|
|
Next Article 
Blood, Vol. 94 No. 5 (September 1), 1999:
pp. 1495-1503
Functional and Molecular Analysis of Hematopoietic Progenitors Derived
From the Aorta-Gonad-Mesonephros Region of the Mouse Embryo
By
Sylvie Delassus,
Ian Titley, and
Tariq Enver
From the Section of Gene Function and Regulation and the Leukaemia
Research Fund Centre, Institute of Cancer Research, Chester Beatty
Laboratories, London, UK.
 |
ABSTRACT |
Herein, we show that CD34, c-kit double-positive
(CD34+c-kit+) cells from the
aorta-gonad-mesonephros (AGM) region of the developing mouse are
multipotent in vitro and can undergo both B-lymphoid and multimyeloid
differentiation. Molecular analysis of individual CD34+c-kit+ cells by single-cell reverse
transcriptase-polymerase chain reaction (RT-PCR) shows coactivation of
erythroid ( -globin) and myeloid (myeloperoxidase [MPO]) but not
lymphoid-affiliated (CD3, Thy-1, and  5) genes. Additionally, most
cells coexpress the stem cell-associated transcriptional regulators
AML-1, PU.1, GATA-2 and Lmo2, as well as the granulocyte
colony-stimulating factor receptor (G-CSF-R). These results show that
the CD34+c-kit+ population from the AGM
represents a highly enriched source of multipotent hematopoietic cells,
and suggest that limited coactivation of distinct lineage-affiliated
genes is an early event in the generation of hematopoietic stem and
progenitor cells during ontogeny.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
CONSIDERABLE INTEREST currently surrounds
intraembryonic hematopoietic progenitor cells located in the
aorta-gonad-mesonephros (AGM) region and its anlage, the para-aortic
splanchnopleura. The interest focuses both on the origin of
intraembryonic stem cells from mesodermal elements and on their own
functional capacity in terms of hematopoietic output.1
With regard to origin, the precise relationship of these intraembryonic
stem cells to extraembryonic or yolk sac-derived progenitors remains
an area of considerable debate.2 However, recent evidence suggests that hematopoietic stem-cell activity, at least within the
AGM, may derive from a classic induction of bipotent
endothelial-hematopoietic precursors (hemangioblasts) mediated by
oncostatin-M.3 A better molecular characterization of early
hematopoietic stem cells may help in clarifying their origin.
With respect to output, AGM cells are the first cells within the
developing mouse embryo capable of long-term reconstitution of lethally
irradiated adult recipients.4 Recent studies using newborn
animals as recipients have shown that paraaortic splanchnopleural cells
and yolk-sac cells from day 9 embryos have long-term reconstitution potential.5 In all cases, the activity resides within the
CD34+ c-kit+ population,6,7 which
is consistent, to an extent, with descriptive studies of CD34
expression in developing mouse and human embryos.8-10 These
investigations identified CD34+ cells both in the
mesenchyme surrounding the dorsal aorta at the level of the AGM and
budding from the internal wall of the aorta in the same region.
Our own interest in AGM-derived stem cells relates to their potential
utility as a model system for the analysis of hematopoietic lineage
specification. Although the CD34+c-kit+
populations from both day 11 mouse AGM and fetal liver clearly contain
hematopoietic stem cells, large numbers of cells from these populations
are required to produce long-term reconstitution of adult recipients:
injection of 4 × 103 CD34+c-kit+
AGM cells per mouse reconstitutes about 30% of the recipients, whereas
10 times more CD34+c-kit+ fetal liver cells are
required to obtain the same result.6 The reason for this
low efficiency of long-term reconstitution is not immediately clear,
although it may partly reflect a lack of compatibility between
embryonic/fetal stem cells and the adult microenvironment.5,11 Alternatively, the
CD34+c-kit+ population may be heterogeneous at
the functional level, the molecular level, or both. Indeed, several
recent studies have emphasized the importance of single-cell approaches
in delineating mechanisms in lineage specification,12 and
to this end, we have analyzed the functional potential of individual
AGM-derived CD34+c-kit+ progenitors and some
aspects of their "ground state" at the molecular level.
| |
MATERIALS AND METHODS |
Cell preparation.
The liver and the AGM region were dissected from F1 embryos of
CBAxC57BL/10 crosses with the embryonic age determined as described previously,13 with the production of a vaginal plug
denoting day 0. Cell suspensions were prepared by passing the organs
through a 70-µm mesh nylon cell strainer (Becton Dickinson Labware,
Franklin Lakes, NJ). Adult bone marrow was obtained by flushing the
femurs of 3-week-old CBA female mice with Dulbecco's modified Eagle's medium (GIBCO-BRL, Paisley, UK).
Flow cytometry and sorting.
The method for the reaction of cell suspensions with antibodies for
flow cytometry has been described previously.14 In our case, cell preparations were treated with combinations of antibodies to
the CD34 molecule (clone RAM34, conjugated to fluorescein
isothiocyanate [FITC]) and c-kit (CD117, clone 2B8, conjugated to
phycoerythrin [PE]) or antibodies to IgM (clone R6-60.2, FITC) and
B220 (CD45R, clone RA3-6B2, PE). All antibodies were obtained from
Pharmingen (San Diego, CA).
Flow-cytometric analysis was performed on a FACScan flow cytometer
using Lysis II software (Becton Dickinson, Mountain View, CA) with
10,000 events recorded for each sample. Dead cells were identified and
excluded from the analysis by addition of propidium iodide to the
sample. Single CD34+c-kit+ cells were sorted
using a FACStar flow sorter fitted with an automated cell-deposition
unit under the control of a Consort 30 computer system (Becton Dickinson).
Determination of differentiation potential.
The ability of single CD34+c-kit+ cells to
undergo differentiation into different hematopoietic lineages was
tested using a modification of a previously described
method.15 Briefly, single CD34+c-kit+ cells were sorted into 96-well
microtest tissue culture plates (Becton Dickinson) containing a layer
of irradiated mouse S17 stromal cells. These were then cultured in
Opti-MEM (GIBCO-BRL) with interleukin-7 (IL-7), c-kit ligand
(description follows), and 2-mercaptoethanol and fed and checked every
7 days. After 14 to 34 days in culture, the clones were split and
either grown in the presence of WEHI-conditioned medium (description
follows) and c-kit ligand (myeloid differentiation conditions) or on
S17 stroma in the presence of IL-7 (pre-B-cell conditions). After 14 days, cytospins were made for the cells grown in myeloid conditions, and these were analyzed by microscopy after staining with the May-Grünwald-Giemsa technique, whereas those grown in pre-B-cell conditions were analyzed by flow cytometry for the presence of mature
B-cell markers.
Cytokines.
IL-7 was obtained from J558 myeloma cells transfected with c-DNA (a
gift from Dr A. Rolink, Basel, Switzerland) and used at a final
concentration of 50 to 100 U/mL. Chinese hamster ovary cells were
stably transfected with cDNA that codes for the c-kit ligand (Genetics
Institute, Boston, MA), and the supernatant was titrated against
c-kit-dependent mast cells and thus used at a 1:250 dilution.
