 25 µg/mL soybean trypsin inhibitor. The
sample was incubated in this buffer for 10 minutes with frequent
vortexing and was then centrifuged at 2,000g for 15 minutes to
remove big membrane fragments. The supernatant obtained was stored at
70°C until further use.
Quantification of total PCI antigen.
Total PCI antigen in platelet lysates and in a citrated plasma pool was
determined by enzyme-linked immunosorbent assay (ELISA) as described
previously,29 except that the microtiter plates were coated
with 20 µg/mL 4PCI instead of 10 µg/mL.
Quantification of active PCI antigen.
A functional ELISA was developed to determine active PCI antigen based
on its ability to bind u-PA. 4PCI, which does not interfere with PCI
activity, was used as a catching antibody. It was acid treated as
described,29 diluted in coating buffer (5.6 mmol/L Na2CO3, 35 mmol/L NaHCO3, 0.01%
thimerosal, pH 9.6) to yield a concentration of 20 µg/mL, and
incubated overnight at 4°C in wells of a microtiter plate.
Remaining binding sites were blocked for 1 hour at 37°C with
PBS-1% bovine serum albumin (BSA). After blocking and washing with
PBS-0.5% Tween 20, dilutions of platelet lysates in PBS-1% BSA were
pipetted into the wells and incubated for 150 minutes at 37°C.
Dilutions of citrated pooled plasma consisting of equal volumes of
plasma obtained from 20 healthy donors (10 men and 10 women; age range,
20 to 50 years) were used as standard. After washing again, u-PA
(Technoclone, Vienna, Austria) was added at a concentration of 80 U/mL
in PBS-1% BSA and incubated for 1 hour at 37°C. Thereafter, wells
were washed and incubated with peroxidase-conjugated monoclonal
anti-u-PA-IgG (Scu-PA-1; Technoclone) at a 1:200 dilution in PBS-1%
BSA. After 1 hour at 37°C, the plates were washed and then
incubated with ABTS substrate for 30 minutes at room temperature. The
substrate reaction was stopped with 0.32% sodium fluoride, and
absorbances were immediately measured at 405 nm/492 nm. The
coefficients of variation for this functional PCI ELISA were calculated
from duplicate determinations of 3 dilutions of 30 different plasma
samples. The intra-assay coefficient of variation was 1.8%. The
corresponding inter-assay coefficient of variation was 8.6%.
Quantification of total PAI-1 antigen.
PAI-1 antigen concentration in platelet extracts was determined using
an ELISA kit from Technoclone. This ELISA measures free, complexed, and
latent PAI-1 and is not affected by other plasminogen activator inhibitors.
Immunoprecipitation, sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE), and Western blotting.
Immunoprecipitation of platelet lysates was performed in wells of a
96-well Nunc Immuno Maxisorb plate (Nunc, Roskilde,
Denmark). The wells were coated overnight at 4°C with
acid-treated 4PCI (20 µg/mL). The remaining binding sites were
blocked and platelet lysates were added to the wells and incubated for
3 hours at 37°C. After washing (PBS-0.5% Tween 20), bound proteins
were separated from the plate with 20 µL of 20% SDS/0.05%
Bromphenol blue/glycerol (1:1). Samples were then removed and incubated
for 5 minutes at 90°C. SDS-PAGE (10% acrylamide) was performed
using a Mini-PROTEAN II electrophoresis cell from Bio-Rad (Vienna,
Austria). Twenty microliters of immunoprecipitated samples was loaded
to the wells and run at a constant current of 50 mA for 90 minutes with
a cooling system. Two identical gels were run, and 1 of them was used
as control. Purified PCI (2.5 µL) was also electrophoresed in each gel. Separated proteins were electrotransferred (75 minutes at 100 V)
to Hybond-P polyvinylidene diflouride (PVDF) membranes (Amersham Life Sciences, Vienna, Austria) using a Mini-Trans-Blot Electrophoretic Transfer Cell from Bio-Rad. After protein transfer, the
PVDF membranes were blocked with 1.5% nonfat dried milk diluted in
blotting buffer (20 mmol/L Tris-HCl, pH 7.4, 500 mmol/L NaCl) and
incubated overnight with or without (control) rabbit-anti-PCI-IgG (15 µg/mL) in blocking buffer. Thereafter, membranes were incubated for 1 hour with anti-rabbit-IgG biotinylated species-specific whole antibody
from donkey (Amersham Life Sciences) at a 1:500 dilution in blocking
buffer, followed by streptavidin-biotinylated horseradish peroxidase
complex (Amersham Life Sciences) at a 1:500 dilution in blocking
buffer. Finally, bound peroxidase was visualized with TMB substrate
color reagent (3, 3', 5, 5',-tetramethylbenzimide).
Immunofluorescence microscopy.
Platelets were isolated from whole blood as previously described,
except that the calcium-free-Tyrode's buffer was enriched with apyrase
and prostaglandin E1 but not with the other inhibitors. The
platelets obtained were extensively washed and thereafter resuspended
in a small volume of Tyrode's buffer. Smears of the washed platelets
were performed on poly-L-lysine-coated glass slides and allowed to dry
for 3 hours. Afterwards, platelets were permeabilized in cold acetone
for 1 minute. Unspecific reactive sites were blocked with PBS-5% BSA;
subsequently, the sections were incubated overnight at 4°C with the
first antibody diluted in PBS-1% BSA. Monoclonal anti-PCI-IgG (4PCI)
at a concentration of 20 µg/mL was used as a first antibody. Staining
specificity was assessed in negative control experiments performed by
substitution of the first antibody with dilution buffer alone, by
incubation with mouse-nonimmune-IgG, and by incubation with a
monoclonal antibody against the nonsense protein heparin cofactor II.
Staining specificity was also assessed in positive control experiments performed by incubation with a monoclonal antibody against PAI-1 (5PAI-12), a protein known to be present intracellularly in platelets. Additionally platelets were stained with a monoclonal antibody against
factor D, which was found to be localized on the membrane of the
platelets but not intracellularly.
Thereafter, the platelet smears were incubated with
fluorescein-conjugated goat-antimouse-IgG (Vector Laboratories Inc,
Burlingame, CA) diluted 1:100 in PBS-1% BSA for 1 hour at 37°C.
