|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, Vol. 94 No. 5 (September 1), 1999:
pp. 1578-1589
By
From the Departments of Pathology and Laboratory Medicine and
Tumor Cell Biology, St Jude Children's Research Hospital,
Memphis, TN.
The transcriptional mechanisms that drive colony-forming unit
granulocyte-macrophage (CFU-GM) myeloid progenitors to differentiate into cells of either the granulocytic or monocytic lineage are not
fully understood. We have shown that the c-Maf and c-Myb transcription factors physically interact in myeloid cells to form inhibitory complexes that hinder transactivation of c-Myb target genes through direct binding to Myb consensus sites. These complexes arise in a
developmentally regulated pattern, peaking at the promyelocyte stage,
or in cell model systems, appearing soon after the induction of
monocytic differentiation. We wished to determine if this
developmentally related interaction is a consequence of myeloid
differentiation or an intrinsic differentiating stimulus. Because the
elevated Myb:Maf status seen in differentiating cells can be
recapitulated by overexpression of c-Maf in myeloid cell lines, we
inducibly expressed the c-Maf cDNA in 2 bipotent human myeloid
progenitor cells. Elevated levels of c-Maf protein led to marked
increases in Myb:Maf complexes and the accumulation of
monocyte/macrophage cells, followed by eventual programmed cell death.
Analysis of targets that could mediate these phenotypic changes
indicated that c-Maf likely plays a key role in myeloid cell
development through dual mechanisms; inhibition of a select set of
c-Myb regulated targets, such as Bcl-2 and CD13/APN,
coupled with the activation of as yet undefined
differentiation-promoting genes.
PRECISE REGULATION OF the c-Myb
transcription factor is essential for normal hematopoiesis.
Interference with T-cell-specific c-Myb expression in transgenic mice
causes growth arrest and reduced proliferative capacity of the T-cell
compartment.1 c-Myb null mice die late in gestation and
display greatly reduced numbers of hematopoietic progenitors,
presumably due to their reduced capacity to establish a normal
proliferative program.2 However, these progenitors can
still differentiate, suggesting that c-Myb sustains hematopoietic
progenitor cells in a proliferative mode, thereby regulating the shift
between proliferation and differentiation.2-4 Consequently,
inhibition of Myb activity during hematopoiesis could block
proliferation, setting the stage for differentiation on receipt of the
appropriate inductive signals.
Members of the Maf family of basic region/leucine zipper (bZIP)
transcription factors play an essential role in growth and development
by regulating tissue-specific gene expression.5-7 These
proteins activate or repress transcription depending on their
particular protein partner and the context of the target promoter. For
example, selective expression of c-Maf dictates the ratio of T-helper
cell subsets by positively regulating interleukin-4 (IL-4)
expression.5 Similarly, the differentially expressed and
highly homologous MafB protein physically binds to and inhibits the
activity of the Ets-1 protein in avian myeloid cells.7 Maf
family proteins are essential to both avian and mammalian development
and differentiation. The tissue restricted avian L-Maf regulates
multiple lens-specific genes, and ectopic expression of this protein is
sufficient to induce lens differentiation in ectodermal and cultured
cells.6 Finally, c-Maf null mice have severe multisystem
defects with high mortality rates in late gestation (L. Glimcher,
personal communication, July 1998, and Kim et
al8), illustrating a fundamental role for c-Maf in
mammalian development.
We have recently demonstrated9 that c-Myb and c-Maf
physically interact, resulting in the inhibition of Myb-dependent gene transcription in early myeloid cells through a mechanism that requires
the binding of c-Myb, but not Maf, to DNA. Although c-Maf mRNA and
protein levels remain constant during myeloid development, the
formation of inhibitory Myb:Maf-DNA complexes is developmentally regulated, with the highest levels found in promyelocytic cells and in
progenitors soon after their induction to differentiate. By contrast,
markedly lower levels of these complexes are present in either immature
myeloblasts or later developmental stages, and during terminal
differentiation. The regulation of complex formation appears to be
independent of Myb, as addition of Myb protein does not affect Myb:Maf
complex levels, or do levels of free Myb protein correlate with complex
levels.9 This developmental pattern of protein interaction
suggests that Maf modulation of c-Myb activity may be an important
regulatory pathway for the control of transcription and the initiation
of myeloid cell differentiation.