WEHI-conditioned medium was produced as described previously16 and was titrated against FDCP-mix cells and
used at a 1:10 dilution.
Analysis of single cells by reverse transcriptase-polymerase chain
reaction.
As previously described,17 single cells were deposited into
96-well polymerase chain reaction (PCR) plates containing 4 µL lysis
buffer (0.4% Nonidet P-40, 60 µmol/L dNTPs, 25 µmol/L dithiothreitol, and 0.5 U/µL RNAsin [Promega, Madison,
WI]) and lysed for 15 minutes on ice. Cell lysates were
reverse-transcribed using multiple (up to 8) pairs of gene-specific
primers and 48 U MMLV-RT per reaction in the buffer provided by the
supplier (GIBCO-BRL). The first-round PCR with 35 cycles was performed by addition of 40 µL PCR buffer and 1.25 U Taq polymerase (Cetus, Emeryville, CA). One-microliter aliquots of first-round PCRs were further amplified using fully nested gene-specific primers. Aliquots of
second-round PCR products were subjected to gel electrophoresis and
visualized by ethidium bromide staining. The primers used in
first-round PCRs were as follows: CD34, TTGACTTCTGCAACCACGGA and
TAGATGGCAGGCTGGACTTC18; c-kit, GGCTCATAAATGGCATGCTC and TATCTCCTCGAGAACCTTCC19; erythropoietin receptor
(EPO-R), CGCTACACCTTCGCTGTTCG and
CAAACTCGCTCTCTGGGCTT20; granulocyte colony-stimulating
factor receptor (G-CSF-R), ACAGGAGTGTGAACTTCGCT and
TTGCTTCTTCTGACACCACG21; Lmo2, TGGATGAGGTGCTGCAGATA and
CCCATTGATCTTGGTCCACT; AML-1, ACTTCCTCTGCTCCGTGCTA and
GTCCACTGTGATTTTGATGGC; PU-1, GATGGAGAAAGCCATAGCGA and
TTGTGCTTGGACGAGAACTG; GATA-2, TTCTTCTGCAGGGGGTAGTGTAG and
GGTGACTTCTCTTGCATGCACTT; myeloperoxidase (MPO), CGCTTCTCCTTCTTCACTGG
and CTGCCATTGTCTTGGAATCG22; -globin, AGACCTATCCTCTGCCTCTG and CCACTCCAGCCACCA(CG)CTTC23; Thy-1,
AGAAGGTGACCAGCCTGACA and GTTCTGAACCAGCAGGCTTA; CD3 ,
TTGTGACCTGCAATACCAGC and TTGGTTGATCACAGGGGAA; and 5,
AGTTCTCCTCCTGCTGCTGC and CCCACCACCAAAGACATACC.24 The primers used in second-round PCRs were as follows: CD34,
ATCCCCATCAGTTCCTACCA and GTAGGCAGTATGCCAGTTGG; c-kit,
ACAGGAGCAGAGCAAAGGTG and CGACCACAAAGCCAATGAGC; EPO-R,
TCTGGAGTGCCTGGTCTGAG and GCTCTCTGGGCTTGGGATGC; G-CSF-R, TACCAGCCACAGCTCAAAGG and ACGTGTCCAGTCTGATGGTG; Lmo2,
GTACTGGCATGAGGATTGCC and TGTCGGAGTTGATGAGAAGGT; AML-1,
ACTCACTGGCGCTGCAACAA and AAGCTCTTGCCTCTACCGCT; PU-1,
AACCACTTCACAGAGCTGCA and CAAGCCATCAGCTTCTCCAT; GATA-2,
GACTATGGCAGCAGTCTCTTCC and GGTGGTTGTCGTCTGACAATT; MPO,
ACTGGCCTCAACTGCGAGAC and GTGTATTGACAGCCAGCAGC; -globin,
A(AG)(AG)GT(GC)AAGGCCCATGGCAA and CA(CG)CTTCTG(GC)(AC)AGGCAGCCT; Thy-1,
CACCAAGGATAACTCCATCC and GCCACACTTGACCAGCTTGT; CD3,
GCATCTAGATGGAACGGTGG and CTTCACGATCTCGAAGAGGC; and 5,
GGGTCTAGTGGATGGTGTCC and CAAAACTGGGGCTTAGATGG.
Reverse transcriptase-PCR analysis of sorted populations.
Total RNA was extracted from 1.5 × 103
CD34+c-kit+ sorted AGM cells and from 1 × 106 MEL, WEHI-3B, or S17 cells. cDNA synthesis was
initiated using random primers, and reaction products were resuspended
in water at a concentration corresponding to approximately 50 cells/µL. To ensure that the PCR was performed during the exponential
phase, serial dilutions of the sample were then submitted to 40 cycles of PCR using HPRT, MPO, or -globin first-round primers. The products were then loaded on agarose gels, and the gels were Southern-blotted and probed with the following radiolabeled probes: HPRT probe, CAGTCAACGGGGGACATAAAAG; MPO probe, GTGTATTGACAGCCAGCAGC; and -globin probe, CA(CG)CTTCTG(GC)(AC)AGGCAGCCT. Degeneracy in the globin probe
allows hybridization to products derived from embryonic and adult
-globin genes. Hybridization was performed at 42°C, and the
filters were washed at the same temperature in 1× SSC (1× SSC is
0.15 mol/L NaCl plus 0.015 mol/L sodium citrate) and revealed using a
phosphor screen and phosphoimager (Molecular Dynamics, Sunnyvale, CA).
MadgeBio gel apparatus.
Single-cell PCR products were analyzed by electrophoresis on agarose
MadgeBio gels (MadgeBio Ltd, Nottingham, UK). These 96-well gels are
structured with the exact same format as 96-well microtiter plates.
Samples are transferred directly from the PCR plate into Madge gels,
and electrophoresis is performed at an angle of 18.4° to the axis of
the rows such that the tracks pass across 3 column gaps, thereby
providing a 2.65-cm path length. Extra wells for size standards allow
size determination of the PCR products.
| |
RESULTS |
Differentiation potential in vitro.
Single-cell suspensions of day 11 AGM and fetal liver were labeled with
anti-mouse CD34 and anti-mouse c-kit antibodies (see Materials and
Methods), and double-positive cells were obtained by FACSorting.
Because CD34+c-kit+ cells represent a small
percentage of AGM cells, the sorting gate was defined using fetal liver
samples, in which the CD34+c-kit+ population is
more readily identifiable (Fig 1A). In
addition, a small gate was set to obtain the highest purity possible.
The fidelity of cell sorting in both AGM and fetal liver samples was confirmed by subsequent validation of CD34 and c-kit gene expression by
RT-PCR analysis of single sorted cells. Furthermore, these control
experiments showed that in the case of the AGM samples, an average of
40% of the wells did not contain any cell. This inefficiency in
sorting is not entirely surprising given the low percentage of
CD34+c-kit+ cells in the AGM population.
View larger version (79K):
[in this window]
[in a new window]
| Fig 1.