After incubation and washing (PBS), a drop of Vectashield Mounting
Medium (Vector Laboratories Inc) was placed onto the
section and then coverslipped. Slides were viewed using a Leitz Dialux
22/22 EB microscope (Ernst Leitz Wetsler Gmbh, Lietzlow, Germany)
equipped with a Nikon super high pressure mercury lamp (Nikon Corp,
Tokyo, Japan) and a power supply model HB-10101 AF (Nikon
Corp). Photographs were taken with a Leitz Vario-Orthomax
2 camera, at a magnification of 3,000 and an exposure time of 3 seconds.
Immunotransmission electron microscopy.
Platelets were isolated from whole blood as described above. After
extensively washing of the platelet pellet obtained, the platelets were
fixed with 4% paraformaldehyde/0.5% glutaraldehyde for 20 minutes at
room temperature. In platelet stimulation experiments, platelets were
incubated for 30 minutes at 37°C in a water bath and then activated
with 1 µmol/L calcium ionophore A23187 under gentle agitation. After
this activation, the platelets were fixed and further processed as
described below. Human bone marrow cells obtained by iliac puncture
from a healthy donor were sedimented by centrifugation at
2,000g for 10 minutes washed and fixed in 4% (wt/vol)
paraformaldehyde for 20 minutes at room temperature.
Before embedding in LR White medium resin, washed platelets and bone
marrow pellets were fixed again for 1 hour in 2.5% glutaraldehyde in
0.1 mol/L cacodylate buffer, pH 7.4, and then rinsed in 0.1 mol/L
phosphate buffer, pH 7.4. Ultrathin serial sections of 150 nm were cut
and mounted on gold grids. Nonspecific binding sites on the sections
were blocked (PBS-5% BSA) and grids were incubated for 3 hours at
37°C with different concentrations (500, 250, 125, 75, 35, and 20 µg/mL) of 4PCI in PBS-1% BSA. In negative control experiments, the
sections were incubated with nonimmune-mouse-IgG. After incubation with
the first antibody and washing, platelet and bone marrow sections were
incubated with 10 nm gold-labeled antimouse-IgG (Sigma-Aldrich) at a
dilution of 1:50 in PBS-1% BSA. In double-labeling experiments,
sections were incubated with a mixture of 75 µg/mL 4PCI and 75 µg/mL rabbit-anti-PAI-1-IgG (final concentrations) in PBS-1% BSA. In
control experiments for double-labeling, incubations were performed in
a mixture of 4PCI and rabbit-nonimmune-IgG or in rabbit-anti-PAI-1-IgG
and mouse-nonimmune-IgG. After washing, grids were incubated in
biotinylated-antimouse-IgG (final dilution, 1:200 in PBS-1% BSA) and
goat-antirabbit-IgG coupled with 5 nm colloidal gold particles (final
dilution, 1:100; Amersham Life Sciences). Further incubation was
performed with streptavidin-gold 10 nm conjugate diluted 1:100 in
PBS-1% BSA. The sections were then counterstained with 3% uranyl
acetate and lead citrate and examined with a JEM 1200 EXII transmission
electron microscope (JEOL Ltd, Tokyo, Japan). Photographs
were taken on AGFA Scientia EM films (AGFA-Gevaert Ag,
Leverkusen, Germany) at magnifications between 40,000 and 120,000.
Uptake of PCI by platelets.
Platelets were isolated as described above, with the only modification
being that 1 µg/mL prostaglandin E1 was added to the washing buffer. The washed platelets were adjusted to a concentration of 1.6 × 109 cells/mL and incubated for 30 minutes at
37°C before starting this experiment. Afterwards, 200 µL of the
platelet suspension was incubated at room temperature with 200 µL of
biotinylated PCI (4.5 or 9 µg/mL, respectively). The uptake reaction
was stopped after 2 different incubation times (7 and 15 minutes,
respectively) by adding 5 parts of 4% paraformaldehyde/0.2%
glutaraldehyde in calcium-free Tyrode's buffer to 1 part of
platelet/PCI solution. Cells were fixed for 20 minutes at room
temperature, washed, and further processed for immuno-electron
microscopy as described above. Sections of these platelets on gold
grids were blocked and incubated for 3 hours at 37°C with 10 nm
gold-labeled streptavidin diluted 1:25 in PBS-1% BSA. After this
incubation, the grids were washed, counterstained, and examined with a
transmission electron microscope.
Reverse transcriptase-polymerase chain reaction
(RT-PCR) and Southern blotting.
Human blood was collected from healthy donors on ACD anticoagulant
solution as described above. The PRP was diluted (7:1) with
calcium-free-Tyrode's buffer containing 2.5 U/mL apyrase, 100 KIU/mL
aprotinin, and 10 mmol/L benzamidine and gel-filtered platelets were
prepared by filtering this PRP through a 40-mL Sepharose CL-2B
chromatography column (Pharmacia Biotech, Vienna, Austria). Fractions (1.5 mL) were collected and aliquots
of each fraction were smeared on poly-L-lysine-coated slides and
stained with Accutain (Sigma Diagnostics, Vienna,
Austria). The slides were then checked by light
microscopy. Fractions containing only platelets and no other blood
cells were pooled, and platelets were washed 5 times and adjusted to 1 × 109 cells/mL.
Total RNA from gel-filtered platelets and HepG2 hepatoma cells was
isolated using RNeasy Mini Kit (QIAGEN, Vienna, Austria), and 5 µg each was reverse transcribed by using a sequence-specific primer and the first-strand cDNA Synthesis Kit for RT-PCR from Boehringer Mannheim. The RT-generated PCI cDNA fragments (1,157 bp)
were amplified by PCR. As a control for this reaction, PCI-cDNA inserted into the plasmid vector pBluescript II KS (+/ ) phagemid (Stratagene, La Jolla, CA) was also amplified. The following primers were used for amplification: 5'-primer (the binding site is
located in exon III: from base 10727 to base 10748)
TCAGTATCACTACCTCCTGGAC and 3'-primer (binding site in exon V:
from base 12705 to base 12726) CTGTTGAACACTAGCCTCTGAG. The human PCI
sequence data were obtained from EMBL Data Bank (accession nos. M64880
through M64884). The design of both primers was performed in such a way
that it allowed the differentiation between the product obtained from
the reverse-transcribed platelet RNA (438 bp) and genomic DNA
contaminations (1,978 bp). PCR amplification using 5 µL of the cDNA
from the RT reaction was performed in 5 µL of 10× reaction buffer, 1.5 mmol/L MgCl2, 200 µmol/L deoxynucleotides, 10 pmol/L primers, and 2.5 U Taq polymerase in a final volume of 25 µL. The samples were subjected to amplification in a GeneAmp PCR System 2400 (Perkin Elmer Cetus Instruments, Emeryville, CA) to 94°C for 5 minutes; then 30 cycles of amplification were performed, each
consisting of denaturation at 94°C for 1 minute, annealing at
61°C for 1 minute, and extension at 72°C for 1 minute, and then
a final incubation at 72°C for 7 minutes was performed. Amplified products were separated in 1% agarose TBE gels and stained with ethidium bromide. After electrophoresis, the gel was transferred overnight to a Duralon-UV membrane (Stratagene). A PCI-cDNA fragment of
982 bp (from base 7994 to base 11344 in the above-described sequence)
was 32P-labeled using Random Primed DNA Labeling Kit
(Boehringer Mannheim) and used as a probe for the blotting. The
nylon-membrane was equilibrated in Church's buffer (0.5 mol/L
Na2HPO4, pH 7.2, 7% SDS, 0.5 mol/L EDTA, pH 8)
for 1 hour at 62°C and then incubated overnight at 62°C with
0.7 mL of denatured 32P-DNA probe in 6.3 mL of Church's
buffer. Thereafter, the membrane was extensively washed and subjected
to autoradiography overnight at 70°C using a Kodak X-OMAT
Scientific Imaging Film (Eastman Kodak, Rochester, NY).