Enforced expression of c-Maf in early myeloid cells lacking Myb:Maf
complexes results in the formation of inhibitory complexes, thereby
recapitulating the regulatory interactions normally occurring in
maturing myeloid cells.9 Because downregulation of Myb may prepare cells for differentiation, we postulated that conditional expression of c-Maf would both inhibit obligatory Myb targets and
provide the necessary inductive signals to drive cells to differentiate. Here we report that induction of c-Maf in 2 bipotential human myeloid cell lines induces the appearance and accumulation of
cells characteristic of the monocytic phenotype. Importantly, levels of
Myb:Maf complexes in these induced clones increased in a pattern
similar to that seen on phorbol-induced monocytic differentiation, supporting the hypothesis that c-Maf plays a crucial
role in myeloid cell differentiation. Finally, prolonged c-Maf
induction in these cell lines results in a decrease in Bcl-2 protein levels and subsequent apoptotic cell death, consistent with inhibition of Myb activity and terminal monocytic differentiation.
Cell lines.
Human cell lines included the myeloid leukemia lines HL-60 (American
Type Culture Collection [ATCC], Rockville, MD, CRL
1593) and U937 (ATCC, CRL 1593). Cells were grown in RPMI-1640 medium supplemented with 2 mmol/L L-glutamine and 10% fetal calf serum. HL-60
and U937 cells were induced to differentiate by using
12-0-tetradecanoylphorbol diester (TPA, 5 × 10 Expression vectors and reporter plasmids.
The CD13/APN minimal reporter construct Transfection of recombinant plasmids and reporter gene assays.
To analyze inhibition of Myb transcriptional activity, c-Maf stably
transfected U937 or HL-60 cloned cell lines were induced with 150 µmol/L ZnSO4 for the indicated time intervals before electroporation with 5 µg of the CD13/APN Northern and Western blot analysis.
polyA+ RNA was purified from cell lines using the FastTrack
2.0 kit (Invitrogen, Carlsbod, CA). Total RNA was
extracted using Tri Reagent (Molecular Research Center, Inc,
Cincinnati, OH). A total of 10 µg of poly A+ RNA or 20 µg of total RNA from the indicated cell lines was separated on a 1%
agarose-formaldehyde gel, transferred to nylon membranes, and
sequentially probed with the BstEII/NcoI fragment containing the
5' region of murine c-Maf (which excludes the bZIP domain), the
3-kb BamHI fragment of the murine CSF-1R cDNA, and a
glyceraldehyde-3-phosphate dehydrogenase (G3PDH) cDNA
probe (Clontech, Palo Alto, CA). For Western blot
analysis, proteins were separated on a 12% sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel and
transferred onto nitrocellulose. Membranes were blocked with 5% milk
in Tris-buffered saline (TBS) buffer; incubated
with the primary antibody (rabbit anti v-Maf and goat
anti-actin polyclonal antisera, Santa Cruz
Biotechnology, Santa Cruz, CA; monoclonal mouse
anti-human Bcl-2, Upstate Biotechnology, Lake Placid,
NY; or anti-Myc for detection of Myc-tagged MEnT, Calbiochem, San Diego, CA), followed by horseradish peroxidase
(HRP)-linked secondary antibody. Specific HRP-conjugated protein
complexes were detected according to the ECL protocol (Amersham,
Arlington Heights, IL).
DNA binding assays.
For DNA binding assays, whole-cell lysates from myeloid cells were
prepared by resuspending and washing pelleted cells in cold
phosphate-buffered saline (PBS) and resuspending the pellet in lysis
buffer (20 mmol/L Tris-HCl, pH 7.5, 2 mmol/L dithiothreitol [DTT], 20% glycerol, 50 mmol/L KCl) containing a
protease inhibitor cocktail (Boehringer-Mannheim Complete Inhibitor
Cocktail Tablets; Boehringer-Mannheim, Indianapolis,
IN). After addition of Triton X-100 to 0.5% final concentration
(vol/vol), the lysate was incubated on ice for 60 minutes, and the
debris pelleted for 15 minutes at 14,000 rpm. Cleared lysate was
quantitated and stored at Apoptosis analysis.