In vitro differentiation potential of
CD34+c-kit+ cells from day 11 AGM and fetal
liver. (A) FACSorting of CD34-FITC/c-kit-PE staining of day 11 fetal
liver and AGM cells. Sorting gates were set using isotype-specific
control antibodies, and dead cells were excluded using propidium iodide
staining. The percentage of double-positive cells is 2.1% (fetal
liver) and 0.1% (AGM). (B) Summary of the 2-step culture assay to test
the differentiation potential of single
CD34+/c-kit+ cells. (C) Photomicrograph of
clone 1G12 after 13 days in culture under "multipotent
conditions." (D) Photomicrograph of clone 1G12 after 13 days of
culture under lymphoid differentiation conditions. (E) Photomicrograph
of clone 1G12 cultured for 13 days under myeloid conditions. (F)
FACSscan analysis of the cells in panel D using anti-B220 and anti-IgM
antibodies. (G) May-Grünwald-Giemsa staining of the cells in
panel E; note the multimyeloid nature of the clone. The open arrowhead
indicates a megakaryocyte; filled arrowheads indicate macrophages;
arrows indicate myeloid cells of the granulocytic series; and the bar
indicates a cluster of basophilic myeloid cells.
|
|
The functional potential of individual
CD34+c-kit+ cells obtained in this manner was
assessed using a previously reported 2-step in vitro differentiation
assay15 (Fig 1B). This assay has been shown to allow
multipotent cells to develop and subsequently differentiate into all
hematopoietic lineages.25,26 In the first step of the
assay, single cells are cultured on irradiated stromal S17 cell
monolayers and expanded in the presence of IL-7, 2-Me, and c-kit
ligand. The second step of the assay occurs after 14 to 28 days when
growing clones are harvested and split. Half of the cells of the clone
are cultured under conditions that promote the growth and
differentiation of B lymphocytes (namely IL-7 and 2-Me), while the
remaining half are cultured under conditions that promote myeloid cell
development (in the presence of c-kit ligand and WEHI-conditioned
medium). Single CD34+c-kit+ cells from day 11 AGM were assayed using this procedure;
CD34+c-kit+ cells from day 11 fetal liver and
adult bone marrow served as controls.
CD34+c-kit+ AGM cells are
multipotent.
Under the conditions already described, the cloning efficiency was 22%
(~1 cell in 5) for AGM cells. However, when corrected for the number
of empty wells observed in the sorted AGM populations, the cloning
efficiency may be calculated at 37%.
Three types of clones derived from CD34+c-kit+
AGM cells were identified: (1) clones with a restricted myeloid
potential that were able to differentiate into either macrophages and
megakaryocytes or macrophages only; none of these clones were able to
produce B cells; (2) multimyeloid clones that showed the ability to
differentiate into at least 3 myeloid lineages (mainly macrophages,
megakaryocytes, and granular polymorphonuclear cells) but were not able
to differentiate into B lymphocytes; and (3) multipotent clones that
displayed a multimyeloid potentiality and the ability to yield B cells. An example of such a clone is shown in Fig 1C to G: panel C shows the
clone after 2 weeks of culture in multipotent conditions, and panels D
and E show the clone grown under lymphoid and myeloid conditions,
respectively. Verification of the lymphoid and multimyeloid nature of
the resulting cells was performed by either immunophenotyping of
lymphoid cells (Fig 1F) or May-Grünwald-Giemsa staining of myeloid cells (Fig 1G). Taking all our experiments together, these lymphomyeloid stem cells represented 38% of the total clonogenic population, while cells with multimyeloid potential but lacking B-lymphoid potential represented 49%, and bilineage and unilineage restricted precursors accounted for approximately 13%.
To compare our data with previously reported stem-cell activity in the
embryo, we also studied the differentiation potential of
CD34+c-kit+ cells from day 11 fetal liver and
from adult bone marrow. Table 1 shows the
clone types in the different samples. Even when taking the cloning
efficiency into account, the results show that the CD34+c-kit+ population from AGM is mainly
composed of multipotent hematopoietic progenitors, while they represent
a smaller fraction of the same population from fetal liver at the same
stage of development. No multipotent progenitors could be detected in
the CD34+c-kit+ population from bone marrow,
presumably reflecting their low frequency in this population.
The high frequency of unilineage and bilineage committed precursors in
the fetal liver and bone marrow samples suggested that the S17 culture
system was capable of supporting the growth and development of less
primitive progenitor cells. This, in turn, suggested that the high
frequency of multipotent and multimyeloid colonies found in the AGM
samples is a true reflection of the developmental potential of the
CD34+c-kit+ population in the AGM and is not a
result of a multipotent/multimyeloid bias in the culture system. To
explore this further, we directly plated AGM
CD34+c-kit+ cells into S17 cultures
supplemented with myeloid growth factors including EPO. Consistent with
the data obtained in the 2-step S17 culture assay, AGM cells primarily
yielded multimyeloid colonies in this 1-step culture system
(lymphopoiesis is not supported by these myeloid growth factor
conditions), with few unilineage and bilineage colonies observed. These
results are also consistent with experiments recently performed by
Cumano et al (personal communication, September 1998), who
have also observed that few EPO-dependent progenitors are present in
the AGM at day 11. Those that do arise occur with a frequency similar
to that found in cultures derived from embryo remnants, and are thus
presumed to result from contamination due to embryonic blood
circulation occurring at this stage of development.
Thus, although several thousand CD34+c-kit+ AGM
cells are required for long-term reconstitution of adult recipients, a
large fraction (8% or 14% when corrected for empty wells) have
lympho-myeloid differentiation capacity as shown by these in vitro
assays. This population may thus provide a tractable model system for
the study of stem-cell fate, and we therefore sought to further
characterize it at the molecular level. Since molecular analysis at the
population level obscures any heterogeneity that may exist between
individual cells, these studies were performed at the single-cell level
using single-cell RT-PCR.
Single-cell RT-PCR.
To perform single-cell RT-PCR analysis, we used a method developed in
our laboratory.17 This method uses gene-specific primers for reverse transcription, followed by 2 rounds of PCR with fully nested primer sets. The resulting high sensitivity of this method requires that appropriate controls be performed to ensure confidence in
the specificity of detected expression. In control experiments with
unilineage committed erythroid and myeloid cell lines, we were able to
detect erythroid-affiliated gene expression (for example, -globin
and GATA-1) only in erythroid-committed cells, not in myeloid-committed
cells. Similarly, we could only detect myeloid-associated gene
expression (for example, MPO) in myeloid-committed cells, not in
erythroid-committed cells. Expression of these hematopoietic genes was
not detected in nonhematopoietic cell lines, nor was expression of
nonhematopoietic genes (for example, EGF receptor) observed in any of
the hematopoietic cells we tested.17 Data such as these
encouraged confidence in the specificity of this method, although its
sensitivity restricts its utility to qualitative as opposed to
quantitative analysis.
The single-cell RT-PCR method has already been described in
detail.17 Briefly, single
CD34+c-kit+ cells were obtained by FACSorting
and lysed. Reverse transcription was performed using gene-specific
primers prior to a multiplex first-round PCR. Aliquots of this reaction
were used in separate second-round PCRs using fully nested primers for
the individual genes of interest. Figure 2
shows typical amplification products obtained on single sorted AGM
cells. The analyses of CD34 and c-kit mRNAs serve as controls for the
RT-PCR procedure and for the fidelity of FACSorting. Consistent with
our previous studies of multipotent cell lines and primary multipotent
cells freshly isolated from bone marrow, most
CD34+c-kit+ AGM cells express G-CSF-R, whereas
few express EPO receptor (EPO-R).