In situ hybridization.
A PCI-cDNA fragment (593 bp; from base 7994 in exon II to base 10645 in
exon III) was in vitro transcribed using the pCR II vector (Invitrogen,
San Diego, CA) that contains the bacteriophage SP6 and T7 polymerase
promoters. The ligation reaction for the PCI-cDNA fragment into the
plasmid vector was performed by using the Rapid DNA Ligation Kit from
Boehringer Mannheim. After transformation and cloning, the DNA template
was linearized with HindIII (2.9 U) and in vitro transcribed
with T7 RNA polymerase to obtain the sense RNA probe (655 bp). The
antisense RNA probe (613 bp) was obtained by linearizing with
EcoRI (14.15 U) and in vitro transcription with the SP6 RNA
polymerase. The transcription procedure was performed by using the
digoxigenin (DIG) RNA Labeling Kit obtained from Boehringer Mannheim.
The human bone marrow samples to be used for in situ hybridization
procedures were immediately embedded in Tissue Tek and snap-frozen in
liquid nitrogen. Sections of these samples were allowed to settle on
poly-L-lysine-coated glass slides and in situ hybridization was
performed as described in the protocols for in situ hybridization to
tissue sections, obtained from Boehringer Mannheim, which were based on
published data.40 Cryosections were incubated with
DIG-labeled antisense or sense PCI cRNA probes, which were further
detected with anti-DIG-alkaline phosphatase Fab fragments, followed by
NBT/BCIP substrate detection. Controls were always included to ensure
the specificity of the detected signals. These controls were made in
the target (hybridization with sense probe) as well as in the detection
(omission of anti-DIG antibody).
 |
RESULTS |
Total PCI antigen and active PCI antigen in platelet lysates.
Platelet lysates and plasma samples were analyzed for total PCI antigen
and active PCI antigen by ELISAs. The total PCI antigen concentration
in platelet lysates (2 × 109 platelets/mL) was 160 ± 0.03 ng/mL (mean ± SD), as determined in 5 measurements
performed in 2 independent experiments. The PCI plasma concentration
measured with the same assay was 5.8 ± 0.02 µg/mL. Active PCI
antigen in platelet lysates was 14% ± 2% (mean ± SD) of that
measured in the citrated pooled plasma (100%) used as standard. This
mean was calculated from duplicate measurements of 7 different
dilutions. Therefore, the specific activity of PCI in platelet lysates
was 5-fold higher as compared with the specific activity of PCI present
in plasma. As a control, PAI-1 antigen was also determined in these
platelet lysates, and the results obtained agree with published
data41-43: 1,639 ± 23 ng/mL (mean ± SD) or 0.82 ng/106 platelets. We therefore assumed that the platelet
lysates were in a condition to allow further reliable experiments.
Immunoprecipitation, SDS-PAGE, and Western blotting.
Immunoprecipitation of platelet lysates was performed with
monoclonal-anti-PCI-IgG (4PCI), and immunoprecipitates were analyzed by SDS-PAGE and Western blotting with rabbit-anti-PCI-IgG. As can be
seen from Fig 1, purified urinary PCI used
as a control exhibited the typical pattern of closely spaced bands with
molecular weights between 60 and 54 kD,14,15,44 with the
most intense bands corresponding to active PCI (57 kD) and reactive
site-cleaved PCI (54 kD), respectively. In platelet lysates there was
also a prominent band at 57 kD, corresponding to the migration distance of active PCI (Fig 1). However, bands corresponding to cleaved PCI were
hardly seen. In addition, platelet lysates contained several high
molecular weight bands of PCI antigen (>220 kD).

View larger version (86K):
[in this window]
[in a new window]
| Fig 1.
Immunoprecipitation, SDS-PAGE, and Western blot of
platelet lysates. Solubilized proteins contained in platelet lysates
were subjected to immunoprecipitation with monoclonal anti-PCI-IgG as
described in Materials and Methods. Precipitates were analyzed by
SDS-PAGE (10% acrylamide) and immunoblotting using
rabbit-anti-PCI-IgG. Bound antigen was detected with
biotinylated-antirabbit-IgG followed by streptavidin-peroxidase and
with TMB color substrate reagent. Purified urinary PCI was used as a
control. In platelet lysates, only the 57-kD band corresponding to the
active PCI was observed; bands corresponding to cleaved PCI were hardly
seen.
|
|
Immunofluorescence microscopy.
Immunofluorescence was used to evaluate the localization of PCI in
platelets (Fig 2). For this purpose, the
platelet smears were incubated with a monoclonal antibody to PCI
(4PCI). The PCI staining pattern observed (Fig 2A) looked very similar
to that of PAI-1 (Fig 2B), which is known to be present in the granules and which was therefore chosen as an intracellular positive
control for this experiment.41-43 The platelets incubated
with 4PCI exhibited a fluorescent homogeneous pattern as well as a
spotted staining pattern consistent with intracellular localization of
the protein (Fig 2A). This pattern was different from that obtained
with a monoclonal antibody to factor D, which showed a rim pattern of staining, characteristic for exclusive surface and not for
intracellular localization (Fig 2C). No staining was seen in control
experiments using antibodies against heparin cofactor II (Fig 2D) or
nonimmune-mouse-IgG (Fig 2F) or when the first antibody was replaced by
dilution buffer alone (Fig 2E).

View larger version (87K):
[in this window]
[in a new window]
| Fig 2.