DNA from ZnSO4 induced cells was isolated at the indicated
intervals (see Fig 8C) using described methods.14 Briefly,
cells were harvested, washed with PBS and resuspended in lysis buffer (1% NP-40 in 20 mmol/L EDTA, 50 mmol/L Tris-HCl, pH 7.5; 10 mL per 1 × 106 cells). After centrifugation, SDS was added to
1% and the supernatants were treated for 2 hours with RNase A (5 mg/mL
final concentration) at 56°C followed by digestion with proteinase
K (2.5 mg/mL final concentration) for 2 hours at 37°C. The DNA was
precipitated, separated by electrophoresis in 1% agarose, and
visualized by ethidium bromide staining. TdT-mediated dUTP nick end
labeling (TUNEL) assays were performed as
described15 on cells treated with zinc for 24 hours (MEnT)
or 48 hours (c-Maf).
Reverse transcription-polymerase chain reaction (RT-PCR).
RNA was extracted with TRI-Reagent (Molecular Research Center,
Inc) according to the method provided. Fifteen
micrograms of total RNA was used as template for first-strand
complementary DNA (cDNA) synthesis using Superscript II reverse
transcriptase (GIBCO/BRL, Gaithersburg, MD) with 100 U ribonuclease inhibitor, 1 µL random primer
(GIBCO/BRL), and nuclease-free water to 36 µL. The reaction was
heated to 70°C for 10 minutes and then quick chilled on ice.
Second-strand synthesis was performed in 5X first strand buffer (12 µL), 10 mmol/L each dNTP (3 µL), and 3 µL
SuperScript II, and the reaction incubated at 25°C for 10 minutes,
42°C for 50 minutes, and at 75°C for 15 minutes. PCR
amplification was performed with 1 µL cDNA, 10 µL 10X PCR buffer, 8 µL dNTP (2.5 mmol/L each), 1 µL 3' primer (100 mmol/L), 1 µL 5' primer (100 mmol/L), add dH2O up to 99.5 µL, and 0.5 µL AmpliTaq Gold. The cDNA was heat denatured at 94°C for 9 minutes, then amplified through 35 cycles of 94°C, 45 seconds,
58°C, 45 seconds, and 72°C, 45 seconds. For c-Maf RT-PCR,
5' primer: TGCACTTCGACGACCGCTTCTCGG, 3' primer:
AAGGTGGCTAGCTGGAATCGCG. MafG RT-PCR primers are as published16; IL-4 and b-actin primers were purchased from
Stratagene (La Jolla, CA). Positive control plasmid
template containing the IL-4 cDNA was purchased from ATCC.
c-Maf promotes monocytic/macrophage differentiation of HL-60 and U937
myeloid cells.
In myeloid cells, the highest levels of Myb:Maf protein complexes are
found in those representing early stages of differentiation or in cells
soon after the induction of monocytic differentiation. By contrast,
markedly lower levels are apparent in either immature myeloblasts or
later developmental stages, linking the interaction of these 2 proteins
with myeloid differentiation.9 To address whether this
interaction is a consequence of myeloid differentiation signals or a
differentiating stimulus in and of itself, we engineered HL-60 and U937
cells (containing equivalent, low levels of endogenous c-Maf mRNA,
Fig 1A) to inducibly express the
full-length murine c-Maf cDNA11 using the
metallothionine-based expression vector pMT-CB6.9 Although
protein expression from the individual clones varied, extremely high
induction of c-Maf was detected in several clonal lines (Fig 1B). The
low level of endogenous c-Maf protein in parental cells is not
detectable in whole-cell lysates, but is evident on immunoprecipitation
followed by Western blot analysis.9 Consistent with our
model, electrophoretic mobility shift assay (EMSA)
analysis of myeloid cell lysates indicated a dose-dependent increase in
the levels of Myb:Maf containing complexes binding to the
CD13/APN target promoter fragment on zinc induction of c-Maf-containing clonal lines (Figs 1C, lanes 4 and 5; 1D, lanes 10 to
16), in effect, mirroring the increase observed in cell lysates from
TPA-induced (monocytic lineage) parental cell lines (Fig 1D, lanes 17 and 18). These complexes consist of physically interacting Myb and Maf
proteins bound to the Myb consensus site in the target promoter
fragment as confirmed by competitor oligonucleotide and specific
antibody abrogation of the complexes (Fig 1C, lanes 6 to 8 and Hegde et
al9). Maf itself does not contact the CD13/APN promoter probe.9 Therefore, these c-Maf-expressing clones
recapitulate the Myb:Maf status of myeloid cells driven to
differentiate along the monocyte/macrophage pathway.