View larger version (60K):
[in this window]
[in a new window]
| Fig 2.
Gene expression in individual
CD34+c-kit+ AGM cells.
CD34+c-kit+ cells from AGM were
individually sorted into 0.2-mL microtubes containing lysis buffer.
Multiplex single-cell RT-PCR analysis was performed. The gel shows
analysis of CD34, c-kit, EPO-R, G-CSF-R, and Lmo2. In each case,
position 1 does not contain any cells and serves as a negative control,
whereas position 12 contains 10 cells. The remaining positions (2-11)
represent the amplification reactions of single cells. The expected
migration position and molecular weight of appropriate RT-PCR products
is indicated.
|
|
We next examined the expression patterns of Lmo2, AML-1, PU.1, and
GATA-2, since these transcription factors have been implicated in the
early stages of hematopoietic development by virtue of the
panhematopoietic or multilineage deficits observed in the corresponding
knockout mice. Expression of these factors may therefore be intimately
linked to the determination of hematopoietic or stem-cell potential.
Mice lacking Lmo2 function are bloodless and die at about embryonic day
10 (E10).27 The importance of this gene in the
differentiation along the nonerythroid pathways is still unclear, but
most lineages seem to be affected.28 The analysis of AML-1
knockout mice suggests a block in the development of all definitive
hematopoietic lineages leading to fetal death by E12.5, but primitive
hematopoiesis is not affected.29 Mice lacking PU.1 die 1 to
3 days before birth.30 The principal hematopoietic defects
are the absence of monocytes, granulocytes, and T and B lymphocytes;
erythroid precursors are present and -globin gene expression is
unaffected. Mice lacking GATA-2 function die at about E10.5. Although
all hematopoietic lineages are affected, stem cells are present but
appear to be deficient in their self-renewal/proliferative capacities.31,32
Single cells were sorted and a multiplex first-round PCR was performed
using specific primers for CD34, c-kit, PU.1, AML-1, and Lmo2.
Individual second rounds of amplification were performed using nested
primers. Figure 2 shows representative data from Lmo2 reactions, and
Fig 3 summarizes PU.1, AML-1, and Lmo2
expression patterns for the cells that were PCR-positive for CD34 and
c-kit. In averaging 2 independent experiments, 89% of AGM cells
expressed Lmo2, 73% expressed PU.1, and 71% were positive for AML-1;
GATA-2 was expressed by an average of 60% of cells (data not shown). These frequencies of coexpression suggest that AGM cells are reasonably homogeneous with respect to expression of these factors, which therefore presumably do not define subpopulations of committed or
lineage-restricted cells within the CD34+c-kit+
AGM compartment.
View larger version (20K):
[in this window]
[in a new window]
| Fig 3.
Summary of Lmo2, AML-1, and PU.1 gene-expression programs
of individual CD34+c-kit+ cells. The first
4 positions (A1-A4) contain no cells and serve as negative controls,
and the last 4 positions (E2-E5) contain 10 cells each and serve as
positive controls. The remaining positions represent the amplification
reactions of single cells, with the presence of a symbol indicating
positive amplification for the gene product indicated.
|
|
Coactivation of erythroid and myeloid programs.
Previous analyses of single adult multipotent cells and cell lines have
led to the hypothesis that individual multipotential cells may prime
more than 1 lineage-affiliated program of gene expression before
exclusive commitment and differentiation to a single hematopoietic
lineage.17 For example, genes such as -globin and MPO
that encode erythroid- and myeloid-affiliated lineage-specific
functions33 were found to be expressed, at least at low
level, ahead of an exclusive unilineage commitment decision to either
erythroid or myeloid cell fates. We therefore studied the expression of
some key lineage-affiliated genes in day 11 AGM cells. Hu et
al17 showed that the neutrophil-specific MPO gene is
expressed in a large percentage of FDCP-mix and is often coexpressed
with -globin.17 We found that over 90% of day 11 CD34+c-kit+ AGM or liver cells express MPO and
that about 50% of them coexpress -globin. This is illustrated in
Fig 4A, showing an agarose
MadgeBio gel (see Materials and Methods) run of RT-PCR products from a representative experiment. The first 4 lanes are amplification products
for MPO on single CD34+c-kit+ AGM cells, while
the last 4 lanes show products for -globin on the same cells.
Analysis of single positive cells
(CD34+c-kit or
CD34c-kit+) from AGM seldom showed
coexpression of MPO and -globin. In all experiments performed, we
never observed coexpression of MPO and -globin in
CD34c-kit+ cells, while only 10% of
CD34+c-kit cells exhibited dual expression
(data not shown).
View larger version (45K):
[in this window]
[in a new window]
| Fig 4.
Coexpression of MPO and -globin in individual
CD34+c-kit+ AGM cells. (A) Individual cells
were subjected to multiplex 2-round RT-PCR using primers specific for
CD34, c-kit, MPO, and -globin. Second-round -globin and MPO PCR
products from CD34+c-kit+ cells were
electrophoresed on an agarose MadgeBio gel, with MPO products on the
left side and -globin products on the right side. The migration
direction of the gel is indicated by the large open arrow, and negative
control reactions are indicated by the offset small arrows. The 2 most
leftward wells of the first and fifth lanes do not contain any cells
and serve as negative controls. Note the high frequency of cells that
score positive for both MPO and -globin. m, marker #6
(Roche Diagnostics, Lewes, UK). (B) Analysis of gene
expression in sorted CD34+c-kit+ AGM cells
compared with different cell lines. Several dilutions of each cDNA were
amplified to ensure quantitation. The amount shown corresponded to
nonsaturated PCR. MEL cells were used as a positive control for globin
expression and WEHI-3B for MPO expression, while S17 was used as an
example of a nonhematopoietic cell line. The clone of MEL cells used
here is HPRT-negative, but the amount of cDNA used was controlled by OD
to be equivalent to the other cDNAs amplified here.
|
|
As previously discussed, the single-cell method described here provides
only qualitative data regarding the cell distribution of specific
transcripts and provides little or no information with regard to the
level. The level of expression of lineage-affiliated genes like
-globin or MPO is not a priori expected to be particularly high in
multipotential cells, as expression in this compartment is not likely
related to the function of these products in these cells, but is
instead a reflection of the priming of these loci for future activity
in appropriate unilineage committed cells (see Discussion). Indeed,
using a different single-cell RT-PCR method, Brady et al34
detected -globin and MPO transcripts in unilineage committed cells,
but not in multipotent cells. This may partly reflect different
sensitivities in the methodologies used or different criteria in
selection of the cells analyzed.