Immunofluorescence microscopy: PCI in washed
platelets. Smears of washed platelets isolated from whole blood were
incubated with a monoclonal antibody against PCI (A), PAI-1 (B), factor
D (C), or heparin cofactor II (D); in other negative control
experiments with dilution buffer alone (E); or with a nonimmune mouse
IgG (F), followed by fluorescein-conjugated goat-antimouse-IgG. PCI
showed fluorescence intracellularly as well as PAI-1, which was used as
a positive control (A and B, respectively), whereas a rim pattern of
staining consistent with an exclusively surface localization of the
protein, which was observed with the antibody to factor D (C), was not
observed in case of PCI. Negative control experiments performed with an
antibody to heparin cofactor II (D), with mouse-nonimmune IgG (F), or
by incubation with dilution buffer alone (E) did not show any
fluorescence. (Original magnification × 3,000; exposure time: 3 seconds.)
|
|
Immunogold-transmission electron microscopy.
The ultrastructural localization of PCI was analyzed by immuno-electron
microscopy using postembedding immunogold labeling. In these sections,
platelets appeared unstimulated. The different structures were well
preserved, with the only exception of some regions of the membranes
(plasma membrane, membranes of the granula, and membranes of the open
canalicular system). The negative control experiments performed by
substituting the first specific antibody with nonimmune-mouse-IgG
(Fig 3F) or omitting the
first antibody and incubating with dilution buffer alone (not shown)
did not show any labeling. The staining with the 4PCI antibody (Fig 3A through E), localized PCI in the granules (Fig 3A through E, arrowheads) in the open canalicular system (OCS; bound
predominantly to the membranes or bound to some precipitates in the
lumen of these structures) as well as on the plasma membrane. The
platelet cytoplasmic matrix reflected minimal background levels of
labeling as did other organelles such as mitochondria. As far as granules are concerned (Fig 3A through E, arrowheads), gold particles
were evenly distributed over all granules. The labeling in these granules was predominantly in the electron dense zone or nucleoid and
also sometimes bound to the membrane of the granules. The labeling of
the plasma membrane (Fig 3A through E) was observed either at the
internal or at the external surface of the trilaminar structure. The
distribution of PCI labeling after platelet activation with calcium
ionophore A23187 was also analyzed (not shown). Differences in the
distribution of staining between stimulated and unstimulated platelets
were quantitatively evaluated by locating more than 500 gold particles
in each case. Activation of the platelets showed a considerable
decrease in staining in the granules.


View larger version (236K):
[in this window]
[in a new window]
| Fig 3.
Immunoelectronmicroscopy of platelet and
megakaryocytes sections. Washed platelets and megakaryocytes were
proceeded for transmission electron microscopy as described in
Materials and Methods. Sections incubated with 75 µg/mL of 4PCI (A
through E) showed positive staining in the OCS, in the granules
(arrowheads), and on the plasma membrane. Sections incubated with
nonimmune-IgG (negative control, F) were devoid of gold staining. PCI
labeling in the granules (A through E, arrowheads) was distributed
over all granules and predominantly in the electron dense zone or
nucleoid, although sometimes they were found to bind to the granule
membrane (A through E, arrowheads). The PCI staining pattern in
megakaryocytes (G and H) was very similar to that seen in platelets.
Gold particles often appeared in granules identifiable as granules,
as well as on the plasma membrane, and in the open canalicular system.
Experiments of colocalization of PCI with PAI-1 (I through M) were
performed as described in Materials and Methods. The gold particles of
10 and 5 nm indicate the presence of PCI and PAI-1, respectively.
Colocalization demonstrates that the granules observed were indeed
granules. (A and C through G) Bars = 200 nm; (B and H through M) bars
= 100 nm.
|
|
The presence of PCI in megakaryocytes was also investigated by the same
immunogold staining procedures (Fig 3G and H). The megakaryocytes seen
in the bone marrow sections displayed a smooth surface, with a nucleus
presenting several rounded lobes with abundant euchromatin (not shown).
Mature megakaryocytes displaying morphologic evidence of platelet
production were also found (not shown). The pattern of PCI labeling in
these cells was very similar to that seen in platelets. PCI was
localized in granules identified as granules, as judged from the
size, form, and electron density (Fig 3G and H). The cisternae of the
OCS or similar structures were also positive for PCI (Fig 3G). Gold
particles appeared also bound to the plasma membrane (Fig 3G). One
interesting finding in this experiment was the presence of PCI in the
nucleus of megakaryocytes (data not shown). Granulocytes present in the
same bone marrow sections showed also positive PCI labeling at
different organelles as well as in the nucleus (not shown). Control
experiments performed by substituting the first antibody (4PCI) with
nonimmune-mouse-IgG did not show any staining either in megakaryocytes
or in granulocytes (data not shown). To confirm the localization of PCI
within the granules, additional experiments were performed using
PAI-1 as an granule marker (Fig 3I through M). Gold particles of 2 different sizes were used to identify the 2 proteins of interest: PCI
(10 nm) and PAI-1 (5 nm). Colocalization of PCI with PAI-1 confirmed
that PCI-containing granules were indeed granules (Fig 3I through
M). In addition to the granules, colocalization of PCI and PAI-1
was also seen in the OCS and on the plasma membrane (data not shown).
Uptake of biotinylated-PCI by platelets.
To determine if the PCI found in platelets is derived from an exogenous
origin or from endogenous synthesis, platelets in suspension were
incubated with 2 different concentrations of biotinylated PCI (4.5 or 9 µg/mL) for 7 or 15 minutes, respectively
(Fig 4). Biotinylated PCI was chosen for
the uptake experiments, based on published data that describe a
possible internalization of solid-phase ligands, as colloidal
gold-protein conjugates, and on postligand binding events induced by
this kind of conjugates,45 as well as based
on other data that demonstrate that platelets incubated with free
biotin remained unlabeled, not showing unspecific uptake of
biotin.46 The detected labeling was sparse, with only a few
gold particles. A dose- and time-dependent uptake of PCI from the
extracellular medium was observed (Fig 4A through D). The morphological
study demonstrates that PCI was bound to platelets sequestered in the
OCS and that some of these molecules were internalized, appearing in
the cytoplasm without being surrounded by a membrane or in the
protein-storing structures, the granules (arrowheads). The
proportion of labeling in the granules was found to increase with
the time and concentration (Fig 4A through D). No evidence for an
endocytotic process mediated by receptors or other ligands was thus
observed. Labels were not seen in coated pits or coated vesicles.