IL-4 does not play a role in inducing monocytic differentiation.
What are the possible mechanisms of monocytic differentiation induced
by c-Maf? Relatively few hematopoietic target genes have been
identified that are directly regulated by c-Maf through its activity as
a DNA-binding transcription factor. Recent data have indicated that
c-Maf directly activates the expression of IL-4 in T-helper cells and
can induce the expression of the endogenous IL-4 gene in IL-4-negative
B-cell lines.5 In several models of experimental
inflammation, exogenous IL-4 can initiate the formation of
multinucleated giant cells (MGC) through macrophage fusion.19-23 MGC contain multiple nuclei within extensively
spread cytoplasm,24 similar to the phenotype of a
percentage of c-Maf-induced monocytes, raising the possibility that
overexpression of c-Maf in myeloid cell lines could also induce ectopic
IL-4 production. To address this issue, we performed RT-PCR analysis
(Fig 5A). Although c-Maf mRNA is highly
induced in our myeloid clones (lanes 8 and 9), its upregulation does
not initiate IL-4 mRNA synthesis (lanes 3 and 4). In addition, we added
neutralizing antibodies to IL-4 to cultures of zinc-induced c-Maf
clonal cell lines; these antibodies had no discernable effect on the
previously observed morphologic changes or ANB esterase positivity (Fig
5B). Similarly, addition of inhibitory concentrations of cyclosporin A
(a potent and specific inhibitor of the calcineurin-dependent
transcription factors required for IL-4 transcription25,26)
had no effect on the c-Maf-induced phenotypic changes (data not
shown). These results indicate that in our system, c-Maf induction does
not initiate endogenous IL-4 expression and, therefore, IL-4 does not
contribute to the observed monocytic differentiation.
Inhibition of Myb activity is not sufficient to drive
differentiation.
During myeloid differentiation, c-Maf forms inhibitory complexes with
c-Myb, which function independently of Maf's binding to
DNA.9 Because the c-Maf protein controls gene expression through DNA-dependent, as well as DNA-independent, mechanisms, Maf-induced differentiation could be triggered by either or both of
these mechanisms.5-7,9,11,27 To confirm that c-Maf
induction altered Myb transactivation in our stable HL-60 clones, we
transiently transfected these cells with Myb-dependent CD13/APN
promoter-driven reporter constructs.9,10 c-Maf expression
inhibited luciferase activity of the reporter gene in these cells in a
dose-dependent fashion with 90% inhibition at the highest dose tested
(Fig 6). Therefore, Myb-dependent
transcription is functionally impaired in these cells and in the U937
clonal lines as well (data not shown).
Maf-induced differentiation terminates in apoptosis.
Active inhibition of Myb in avian myeloid and mammalian T cells results
in the downregulation of the antiapoptotic effector, Bcl-2, a direct
transcriptional target of Myb, followed by induction of
apoptosis.35,36 We observed that induction of either c-Maf or the dominant interfering Myb construct (MEnT) in HL-60 clonal lines
generates substantial cell death when compared with zinc-treated control cells (Fig 3C and data not shown). Flow cytometric analysis of
the DNA content of propidium iodide stained cells showed the appearance
of a significant percentage of c-Maf, and a higher ratio of positive
control MEnT expressing lines, present in a sub-G1 peak by
24 hours and as shown at 72 hours (Fig 8A),
indicative of apoptotic cell death. Untreated cells (Fig 8A) or vector
control cells treated with zinc (data not shown) did not result in
similar DNA content profiles. We confirmed that c-Maf containing cells were dying by apoptosis by TUNEL assay (Fig 8B) and DNA fragmentation analysis (Fig 8C). This latter assay also indicated that c-Maf-induced apoptosis is delayed relative to that induced by the positive control
MEnT fusion protein (24 to 48 hours v 6 hours), probably reflecting differences in the range of Myb targets inhibited by Maf
versus MEnT.