To gain an appreciation of the level of expression of MPO and
-globin in AGM cells, we prepared total cDNA from a population of
sorted CD34+c-kit+ AGM cells. After reverse
transcription and 1 round of PCR for -globin, MPO, and HPRT,
reaction products were fractionated on agarose gels, blotted, and
hybridized with radiolabeled oligomers specific for the -globin,
MPO, and HPRT products, respectively. The results presented in Fig 4B
are from cDNA dilutions that do not yield saturated signals by PCR and
show that both -globin and MPO can be easily detected in the
CD34+c-kit+ population of AGM cells. In
contrast, only -globin is detected in the erythroid committed cell
line MEL, and only MPO is detected in the myeloid committed cell line
WEHI-3B. Neither -globin nor MPO were detected in the
nonhematopoietic stromal cell line S17. HPRT serves as a loading
control for these experiments except in the case of MEL cells, which
are mutant at the HPRT locus and do not express HPRT.
Analysis of lymphoid genes.
Expression of the lymphoid-specific genes Thy-1, CD3, and 5 was also
studied using single-cell RT-PCR. Thy-1 is a surface marker for
thymocytes and T cells that is expressed very early in T-cell
development, prior to CD3 expression.35 Thy-1 is also expressed at a low level in mouse (C57BL/Ka-Thy-1.1) bone marrow, where
the Thy-1.1lo, Sca-1hi, lin
population has been shown to contain all of the multipotent
progenitors.36 Additionally, Thy-1 is expressed outside of
the hematopoietic system, most notably in cells of the nervous
system.37 The CD3 gene of the CD3 complex of the T-cell
receptor is 1 of the earliest definitive markers of T-cell
differentiation.27 5 is 1 of the 2 chains comprising the
surrogate light chain of the pre-B receptor.38,39 Figure
5 shows the signals obtained with single
cells after amplification of the mRNAs for these genes from AGM cells,
as well as from control cells known to express these different genes.
We were not able to detect any cells expressing 5 or CD3, and only
2% to 4% of CD34+c-kit+ AGM cells were
positive for Thy-1 expression. This is consistent with data reported by
Sanchez et al,6 who examined the surface expression of
Thy-1.2 on AGM cells by flow cytometry. In these studies, while 9.5%
of AGM cells were scored positive for Thy-1.2 expression, only 0.5% of
c-kit+ AGM cells expressed Thy-1.2.
View larger version (40K):
[in this window]
[in a new window]
| Fig 5.
Expression of Thy-1, CD3, and 5 in individual
CD34+c-kit+ cells from AGM or from control
cell lines. Cells were analyzed as previously described. Position 1 does not contain any cells and serves as a negative control, positions
2-11 contain single cells, and position 12 contains 10 cells. Product
sizes are indicated.
|
|
| |
DISCUSSION |
AGM cells as an in vitro model.
Previous studies have shown that the long-term reconstitution activity
of AGM cells resides within the CD34+c-kit+
population.6 Our present in vitro analysis of the
CD34+c-kit+ population at the level of single
cells has revealed the following. (1) The incidence of clonogenic cells
is surprisingly high. This may relate to the cycling status of these
cells: certainly, an actively cycling population would square with the
hypothesis that the AGM is a site of stem-cell development or expansion
in the early embryo.40 (2) A high percentage of AGM-derived
clonogenic cells in our experiments retain both multimyeloid and
B-lymphoid differentiation potential. Previous experiments have shown
that all P-Sp clones with B-cell potential are able to differentiate into T lymphocytes25 and that this is also the case for all day 11 liver- or blood-derived clones.15 While we have not
tested the T-lymphoid differentiation potential of
CD34+c-kit+ AGM cells directly in the
experiments described here, it seems likely that AGM cells with
multimyeloid and B-lymphoid potential also possess T-lymphoid
differentiation capacity.
Our data show that in the CD34+c-kit+
population from day 11 AGM, 1 in 6 cells, at the very least, is
multimyeloid and 1 in 12 is also able to differentiate into
lymphocytes. This frequency is in agreement with the published
frequency of cells able to form CFU-S40,41 but is much
higher than the frequency of cells able to reconstitute irradiated
adult recipients.6 This could indicate that the majority of
cells that have a multipotent phenotype in vitro are not hematopoietic
stem cells; alternatively, recent studies using conditioned newborn
mice as recipients for reconstitution with embryonic cells seem to
indicate that the discrepancy might be due to a failure of embryonic
stem cells to engraft in adult recipients.5,7,11 Although
AGM cells have not yet been tested under these conditions, it is
possible that the frequency of reconstituting cells in newborns may
better reflect the frequency of multipotent cells detected in our in
vitro studies.
Our data thus suggest that cells from the AGM will provide a valuable
model system in which to examine and experimentally manipulate
hematopoietic lineage specification processes in vitro. In particular,
the high frequency of multipotent cells predicts that daughter-cell
experiments will prove fruitful. AGM cells should also prove uniquely
valuable in the study of knockout mice with hematopoietic defects. The
effects on hematopoiesis of otherwise lethal mutations can be studied
in in vitro AGM cultures, as long as these cells themselves are
generated and the embryos survive to at least day 10 to 11 of gestation.
Multilineage priming.
Previous studies have documented low-level transcription of genes with
known lineage-affiliated function (such as -globin) in adult
multipotential cell lines (FDCP-mix A4), as well as multipotential cells freshly isolated from adult mouse bone marrow.17
Importantly, transcripts characteristic of distinct lineages (eg,
-globin and MPO) did not segregate to different cells within the
population, but were frequently found to be coexpressed in a large
percentage of individual cells. Evidence provided in this report
suggests that this coexpression of lineage-affiliated markers in
multipotent progenitors is not unique to the adult stage of
hematopoiesis, nor is it simply a function of continually forced
self-renewal of multipotential cell lines in cell culture. Rather, such
limited coactivation of lineage-affiliated genes such as -globin and MPO appears to be an early event in the ontogeny of the hematopoietic system. Thus, the molecular process underlying the priming of these
loci may be closely coupled or associated with the registration of
hematopoietic potential.
While the specificity of the low-level transcription observed in these
cells seems secure enough (ie, nonhematopoietic-associated transcripts
are not detected), its precise significance remains speculative. Our
results are consistent with the notion that the expression of genes
like MPO or -globin occurs in cells that have multipotent or at
least multimyeloid potential. Certainly, it occurs within cells that
coexpress transcription factors such as AML-1, Lmo2, and PU.1, since
these encompass the vast majority of cells analyzed; RT-PCR experiments
on single AGM cells have confirmed this (data not shown). Arguably, the
cloning efficiency of the cells used in our experiments precludes
formal assignment of a -globin/MPO phenotype to a cell with proven
multipotent potential. When our data are adjusted for the frequency of
wells that contain no cells after sorting, we estimate that
approximately 33% of AGM cells are capable of generating multilineage
colonies in vitro. An additional 2% to 3% yield bilineage or
unilineage colonies after 2-step culture. This leaves approximately
65% of the sorted population that is not clonogenic under these
conditions and whose developmental potential therefore cannot be
categorically determined. There is no a priori reason to assume that
these cells are particularly different in their lineage potential
versus those that do produce colonies in vitro. Certainly, we have
found little evidence for more committed cells in this population using
the 2-step culture system or in different culture systems for the growth and development of more committed progenitors. Given that at
least 90% of the AGM cells analyzed express MPO, we can safely infer
that MPO is expressed (or rather primed) in at least some multipotent
AGM cells. Since 50% of CD34+c-kit+ AGM cells
coexpress MPO and -globin (note that coexpression of -globin and
MPO is seldom found in single CD34+ or c-kit+
AGM cells), it is formally possible that these coexpressing cells lie
specifically within the 65% that do not give rise to colonies. However, by applying Ockham's razor, the simplest and most plausible explanation consistent with the current culture data and molecular analyses is that coexpression occurs within multilineage-potential hematopoietic cells, and this interpretation of the data agrees well
with previous studies in this area.