View larger version (119K):
[in this window]
[in a new window]
| Fig 4.
Uptake of biotinylated PCI by platelets. Washed
platelets in suspension were incubated with 2 different concentrations
of biotinylated PCI for 2 different periods of time, namely, 4.5 µg/mL for 7 minutes (A) and 15 minutes (B) or 9 µg/mL for 7 minutes
(C) and 15 minutes (D). Uptake was stopped by addition of fixative and
platelets were then processed for transmission electron microscopy.
Biotinylated PCI was detected by incubating platelets sections with 10 nm gold-labeled streptavidin. Dose- and time-dependent internalization
of biotinylated PCI was observed, which conduced the biotinylated PCI
molecules to the granules (arrowheads). Bars = 200 nm.
|
|
RT-PCR and Southern blotting.
RT-PCR and Southern blot analysis were performed to provide evidence as
to whether platelet PCI might also be derived from endogenous
synthesis. After blotting and autoradiography, a band corresponding in
size to the expected fragment (438 bp) was observed using total
platelet RNA (Fig 5). A band of the same
size was seen with total RNA from HepG2 cells used as a positive
control (Fig 5). Both bands had the same size as the fragment amplified from PCI-cDNA (Fig 5). No genomic DNA contaminations were detected, as
judged from the absence of a 1,978-bp band containing introns 3 and 4 of PCI (not shown). No band was observed in the control without
platelets (Fig 5). These results suggest that platelet PCI is also
derived from endogenous synthesis. Therefore, PCI present in the granules seems to be derived from 2 sources: endogenous synthesis and
uptake from the surrounding medium.

View larger version (21K):
[in this window]
[in a new window]
| Fig 5.
RT-PCR and Southern blotting. Total RNA obtained from
platelets and Hep G2 cells was subjected to RT-PCR and Southern
blotting using primers specific for a 438-bp fragment of PCI-cDNA. A
PCI-cDNA fragment inserted into the plasmid vector pBluescript II KS
(+/ ) phagemid was also amplified by PCR with the same primers.
Additionally, a negative control was performed by amplifiying a sample
without platelets. After blotting, the membrane was incubated with a
32P-labeled PCI-cDNA fragment and subjected to
autoradiography as described in Materials and Methods.
|
|
In situ hybridization of bone marrow cryosections.
To demonstrate synthesis of PCI in megakaryocytes, human bone marrow
cryosections were analyzed for the presence of PCI-mRNA (Fig 6). In situ hybridization was
performed using DIG-labeled antisense or sense PCI cRNA probes, which
were further detected with anti-DIG-alkaline phosphatase Fab fragments,
followed by NBT/BCIP substrate detection. The megakaryocytes were
easily recognized in these sections at lower magnifications because of
their large size as compared with other cells present in the bone
marrow and because of their typical morphology. The analysis of
labeling with antisense PCI cRNA probe was found to be positive (Fig
6b): cells showed dark blue precipitates, identified as positive
hybridization signals. In addition to megakaryocytes, other nucleated
cells in bone marrow also contained PCI-mRNA (data not shown). As
judged from their morphology, these cells resembled granulocytes, which were also positive for PCI antigen as judged from immuno-electron microscopy. However, these cells were not further examined in the
present study. Sections incubated with sense PCI cRNA probes (Fig 6a)
or with antisense probe but without incubation with the anti-digoxigenin antibody (data not shown) yielded negative results. In
conclusion, PCI mRNA was detected in megakaryocytes obtained from bone
marrow preparations, which reflects again that not all of the PCI
molecules present in platelets are derived from an endocytotic process
and that some of them are sequestered into the storage granules after
endogenous synthesis in megakaryocytes.

View larger version (94K):
[in this window]
[in a new window]
| Fig 6.
In situ hybridization of human bone marrow cryosections.
Sections of human bone marrow were incubated with DIG-labeled-cRNA
sense (a) or antisense probe (b). Bound cRNA probes were detected with
anti-digoxigenin-alkaline phosphatase Fab fragments, followed by
incubation with NBT/BCIP color solution. The megakaryocytes observed in
sections incubated with the PCI-cRNA antisense probe showed dark blue
precipitates (b). Control sections incubated with the sense probe
yielded negative results (a). (Original magnification × 1,000.)
|
|
 |
DISCUSSION |
It has been suggested previously that platelets might contain an
inhibitor of APC.35,36 We therefore analyzed in this study the presence of PCI in washed human platelets. As judged from an ELISA
that recognizes all forms of PCI antigen (active, complexed, and
cleaved), PCI is present in platelets at a concentration of 160 ng/2 × 109 platelets. Using an ELISA specific for
functional PCI antigen and pooled citrated plasma as a reference, we
have shown that this PCI in the platelets is active and, furthermore,
that the specific activity of platelet PCI is approximately 5 times
higher than that of plasma PCI. This could be caused by binding of
platelet PCI to substances stimulating its activity, as shown
previously for proteoglycans on epithelial kidney cells.47
To analyze in a semiquantitative way the different forms of PCI antigen
in platelets, platelet lysates immunoprecipitated with monoclonal
anti-PCI-IgG were analyzed in Western blots. The main PCI antigen bands
detected exhibited Mrs of 57,000 (corresponding in size to
active PCI)44 and greater than 220,000. Bands corresponding
to cleaved, inactive PCI (54 kD or less) were practically absent. The
identity of the high Mr bands is still unknown and will be
analyzed separately.