Here we show that elevated, conditional expression of c-Maf in bipotent
myeloid cell lines is sufficient to promote differentiation to
monocytes. Elevation of c-Maf causes an increase in the levels of
Myb:Maf complexes, recapitulating the increase seen when these lines
are induced to monocytic differentiation. Enforced expression of the
c-Maf protein correlated precisely with the induction of morphological
changes, the appearance of cell-surface markers, and the induction of
cytosolic enzyme activities characteristic of monocytic
differentiation. Maf's induction of differentiation was independent of
the expression of IL-4, a direct transcriptional target of c-Maf, but
was associated with the inhibition of c-Myb activity, including the Myb
targets CD13/APN and Bcl-2. This inhibition of Bcl-2
correlated with the induction of apoptosis following the
differentiation of c-Maf-expressing cells and was consistent with
Bcl-2 downregulation seen during normal terminal myeloid differentiation.37-39 However, inhibition of c-Myb alone
does not appear to account for all of the effects of c-Maf, as
conditional expression of dominant interfering Myb proteins in HL-60
cells did not induce c-Maf-like differentiation. Hence, c-Maf likely plays a key role in myeloid cell development through dual mechanisms; inhibition of selected c-Myb regulated targets coupled with the activation of as yet undefined differentiation-promoting genes.
We thank Drs Rick Bram, David Shapiro, John Cleveland, and Paul Brindle
for helpful comments, Dr Kathy Weston for her generous gift of
plasmids, John Zacher for photomicrography, Liz Mann for technical
help, and John Gilbert for editorial assistance.
Submitted January 13, 1999; accepted May 3, 1999.
Supported by Grant No. CA-70909 from the National Institutes of Health
(to L.H.S.), by Grant No. CA-21765 from the National Cancer Institute
Cancer Center Support (CORE), and by the American Lebanese Syrian
Associated Charities (ALSAC), St Jude Children's Research Hospital.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Linda H. Shapiro, PhD,
Department of Pathology and Laboratory Medicine, St Jude Children's
Research Hospital, Memphis, TN 38105; e-mail:
linda.shapiro{at}stjude.org.
1.
Badiani P, Corbella P, Kiossus D, Marvel J, Weston K:
Dominant interfering alleles define a role of c-Myb in T-cell development.
Genes Dev
8:770, 1994
2.
Mucenski ML, McLain K, Kier AB, Swerdlow SH, Schreiner CM, Miller TA, Pietryga DW, Scott WJ Jr, Potter SS:
A functional c-myb gene is required for normal murine fetal hepatic hematopoiesis.
Cell
65:677, 1991[Medline]
[Order article via Infotrieve]
3.
Thompson MA, Ramsay RG:
Myb: An old oncoprotein with new roles.
BioEssays
17:341, 1995[Medline]
[Order article via Infotrieve]
4.
Lyon J, Robinson C, Watson RJ:
The role of Myb proteins in normal and neoplastic cell proliferation.
Crit Rev Oncog
5:373, 1994[Medline]
[Order article via Infotrieve]
5.
Ho I-C, Hodge MR, Rooney JW, Glimcher LH:
The proto-oncogene c-maf is responsible for tissue-specific expression of interleukin-4.
Cell
85:973, 1996[Medline]
[Order article via Infotrieve]
6.
Ogino H, Yasuda K:
Induction of lens differentiation by activation of a bZIP transcription factor, L-Maf.
Science
280:115, 1998
7.
Sieweke MH, Tekotte H, Frampton J, Graf T:
MafB is an interaction partner and repressor of ETS-1 that inhibits erythroid differentiation.
Cell
85:49, 1996[Medline]
[Order article via Infotrieve]
8.
Kim JI, Li T, Ho I, Grusby MJ, Glimcher LH:
Requirement for the c-Maf transcription factor in crystallin gene regulation and lens development.