Our favored interpretation with regard to the nature of this low-level
or sporadic transcription is that it reflects the partially accessible
nature, or "primed" configuration, of the chromatin structure at
the loci in question. Evidence for this primed chromatin configuration
has been obtained in multipotential cell line models such as FDCP-mix
A4, where appropriate numbers of cells for chromatin and biochemical
analyses are readily obtainable.42-46 Similar observations have also been made on human leukemic cells and cell
lines.47 We have also speculated that priming may be
achieved by so-called "stand-in" factors rather than by the set
of transcription factors normally associated with high-level
transcriptional output of lineage-affiliated loci in terminally
differentiated unilineage-committed cells.42 Transcription
factors such as Lmo2, AML-1, PU.1, and GATA-2, where gene targeting has
revealed an early hematopoietic defect and which we show to be
consistently coexpressed in multipotential AGM cells, may be prime
candidates for this priming function. The transcripts we have observed
may reflect low-level or sporadic transcription from authentic
promoters, ie, a consequence of locus activation. Alternatively, they
themselves may be active participants in the opening of a locus. In
this regard, it is interesting to note the recent observations of Ashe
et al,48 who detected intergenic transcription throughout
the globin locus, which they suggested may function as part of the
locus-opening machinery.
Finally, our studies of priming in AGM-derived stem cells have failed
to find evidence of lymphoid-affiliated gene activation: neither CD3,
5, nor Thy-1 transcripts were consistently detected by RT-PCR. This
is seemingly at odds with our previous studies of FDCP-mix A4 cells,
where the CD3 enhancer was shown to be in a DNase I-hypersensitive
configuration.49 Similarly, 5 expression is detectable
by RT-PCR in FDCP-mix, and these cells also express Thy-1 on their
surface.17,35 These lymphoid characteristics of FDCP-mix
probably reflect their forced self-renewal in tissue culture.
Certainly, FDCP-mix cells are not considered entirely authentic stem
cells, and despite displaying lymphoid features, they have not been
successfully differentiated down the lymphoid pathway. However, the
recent observations of Wang et al50 provide cogent evidence
that T- and B-lymphoid gene loci are coactivated before unilineage T-
or B-lymphoid commitment.
These considerations aside, we are intrigued by another possibility
that relates to the evolutionary origins of hematopoietic stem cells.
We suggest that the ground state of developmentally early stem cells
may essentially be myeloid-disposed, reflecting (1) the evolutionary
origins of hematopoiesis in monocytic/phagocytic cells and granulocytes
and (2) the early evolutionary requirement for oxygen-carrying red
blood cells. This evolutionary baggage may also underlie the
essentially eythro-myeloid disposition of early yolk sac-derived
progenitors and the later developmental appearance of lymphoid
potential in intraembryonic progenitors of the paraaortic
splanchnopleura and AGM. Further studies of lymphoid gene activation in
early stem cells at the level of chromatin structure will be required
to test this hypothesis.
| |
FOOTNOTES |
Submitted November 23, 1998; accepted May 3, 1999.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Tariq Enver, PhD, Section of
Gene Function and Regulation, Institute of Cancer Research, Chester
Beatty Laboratories, 237 Fulham Rd, London SW3 6JB; e-mail:
<tariq{at}icr.ac.uk>.
| |
REFERENCES |
1.
Dzierzak E, Sanchez MJ, Muller A, Miles C, Holmes A, Tidcombe H, Medvinsky A:
Hematopoietic stem cells: Embryonic beginnings.
J Cell Physiol
173:216, 1997[Medline]
[Order article via Infotrieve]
2.
Robb L:
Hematopoiesis: Origin pinned down at last?
Curr Biol
7:R10, 1997[Medline]
[Order article via Infotrieve]
3.
Mukouyama Y, Hara T, Xu M, Tamura K, Donovan PJ, Kim H, Kogo H, Tsuji K, Nakahata T, Miyajima A:
In vitro expansion of murine multipotential hematopoietic progenitors from the embryonic aorta-gonad-mesonephros region.
Immunity
8:105, 1998[Medline]
[Order article via Infotrieve]
4.
Muller AM, Medvinsky A, Strouboulis J, Grosveld F, Dzierzak E:
Development of hematopoietic stem cell activity in the mouse embryo.
Immunity
1:291, 1994[Medline]
[Order article via Infotrieve]
5.
Yoder MC, Hiatt K, Mukherjee P:
In vivo repopulating hematopoietic stem cells are present in the murine yolk sac at day 9.0 postcoitus.
Proc Natl Acad Sci USA
94:6776, 1997[Abstract/Free Full Text]
6.
Sanchez MJ, Holmes A, Miles C, Dzierzak E:
Characterization of the first definitive hematopoietic stem cells in the AGM and liver of the mouse embryo.
Immunity
5:513, 1996[Medline]
[Order article via Infotrieve]
7.
Yoder MC, Hiatt K, Dutt P, Mukherjee P, Bodine DM, Orlic D:
Characterization of definitive lymphohematopoietic stem cells in the day 9 murine yolk sac.
Immunity
7:335, 1997[Medline]
[Order article via Infotrieve]
8.
Peault B:
Hematopoietic stem cell emergence in embryonic life: Developmental hematology revisited.
J Hematother
5:369, 1996[Medline]
[Order article via Infotrieve]
9.
Tavian M, Coulombel L, Luton D, Clemente HS, Dieterlen-Lievre F, Peault B:
Aorta-associated CD34+ hematopoietic cells in the early human embryo.
Blood
87:67, 1996[Abstract/Free Full Text]
10.
Wood HB, May G, Healy L, Enver T, Morriss-Kay GM:
CD34 expression patterns during early mouse development are related to modes of blood vessel formation and reveal additional sites of hematopoiesis.
Blood
90:2300, 1997[Abstract/Free Full Text]
11.
Yoder MC, Hiatt K:
Engraftment of embryonic hematopoietic cells in conditioned newborn recipients.
Blood
89:2176, 1997[Abstract/Free Full Text]
12.
Enver T, Greaves M:
Loops, lineage, and leukemia.
Cell
94:9, 1998[Medline]
[Order article via Infotrieve]
13.
Cumano A, Dorshkind K, Gillis S, Paige CJ:
The influence of S17 stromal cells and interleukin 7 on B cell development.
Eur J Immunol
20:2183, 1990[Medline]
[Order article via Infotrieve]
14.
Forni L:
Reagents for immunofluorescence and their use for studying lymphoid cell products, in
Pernis I
(ed):
Immunological Methods, vol 151. New York, NY, Academic, 1979.