Having shown the presence of PCI in platelet lysates, we analyzed the
localization of PCI in resting platelets. Using immunofluorescence microscopy, a relatively homogenous pattern of distribution of PCI in
resting platelets was observed, together with a spotted pattern in many
domains, indicating intracellular localization of PCI and not only
external binding to the plasma membrane. A similar pattern of
fluorescence has been described for other proteins localized in
subcellular structures of platelets, eg, in the granules, in the
dense granules, or in the OCS.7,8,48 Immunotransmission electron microscopy showed localization of PCI in the granules, in
the OCS, and on the surface of the platelets associated to the plasma
membrane. A possible redistribution of PCI in platelets after
activation was investigated by activating the platelets with calcium
ionophore. The results were consistent with the hypothesis that, after
activation of the platelets, the PCI-pool stored in the granules is
secreted, presumably, to the extracellular space. Soluble proteins have
been identified that are stored in the platelet granules and are
secreted upon platelet activation,2,3,42,49,50 and some of
them were found to play a role in the arrest of bleeding (physiological
hemostasis) or in the formation of vaso-occlusive thrombi (pathological
thrombosis).43
Many proteins stored in granules are endogenously synthesized and
packed within the platelet precursor, the megakaryocyte, such as
platelet factor 4, thrombospondin, and von Willebrand factor.2 Other proteins in the granules, such as
fibrinogen and albumin, are accumulated via a different mechanism
involving endocytosis and pinocytosis from the surrounding
extracellular medium at both the megakaryocyte and circulating platelet
levels.5,7,9,10 A slight uptake into the platelets analyzed
was observed. This uptake was time- and dose-dependent, and
biotinylated-PCI was detected on the plasma membrane, in the OCS, and
in the granules. It can therefore be assumed that PCI is bound to
the platelets and sequestered in the open canalicular system and that
some of these molecules are internalized, appearing in the
protein-storing structures, the granules. No evidence for an
endocytotic process mediated by receptors or other ligands was
observed; labels were not seen in coated pits or vesicles. In vivo, due
to the high levels of PCI in plasma as compared with platelets, the
process of internalization of PCI could occur by fluid-phase
internalization or pinocytosis, as observed for other proteins (eg,
albumin).51
We were also able to show by RT-PCR that platelets contain PCI mRNA,
suggesting endogenous PCI synthesis in megakaryocytes. To confirm this
hypothesis and because we cannot completely rule out contamination of
the gel filtered platelets with white blood cells, we performed in situ
hybridization of bone marrow cryosections. Positive staining for PCI
mRNA was seen in megakaryocytes. Therefore, endogenous synthesis of PCI
occurs in the precursors of the platelets, in which we were also able
to localize PCI protein. The localization of PCI antigen within
megakaryocytes looked very similar to that of platelets: it was seen in
small granules, which might be identified as granules, in the
channels of the OCS, and on the surface of the cell, at the plasma
membrane. Interestingly, megakaryocytes were not the only cells in bone
marrow that were positive for PCI. Other cell types morphologically
indistinguishable from granulocytes showed also positive staining in
their granules as well as in structures similar to vesicles dispersed
along the cytoplasm. An unexpected observation was furthermore the
presence of PCI labeling in the nucleus of megakaryocytes and
granulocytes. Nuclear staining was not seen with nonimmune-IgG and
therefore seems to be specific. Analysis of these data is too
preliminary at the moment and could be a subject for further investigations.
In conclusion, the results presented in this work demonstrate the
presence in platelets of 2 PCI pools with different origins: from
megakaryocytic synthesis and from plasma uptake. Furthermore, they
indicate that this PCI is stored in platelets in a more active form
than that found in plasma and that it is secreted after platelet activation. Although extrapolation to physiologic and pathophysiologic conditions is difficult, platelet activation in vivo may be responsible for local increase in PCI activity, which could play a role at sites of
platelet accumulation, ie, at sites of clot formation. We have shown
previously that PCI plasma levels are elevated in survivors of
myocardial infarction,52 suggesting a role of PCI in the
development of thrombotic processes. Our present findings suggest that
platelets might contribute to the local elevation of PCI. These locally
increased PCI levels could not only inhibit the activity of the
anticoagulant protein C pathway,11 but also the activation
of fibrinolysis,25 resulting in a tendency of clots to
persist, thereby being involved in the development of thrombotic
diseases such as myocardial infarction or deep venous thrombosis.
 |
ACKNOWLEDGMENT |
The authors are grateful to Dr F. Keil (Department of Internal Medicine
I, University of Vienna, Vienna, Austria) for his help obtaining bone
marrow samples. We also thank Prof E. Koller and Dr I. Volf (Department
of Medical Physiology, University of Vienna) for their helpful suggestions.
 |
FOOTNOTES |
Submitted August 12, 1998; accepted April 12, 1999.
Supported in part by Grants No. P 10823-Med and P 12308-Gen from the
Austrian Science Foundation.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Presented at the 14th International Congress on Fibrinolysis and
Thrombolysis, Ljubljana, Slovenia, June 22-26, 1998, and at the Xth
International Vascular Biology Meeting in Cairns, Queensland,
Australia, August 23-27, 1998.
Address reprint requests to Margarethe Geiger, MD, Department of
Vascular Biology and Thrombosis Research, University of Vienna,
Schwarzspanierstrasse 17, A-1090 Vienna, Austria; e-mail:
margarethe.geiger{at}univie.ac.at.
 |
REFERENCES |
1.
Bloom AL, Forbes CD, Thomas DP, Tuddenham EGD:
Haemostasis and Thrombosis (ed 3). Singapore, Churchill Livingstone, 1994.
2.
Harrison P, Cramer EM:
Platelet alpha-granules.
Blood Rev
7:52, 1993[Medline]
[Order article via Infotrieve]
3.
Hayward CM:
Inherited disorders of platelet alpha-granules.
Platelets
8:197, 1997
4. Klinger MF: Coated vesicle-mediated endocytosis in human blood
platelets. Rec Adv Microsc Cells Tissues Organs 101, 1997
5.
Suzuki M, Miyazaki Y, Miyake T, Kido H, Yamaguchi K, Kagawa H, Yanabu M, Nomura S, Fukuhara S:
Uptake of fibrinogen by circulating platelets (letter).
Vox Sang
67:243, 1994[Medline]
[Order article via Infotrieve]
6.
Behnke O:
Coated pits and vesicles transfer plasma components to platelet granules.
Thromb Haemost
62:718, 1989[Medline]
[Order article via Infotrieve]
7.
Harrison P, Wilbourn B, Debili N, Vainchenker W, Breton GJ, Lawrie AS, Masse JM, Savidge GF, Cramer EM:
Uptake of plasma fibrinogen into the alpha granules of human megakaryocytes and platelets.
J Clin Invest
84:1320, 1989
8.
Belitser N, Anischuk M, Veklich Y, Pozdnjakova T, Gorkun O:
Fibrinogen internalization by ADP-stimulated blood platelets. Ultrastructural studies with fibrinogen-colloidal gold probes.
Thromb Res
69:413, 1993[Medline]
[Order article via Infotrieve]
9.
Handagama PJ, George JN, Shuman MA, McEver RP, Bainton DF:
Incorporation of a circulating protein into megakaryocyte and platelet granules.
Proc Natl Acad Sci USA
84:861, 1987[Abstract/Free Full Text]
10.
Handagama PJ, Bainton DF:
Incorporation of a circulating protein into alpha granules of megakaryocytes.
Blood Cells
15:59, 1989[Medline]
[Order article via Infotrieve]
11.