Proc Natl Acad Sci USA
96:3781, 1999
9.
Hegde SP, Kumar A, Kurschner C, Shapiro LH:
c-Maf interacts with c-Myb to regulate transcription of an early myeloid gene during differentiation.
Mol Cell Biol
18:2729, 1998
10.
Shapiro LH:
MYB and ETS proteins cooperate to transactivate an early myeloid gene.
J Biol Chem
270:8763, 1995
11.
Kurschner C, Morgan JI:
The maf proto-oncogene stimulates transcription from multiple sites in a promoter that directs Purkinje Neuron-specific gene expression.
Mol Cell Biol
15:246, 1995[Abstract]
12.
Bram RJ, Hung DT, Martin PK, Schreiber SL, Crabtree GR:
Identification of the immunophilins capable of mediating inhibition of signal transduction by cyclosporin A and FK506: Roles of calcineurin binding and cellular location.
Mol Cell Biol
13:4760, 1993
13.
Kataoka K, Fujiwara KT, Noda M, Nishizawa M:
MafB, a new Maf family transcription activator that can associate with Maf and Fos but not with Jun.
Mol Cell Biol
14:7581, 1994
14.
Herrmann M, Lorenz HM, Voll R, Grünke M, Woith W, Kalden JR:
A rapid and simple method for the isolation of apoptotic DNA fragments.
Nucleic Acids Res
22:5506, 1994
15.
Inaba T, Inukai T, Yoshihara T, Seyschab H, Ashmun RA, Canman CE, Laken SJ, Kastan MB, Look AT:
Reversal of apoptosis by the leukaemia-associated E2A-HLF chimaeric transcription factor.
Nature
382:541, 1996[Medline]
[Order article via Infotrieve]
16.
Blank V, Kim MJ, Andrews NC:
Human MafG is a functional partner for p45 NF-E2 in activating globin gene expression.
Blood
89:3925, 1997
17.
Yam LT, Li CY, Crosby WH:
Cytochemical identification of monocytes and granulocytes.
Am J Clin Pathol
55:283, 1971[Medline]
[Order article via Infotrieve]
18.
Lubbert M, Herrmann F, Koeffler HP:
Expression and regulation of myeloid-specific genes in normal and leukemic myeloid cells.
Blood
77:909, 1991
19.
Adams DO:
The granulomatous inflammatory response: A review.
Am J Pathol
84:164, 1976[Medline]
[Order article via Infotrieve]
20.
Dugast C, Gaudin A, Toujas L:
Generation of multinucleated giant cells by culture of monocyte-derived macrophages with IL-4.
J Leukoc Biol
61:517, 1997[Abstract]
21.
Most J, Spotl L, Mayr G, Gasser A, Sarti A, Dierich MP:
Formation of multinucleated giant cells in vitro is dependent on the stage of monoctye to macrophage maturation.
Blood
89:662, 1997
22.
McNally AK, Anderson JM:
Interleukin-4 induces foreign body giant cells from human monocytes/macrophages.
Am J Pathol
147:1487, 1995[Abstract]
< |
TOP
ABSTRACT
INTRODUCTION
6 mol/L) added to the culture medium; cells were
harvested at indicated time points after addition. Anti-IL-4 and
matched control antibodies (R & D Systems, Minneapolis,
MN) were used according to the manufacturer's instructions.
411luc contains genomic
sequences from bp 
-actin-secreted
alkaline phosphatase (SEAP) plasmid as described.
-napthyl-butyrate esterase (ANB, Fig 
-napthyl butyrate esterase stain specific for monocytic lineage.
50%).
Similar morphologic and ANB data were obtained with HL-60 c-Maf clone 4, while identical treatment of vector containing control cells showed
no analogous changes (data not shown). Finally, the induction of c-Maf
in these clones altered their normal growth kinetics, as illustrated by
the reduced proliferative capacity of c-Maf containing clones, but not
vector control clones after exposure to zinc (Fig 
)
or CB6 vector control clone 3 (
) were incubated at the indicated
ZnSO4 concentrations for 12 hours to induce c-Maf protein
expression, and then transiently transfected with 5 µg of the
(IFN-