15.
Delassus S, Cumano A:
Circulation of hematopoietic progenitors in the mouse embryo.
Immunity
4:97, 1996[Medline]
[Order article via Infotrieve]
16.
Dexter TM, Garland J, Scott D, Scolnick E, Metcalf D:
Growth of factor-dependent hemopoietic precursor cell lines.
J Exp Med
152:1036, 1980[Abstract/Free Full Text]
17.
Hu M, Krause D, Greaves M, Sharkis S, Dexter M, Heyworth C, Enver T:
Multilineage gene expression precedes commitment in the hemopoietic system.
Genes Dev
11:774, 1997[Abstract/Free Full Text]
18.
Brown J, Greaves MF, Molgaard HV:
The gene encoding the stem cell antigen, CD34, is conserved in mouse and expressed in haemopoietic progenitor cell lines, brain, and embryonic fibroblasts.
Int Immunol
3:175, 1991[Abstract/Free Full Text]
19.
Qiu FH, Ray P, Brown K, Barker PE, Jhanwar S, Ruddle FH, Besmer P:
Primary structure of c-kit: Relationship with the CSF-1/PDGF receptor kinase family Oncogenic activation of v-kit involves deletion of extracellular domain and C terminus.
EMBO J
7:1003, 1988[Medline]
[Order article via Infotrieve]
20.
D'Andrea AD, Fasman GD, Lodish HF:
Erythropoietin receptor and interleukin-2 receptor beta chain: A new receptor family.
Cell
58:1023, 1989[Medline]
[Order article via Infotrieve]
21.
Fukunaga R, Ishizaka-Ikeda E, Seto Y, Nagata S:
Expression cloning of a receptor for murine granulocyte colony-stimulating factor.
Cell
61:341, 1990[Medline]
[Order article via Infotrieve]
22.
Venturelli D, Bittenbender S, Rovera G:
Sequence of the murine myeloperoxidase (MPO) gene.
Nucleic Acids Res
17:7987, 1989[Free Full Text]
23.
Shehee WR, Loeb DD, Adey NB, Burton FH, Casavant NC, Cole P, Davies CJ, McGraw RA, Schichman SA, Severynse DM, Voliva F, Weyter FW, Wisely GB, Edgell MH, Hutchison CA III:
Nucleotide sequence of the BALB/c mouse beta-globin complex.
J Mol Biol
205:41, 1989[Medline]
[Order article via Infotrieve]
24.
Kudo A, Sakaguchi N, Melchers F:
Organization of the murine Ig-related lambda 5 gene transcribed selectively in pre-B lymphocytes [published erratum appears in EMBO J 6:4242, 1987].
EMBO J
6:103, 1987[Medline]
[Order article via Infotrieve]
25.
Godin I, Dieterlen-Lievre F, Cumano A:
Emergence of multipotent hemopoietic cells in the yolk sac and paraaortic splanchnopleura in mouse embryos, beginning at 8.5 days postcoitus [published erratum appears in Proc Natl Acad Sci USA 92:10815, 1995].
Proc Natl Acad Sci USA
92:773, 1995[Abstract/Free Full Text]
26.
Cumano A, Paige CJ:
Enrichment and characterization of uncommitted B-cell precursors from fetal liver at day 12 of gestation.
EMBO J
11:593, 1992[Medline]
[Order article via Infotrieve]
27.
Haynes BF, Denning SM, Singer KH, Kurtzberg J:
Ontogeny of T-cell precursors: A model for the initial stages of human T-cell development.
Immunol Today
10:87, 1989[Medline]
[Order article via Infotrieve]
28.
Shivdasani RA, Orkin SH:
The transcriptional control of hematopoiesis.
Blood
87:4025, 1996[Free Full Text]
29.
Okuda T, van Deursen J, Hiebert SW, Grosveld G, Downing JR:
AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis.
Cell
84:321, 1996[Medline]
[Order article via Infotrieve]
30.
Scott EW, Simon MC, Anastasi J, Singh H:
Requirement of transcription factor PU.1 in the development of multiple hematopoietic lineages.
Science
265:1573, 1994[Abstract/Free Full Text]
31.
Tsai FY, Orkin SH:
Transcription factor GATA-2 is required for proliferation/survival of early hematopoietic cells and mast cell formation, but not for erythroid and myeloid terminal differentiation.
Blood
89:3636, 1997[Abstract/Free Full Text]
32.
Tsai FY, Keller G, Kuo FC, Weiss M, Chen J, Rosenblatt M, Alt FW, Orkin SH:
An early haematopoietic defect in mice lacking the transcription factor GATA-2.
Nature
371:221, 1994[Medline]
[Order article via Infotrieve]
33.
Tenen DG, Hromas R, Licht JD, Zhang DE:
Transcription factors, normal myeloid development, and leukemia.
Blood
90:489, 1997[Free Full Text]
34.
Brady G, Barbara M, Iscove NN:
Representative in vitro cDNA amplification from individual hemopoietic cells and colonies.
Methods Mol Cell Biol
2:17, 1990
35.
Ford AM, Healy LE, Bennett CA, Navarro E, Spooncer E, Greaves MF:
Multilineage phenotypes of interleukin-3-dependent progenitor cells.
Blood
79:1962, 1992[Abstract/Free Full Text]
36.
Uchida N, Weissman IL:
Searching for hematopoietic stem cells: Evidence that Thy-1.1lo Lin Sca-1+ cells are the only stem cells in C57BL/Ka-Thy-1.1 bone marrow.
J Exp Med
175:175, 1992[Abstract/Free Full Text]
37.
Vidal M, Morris R, Grosveld F, Spanopoulou E:
Tissue-specific control elements of the Thy-1 gene.
EMBO J
9:833, 1990[Medline]
[Order article via Infotrieve]
38.
Pillai S, Baltimore D:
Formation of disulphide-linked mu 2 omega 2 tetramers in pre-B cells by the 18K omega-immunoglobulin light chain.
Nature
329:172, 1987[Medline]
[Order article via Infotrieve]
39.
Sakaguchi N, Melchers F:
Lambda 5, a new light-chain-related locus selectively expressed in pre-B lymphocytes.
Nature
324:579, 1986[Medline]
[Order article via Infotrieve]
40.
Medvinsky A, Dzierzak E:
Definitive hematopoiesis is autonomously initiated by the AGM region.
Cell
86:897, 1996[Medline]
[Order article via Infotrieve]
41.
Medvinsky AL, Samoylina NL, Muller AM, Dzierzak EA:
An early pre-liver intraembryonic source of CFU-S in the developing mouse.
Nature
364:64, 1993[Medline]
[Order article via Infotrieve]
42.
Ford AM, Bennett CA, Healy LE, Towatari M, Greaves MF, Enver T:
Regulation of the myeloperoxidase enhancer binding proteins Pu1, C-EBP-alpha, -beta, and -delta during granulocyte-lineage specification.
Proc Natl Acad Sci USA
93:10838, 1996[Abstract/Free Full Text]
43.