Esmon CT, Ding W, Yasuhiro K, Gu JM, Ferrell G, Regan LM, Stearns-Kurosawa DJ:
The protein C pathway: New insights.
Thromb Haemost
78:70, 1997[Medline]
[Order article via Infotrieve]
12.
Gruber A, Pal A, Kiss RG, Sas G, Griffin JH:
Generation of activated protein C during thrombolysis.
Lancet
342:1275, 1993[Medline]
[Order article via Infotrieve]
13.
Marlar RA, Griffin JH:
Deficiency of protein C inhibitor in combined factor V/VIII deficiency disease.
J Clin Invest
66:1186, 1980
14.
Suzuki K, Nishioka J, Hashimoto S:
Protein C inhibitor. Purification from human plasma and characterization.
J Biol Chem
258:163, 1983[Abstract/Free Full Text]
15.
Suzuki K, Deyashiki Y, Nishioka J, Toma K:
Protein C inhibitor: Structure and function.
Thromb Haemost
61:337, 1989[Medline]
[Order article via Infotrieve]
16.
Scully MF, Toh CH, Hoogendoorn H, Manuel RP, Nesheim ME, Solymoss S, Giles AR:
Activation of protein C and its distribution between its inhibitors, protein C inhibitor, alpha 1-antitrypsin and alpha 2-macroglobulin, in patients with disseminated intravascular coagulation.
Thromb Haemost
69:448, 1993[Medline]
[Order article via Infotrieve] (erratum 70:377, 1993)
17.
Heeb MJ, España F, Griffin JH:
Inhibition and complexation of activated protein C by two major inhibitors in plasma.
Blood
73:446, 1989[Abstract/Free Full Text]
18.
van der Meer FJ, van Tilburg NH, van Wijngaarden A, van der Linden IK, Briet E, Bertina RM:
A second plasma inhibitor of activated protein C: Alpha 1-antitrypsin.
Thromb Haemost
62:756, 1989[Medline]
[Order article via Infotrieve]
19.
España F, Vicente V, Tabernero D, Scharrer I, Griffin JH:
Determination of plasma protein C inhibitor and of two activated protein C-inhibitor complexes in normals and in patients with intravascular coagulation and thrombotic disease.
Thromb Res
59:593, 1990[Medline]
[Order article via Infotrieve]
20.
Minamikawa K, Wada H, Wakita Y, Ohiwa M, Tanigawa M, Deguchi K, Hiraoka N, Huzioka H, Nishioka J, Hayashi T, Shirakawa S, Nakano T, Suzuki K:
Increased activated protein C-protein C inhibitor complex levels in patients with pulmonary embolism.
Thromb Haemost
71:192, 1994[Medline]
[Order article via Infotrieve]
21.
Nakase T, Wada H, Minamikawa K, Wakita Y, Shimura M, Hiyoyama K, Tamaki S, Shirakawa S, Deguchi K, Nisioka J, Hayashi T, Suzuki K:
Increased activated protein C-protein C inhibitor complex level in patients positive for lupus anticoagulant.
Blood Coagul Fibrinol
5:173, 1994[Medline]
[Order article via Infotrieve]
22.
Tabernero D, España F, Vicente V, Estelles A, Gilabert J, Aznar J:
Protein C inhibitor and other components of the protein C pathway in patients with acute deep vein thrombosis during heparin treatment.
Thromb Haemost
63:380, 1990[Medline]
[Order article via Infotrieve]
23.
Marlar RA, Endres BJ, Miller C:
Serial studies of protein C and its plasma inhibitor in patients with disseminated intravascular coagulation.
Blood
66:59, 1985[Abstract/Free Full Text]
24.
España F, Gruber A, Heeb MJ, Hanson SR, Harker LA, Griffin JH:
In vivo and in vitro complexes of activated protein C with two inhibitors in baboons.
Blood
77:1754, 1991[Abstract/Free Full Text]
25.
Geiger M, Huber K, Wojta J, Stingl L, España F, Griffin JH, Binder BR:
Complex formation between urokinase and plasma protein C inhibitor in vitro and in vivo.
Blood
74:722, 1989[Abstract/Free Full Text]
26.
Meijers JC, Kanters DHAJ, Riek AA, Vlooswijk RA, van Erp HE, Hessing M, Bouma BN:
Inactivation of human plasma kallikrein and factor XIa by protein C inhibitor.
Biochemistry
27:4231, 1988[Medline]
[Order article via Infotrieve]
27.
España F, Estelles A, Griffin JH, Aznar J:
Interaction of plasma kallikrein with protein C inhibitor in purified mixtures and in plasma.
Thromb Haemost
65:46, 1991[Medline]
[Order article via Infotrieve]
28.
Christensson A, Lilja H:
Complex formation between protein C inhibitor and prostate-specific antigen in vitro and in human semen.
Eur J Biochem
220:45, 1994[Medline]
[Order article via Infotrieve]
29.
Zheng XL, Geiger M, Ecke S, Resch I, Eberspächer U, Donner P, Schleuning WD, Binder BR:
Serine protease inhibitors (Serpins) in human seminal plasma: Concentrations and inhibition of acrosin.
Fibrinolysis
8:364, 1994
30.
Zheng XL, Geiger M, Ecke S, Bielek E, Donner P, Eberspächer U, Schleuning WD, Binder BR:
Inhibition of acrosin by protein C inhibitor and localization of protein C inhibitor to spermatozoa.
Am J Physiol
267:C466, 1994[Abstract/Free Full Text]
31.
Ecke S, Geiger M, Resch I, Jerabek I, Sting L, Maier M, Binder BR:
Inhibition of tissue kallikrein by protein C inhibitor. Evidence for identity of protein C inhibitor with the kallikrein binding protein.
J Biol Chem
267:7048, 1992[Abstract/Free Full Text]
32.
Laurell M, Christensson A, Abrahamsson PA, Stenflo J, Lilja H:
Protein C inhibitor in human body fluids. Seminal plasma is rich in inhibitor antigen deriving from cells throughout the male reproductive system.
J Clin Invest
89:1094, 1992
33.
Radtke KP, Fernandez JA, Greengard JS, Tang WW, Wilson CB, Loskutoff DJ, Scharrer I, Griffin JH:
Protein C inhibitor is expressed in tubular cells of human kidney.
J Clin Invest
94:2117, 1994
34.
Ecke S, Geiger M, Binder BR:
Heparin binding of protein C inhibitor. Analysis of the effect of heparin on the interaction of protein C inhibitor with tissue kallikrein.
Eur J Biochem
248:475, 1997[Medline]
[Order article via Infotrieve]
35.
Jane SM, Mitchell CA, Hau L, Salem HH:
Inhibition of activated protein C by platelets.
J Clin Invest
83:222, 1989
36.
Sidelmann J, Gram J, Pedersen OD, Jespersen J:
Influence of plasma platelets on activated protein C resistance assay (letter).
Thromb Haemost
74:993, 1995[Medline]
[Order article via Infotrieve]
37.
Hayashi S, Yamada K:
Binding of urinary protein C inhibitor to fibrin(ogen) and its binding mechanism.
Blood Coagul Fibrinol
4:153, 1993[Medline]
[Order article via Infotrieve]
38.
Rezaie AR, Cooper ST, Church FC, Esmon CT:
Protein C inhibitor is a potent inhibitor of the thrombin-thrombomodulin complex.
J Biol Chem
270:25336, 1995[Abstract/Free Full Text]
39.
Nakane PK, Kawaoi A:
Peroxidase-labeled antibody. A new method of conjugation.
J Histochem Cytochem
22:1081, 1974
40.
Komminoth P:
Digoxigenin as an alternative probe labeling for in situ hybridization.
Diagn Mol Pathol
1:142, 1992[Medline]
[Order article via Infotrieve]
41.
Sprengers ED, Akkerman JW, Jansen BG:
Blood platelet plasminogen activator inhibitor: Two different pools of endothelial cell type plasminogen activator inhibitor in human blood.
Thromb Haemost
55:325, 1986[Medline]
[Order article via Infotrieve]
42.
Booth NA, Simpson AJ, Croll A, Bennett B, MacGregor IR:
Plasminogen activator inhibitor (PAI-1) in plasma and platelets.
Br J Haematol
70:327, 1988[Medline]
[Order article via Infotrieve]
43.
Robbie LA, Bennett B, Croll AM, Brown PA, Booth NA:
Proteins of the fibrinolytic system in human thrombi.
Thromb Haemost
75:127, 1996[Medline]
[Order article via Infotrieve]
44.
Laurell M, Stenflo J:
Protein C inhibitor from human plasma: Characterization of native and cleaved inhibitor and demonstration of inhibitor complexes with plasma kallikrein.
Thromb Haemost
62:885, 1989[Medline]
[Order article via Infotrieve]
45.
Hogan M, Mattson JC, Estry DW, Klomparens K:
Biotinylated fibrinogen. A novel probe for monitoring post-ligand-binding events in platelets.
Ann NY Acad Sci
714:282, 1994[Medline]
[Order article via Infotrieve]
46.
Wencel-Drake JD, Boudignon-Proudhon C, Dieter MG, Criss AB, Parise LV:
Internalization of bound fibrinogen modulates platelet aggregation.
Blood
87:602, 1996[Abstract/Free Full Text]
47.
Priglinger U, Geiger M, Bielek E, Vanyek E, Binder BR:
Binding of urinary protein C inhibitor to human epithelial kidney tumor cells (TCL-598). The role of glycosaminoglycans present on the luminal cell surface.
J Biol Chem
269:14705, 1994[Abstract/Free Full Text]
48.
Jeanneau C, Sultan Y:
Tissue plasminogen activator in human megakaryocytes and platelets: Immunocytochemical localization, immunoblotting and zymographic analysis.
Thromb Haemost
59:529, 1988[Medline]
[Order article via Infotrieve]
49.
Mirlashari MR, Ryningen A, Mikkelsen HM, Fukami MH:
Differential secretion of blood platelet storage granules.
Platelets
7:313, 1996
50.
Rosa JP, George JN, Bainton DF, Nurden AT, Caen JP, McEver RP:
Gray platelet syndrome. Demonstration of alpha granule membranes that can fuse with the cell surface.
J Clin Invest
80:1138, 1987
51.
Handagama P, Scarborough RM, Shuman MA, Bainton DF:
Endocytosis of fibrinogen into megakaryocyte and platelet alpha-granules is mediated by alpha IIb beta (glycoprotein IIb-IIIa).
Blood
82:135, 1993[Abstract/Free Full Text]
52.
Carroll VA, Griffiths MR, Geiger M, Merlo C, Furlan M, Lämmle B, Binder BR:
Plasma protein C inhibitor is elevated in survivors of myocardial infarction.
Arterioscler Thromb Vasc Biol
17:114, 1997[Abstract/Free Full Text]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
P. Baumgartner, M. Geiger, S. Zieseniss, J. Malleier, J. A. Huntington, K. Hochrainer, E. Bielek, M. Stoeckelhuber, K. Lauber, D. Scherfeld, et al.
Phosphatidylethanolamine critically supports internalization of cell-penetrating protein C inhibitor
J. Cell Biol.,
November 19, 2007;
179(4):
793 - 804.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Malleier, O. Oskolkova, V. Bochkov, I. Jerabek, B. Sokolikova, T. Perkmann, J. Breuss, B. R. Binder, and M. Geiger
Regulation of protein C inhibitor (PCI) activity by specific oxidized and negatively charged phospholipids
Blood,
June 1, 2007;
109(11):
4769 - 4776.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. S. Donahue
Factor V Leiden and Perioperative Risk
Anesth. Analg.,
June 1, 2004;
98(6):
1623 - 1634.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Mairhofer, M. Steiner, W. Mosgoeller, R. Prohaska, and U. Salzer
Stomatin is a major lipid-raft component of platelet alpha granules
Blood,
July 18, 2002;
100(3):
897 - 904.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Huber, H. Boechzelt, B. Karten, M. Surboeck, V. N. Bochkov, B. R. Binder, W. Sattler, and N. Leitinger
Oxidized Cholesteryl Linoleates Stimulate Endothelial Cells to Bind Monocytes via the Extracellular Signal-Regulated Kinase 1/2 Pathway
Arterioscler. Thromb. Vasc. Biol.,
April 1, 2002;
22(4):
581 - 586.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. M. Meijers;, M. J. Prendes, B. R. Binder, and M. Geiger
Protein C inhibitor in platelets?
Blood,
March 1, 2000;
95(5):
1880 - 1881.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Huber, H. Boechzelt, B. Karten, M. Surboeck, V. N. Bochkov, B. R. Binder, W. Sattler, and N. Leitinger
Oxidized Cholesteryl Linoleates Stimulate Endothelial Cells to Bind Monocytes via the Extracellular Signal-Regulated Kinase 1/2 Pathway
Arterioscler. Thromb. Vasc. Biol.,
April 1, 2002;
22(4):
581 - 586.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|