Crotta S, Nicolis S, Ronchi A, Ottolenghi S, Ruzzi L, Shimada Y, Migliaccio AR, Migliaccio G:
Progressive inactivation of the expression of an erythroid transcriptional factor in GM- and G-CSF-dependent myeloid cell lines.
Nucleic Acids Res
18:6863, 1990[Abstract/Free Full Text]
44.
Zhu J, Bennett CA, MacGregor AD, Greaves MF, Goodwin GH, Ford AM:
A myeloid-lineage-specific enhancer upstream of the mouse myeloperoxidase (MPO) gene.
Leukemia
8:717, 1994[Medline]
[Order article via Infotrieve]
45.
Heberlein C, Fischer KD, Stoffel M, Nowock J, Ford A, Tessmer U, Stocking C:
The gene for erythropoietin receptor is expressed in multipotential hematopoietic and embryonal stem cells: Evidence for differentiation stage-specific regulation.
Mol Cell Biol
12:1815, 1992[Abstract/Free Full Text]
46.
Jimenez G, Griffiths SD, Ford AM, Greaves MF, Enver T:
Activation of the beta-globin locus control region precedes commitment to the erythroid lineage.
Proc Natl Acad Sci USA
89:10618, 1992[Abstract/Free Full Text]
47.
Greaves MF, Chan LC, Furley AJ, Watt SM, Molgaard HV:
Lineage promiscuity in hemopoietic differentiation and leukemia.
Blood
67:1, 1986[Abstract/Free Full Text]
48.
Ashe HL, Monks J, Wijgerde M, Fraser P, Proudfoot NJ:
Intergenic transcription and transinduction of the human beta-globin locus.
Genes Dev
11:2494, 1997[Abstract/Free Full Text]
49.
Ford AM, Bennett CA, Healy LE, Navarro E, Spooncer E, Greaves MF:
Immunoglobulin heavy-chain and CD3 delta-chain gene enhancers are DNase I-hypersensitive in hemopoietic progenitor cells.
Proc Natl Acad Sci USA
89:3424, 1992[Abstract/Free Full Text]
50.
Wang H, Diamond RA, Rothenberg EV:
Cross-lineage expression of Ig-beta (B29) in thymocytes: Positive and negative gene regulation to establish T cell identity.
Proc Natl Acad Sci USA
95:6831, 1998[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
S. T. Chou, E. Khandros, L. C. Bailey, K. E. Nichols, C. R. Vakoc, Y. Yao, Z. Huang, J. D. Crispino, R. C. Hardison, G. A. Blobel, et al.
Graded repression of PU.1/Sfpi1 gene transcription by GATA factors regulates hematopoietic cell fate
Blood,
July 30, 2009;
114(5):
983 - 994.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. L. McKinney-Freeman, C. Lengerke, I.-H. Jang, S. Schmitt, Y. Wang, M. Philitas, J. Shea, and G. Q. Daley
Modulation of murine embryonic stem cell-derived CD41+c-kit+ hematopoietic progenitors by ectopic expression of Cdx genes
Blood,
May 15, 2008;
111(10):
4944 - 4953.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Sugano, M. Takeuchi, A. Hirata, H. Matsushita, T. Kitamura, M. Tanaka, and A. Miyajima
Junctional adhesion molecule-A, JAM-A, is a novel cell-surface marker for long-term repopulating hematopoietic stem cells
Blood,
February 1, 2008;
111(3):
1167 - 1172.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Wang, F. Yates, O. Naveiras, P. Ernst, and G. Q. Daley
Embryonic stem cell-derived hematopoietic stem cells
PNAS,
December 27, 2005;
102(52):
19081 - 19086.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Iwasaki, C. Somoza, H. Shigematsu, E. A. Duprez, J. Iwasaki-Arai, S.-i. Mizuno, Y. Arinobu, K. Geary, P. Zhang, T. Dayaram, et al.
Distinctive and indispensable roles of PU.1 in maintenance of hematopoietic stem cells and their differentiation
Blood,
September 1, 2005;
106(5):
1590 - 1600.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Bottardi, V. Bourgoin, N. Pierre-Charles, and E. Milot
Onset and inheritance of abnormal epigenetic regulation in hematopoietic cells
Hum. Mol. Genet.,
February 15, 2005;
14(4):
493 - 502.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Bottardi, A. Aumont, F. Grosveld, and E. Milot
Developmental stage-specific epigenetic control of human {beta}-globin gene expression is potentiated in hematopoietic progenitor cells prior to their transcriptional activation
Blood,
December 1, 2003;
102(12):
3989 - 3997.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Wong, J. McLaughlin, D. Cheng, K. Shannon, L. Robb, and O. N. Witte
IL-3 receptor signaling is dispensable for BCR-ABL-induced myeloproliferative disease
PNAS,
September 30, 2003;
100(20):
11630 - 11635.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Minegishi, N. Suzuki, T. Yokomizo, X. Pan, T. Fujimoto, S. Takahashi, T. Hara, A. Miyajima, S.-i. Nishikawa, and M. Yamamoto
Expression and domain-specific function of GATA-2 during differentiation of the hematopoietic precursor cells in midgestation mouse embryos
Blood,
August 1, 2003;
102(3):
896 - 905.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Akashi, X. He, J. Chen, H. Iwasaki, C. Niu, B. Steenhard, J. Zhang, J. Haug, and L. Li
Transcriptional accessibility for genes of multiple tissues and hematopoietic lineages is hierarchically controlled during early hematopoiesis
Blood,
January 15, 2003;
101(2):
383 - 389.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. de Andres, P. Gonzalo, S. Minguet, J. A. Martinez-Marin, P. G. Soro, M. A. R. Marcos, and M. L. Gaspar
The first 3 days of B-cell development in the mouse embryo
Blood,
December 1, 2002;
100(12):
4074 - 4081.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Lambolez, O. Azogui, A.-M. Joret, C. Garcia, H. von Boehmer, J. Di Santo, S. Ezine, and B. Rocha
Characterization of T Cell Differentiation in the Murine Gut
J. Exp. Med.,
February 11, 2002;
195(4):
437 - 449.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. A. Martinez-M., S. Minguet, P. Gonzalo, P. G. Soro, B. de Andres, A. Izcue, M. A. R. Marcos, and M.-L. Gaspar
Long-lived polyclonal B-cell lines derived from midgestation mouse embryo lymphohematopoietic progenitors reconstitute adult immunodeficient mice
Blood,
September 15, 2001;
98(6):
1862 - 1871.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. E. Mebius, T. Miyamoto, J. Christensen, J. Domen, T. Cupedo, I. L. Weissman, and K. Akashi
The Fetal Liver Counterpart of Adult Common Lymphoid Progenitors Gives Rise to All Lymphoid Lineages, CD45+CD4+CD3- Cells, As Well As Macrophages
J. Immunol.,
June 1, 2001;
166(11):
6593 - 6601.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Akashi, L. I. Richie, T. Miyamoto, W. H. Carr, and I. L. Weissman
B Lymphopoiesis in the Thymus
J. Immunol.,
May 15, 2000;
164(10):
5221 - 5226.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. Lemischka
The power of stem cells reconsidered?
PNAS,
December 7, 1999;
96(25):
14193 - 14195.
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION