|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 5 (September 1), 1999:
pp. 1590-1600
Lineage-Specific Expression of Human Immunodeficiency Virus (HIV)
Receptor/Coreceptors in Differentiating Hematopoietic Precursors:
Correlation With Susceptibility to T- and M-Tropic HIV and
Chemokine-Mediated HIV Resistance
By
C. Chelucci,
I. Casella,
M. Federico,
U. Testa,
G. Macioce,
E. Pelosi,
R. Guerriero,
G. Mariani,
A. Giampaolo,
H.J. Hassan, and
C. Peschle
From the Departments of Hematology-Oncology and Virology, Istituto
Superiore di Sanità, Rome, Italy; and Kimmel Cancer Center,
Thomas Jefferson University, Philadelphia, PA.
 |
ABSTRACT |
Human immunodeficiency virus (HIV) entry is mediated not only by the
CD4 receptor, but also by interaction with closely related molecules
that act as membrane coreceptors. We have analyzed mRNA expression
and/or cell membrane exposition of the coreceptors most widely used by
diverse HIV-1 strains (CXCR4, CCR5, and CCR3) on purified hematopoietic
progenitor cells (HPCs) induced in liquid suspension culture to
unilineage differentiation/maturation through the erythroid (E),
granulocytic (G), megakaryocytic (Mk), and monocytic (Mo) lineages.
Reverse transcriptase-polymerase chain reaction (RT-PCR) and
cytofluorimetric analysis showed the presence of both CXCR4 and CCR5 in
quiescent HPCs, but failed to detect CCR3-specific transcripts.
Chemokine expression in HPC progenies showed that CXCR4 receptor is
detected on the majority of MKs from early to late stages of
maturation, whereas it is moderately decreased in the Mo lineage. In
the G pathway, two distinct cell populations, CXCR4+ and
CXCR4 , were observed: morphological analysis of the
sorted populations showed that the CXCR4+ cells were
largely eosinophils and the CXCR4 were granulocytes of
the neutrophilic series. Furthermore, in the E pathway, CXCR4 was
almost completely absent. CCR5 expression is restricted to Mo cultures,
ie,  30% to 80% cells throughout all monocytopoietic
differentiation/maturation stages. Finally, CCR3 mRNA is always absent
in all the unilineage cultures. Evaluation of CD4 expression by flow
cytometry on both quiescent HPCs and differentiating unilineage
precursors showed that the CD4 receptor is present on 15% of the
starting CD34+ HPC population, highly expressed in the Mo
lineage up to 80% at terminal maturation, present on 20% to 30% of
maturing Mks, and not detectable in either the E or G lineage.
Expression of CD4 receptor together with CXCR4 and/or CCR5 coreceptor
in the four lineages correlates with hematopoietic precursor
susceptibility to T-lymphotropic and macrophage (M)-tropic HIV strains
infection: (1) CD4 G and E cells were resistant to both
M-tropic and T-lymphotropic strains; (2) HPC-derived Mks were
susceptible to T-tropic, but resistant to M-tropic, infection; (3) Mo
differentiating cells efficiently replicate both HIV strains.
Furthermore, we showed that the CXCR4 and CCR5 ligands (stromal-derived
factor 1 and macrophage-inflammatory protein-1 [MIP-1],
MIP-1 and RANTES, respectively) inhibit HIV replication in both
maturing Mo and Mk cells. Taken together, our data show a
lineage-specific modulation of chemokine receptor/coreceptor during
hematopoietic cell differentiation and extend previous observations on
the relationship between the expression of HIV receptor/coreceptors,
susceptibility, and chemokine-mediated resistance to HIV infection.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
CHEMOKINE RECEPTORS belong to a family of
seven transmembrane spanning G protein-coupled receptors whose
activation leads to intracellular and extracellular
signaling.1-3 Their role in the human immunodeficiency
virus (HIV) entry process has been demonstrated by numerous
studies.4-12 Particularly, chemokine receptor CXCR4 binds
stromal-derived factor 1 (SDF-1) and has been shown to function as a
coreceptor for T-cell tropic HIV-1 strains,4-6 while
chemokine receptor CCR5 binds the -chemokines macrophage-inflammatory protein-1 (MIP-1), MIP-1, and
regulated-upon-activation, normal T-expressed and secreted (RANTES) and
mediates binding and entry of the M-tropic HIV strain.7-12
Therefore, HIV entry depends on the expression of receptor molecules
that mediate physiological events of primary importance, such as
chemotaxis, inflammation, and cell differentiation. In humans, HIV-1
strains that use CCR5 coreceptor predominate during the asymptomatic
stages of infection; as disease proceeds, viruses emerge that use other
receptors, most commonly the CXCR4.13
The pattern of expression of CXCR4 and CCR5 receptors has been
investigated on CD34+ human progenitor cells. CXCR4 mRNA
and protein were found on hematopoietic progenitor cells (HPCs)
purified either from bone marrow (BM)14-18 or from
peripheral blood (PB).19,20 Uncertain results were obtained
for CCR5 expression: analysis of granulocyte colony-stimulating factor
(G-CSF)-mobilized PB progenitors from single donors showed a low
incidence of cell samples containing CCR5 mRNA20;
negative18 or positive16 results were observed in BM-derived CD34+ cells. On the other hand,
cytofluorimetric analysis revealed that CCR5 is undetectable on most BM
hematopoietic progenitors,15,17 while its expression was
found in PB-derived CD34+ cells.19 Little is
known about HIV coreceptor regulation during the
differentiation/maturation of HPCs. Recently, CXCR4 has been shown to
be exposed on the cell surface of CD34+ cell-derived
megakaryocytes, and its expression is increased during their
maturation.14,17,21,22
We previously showed that both HPCs and maturing megakaryocytic (Mk)
precursors are susceptible to T-tropic HIV infection.23,24 These findings correlated with the membrane exposition of the CD4
molecule, the major HIV receptor. Taking advantage of a methodology for
selective unilineage HPC differentiation cultures,25 we extended the studies to the expression of CD4 receptor and CXCR4, CCR5,
and CCR3 coreceptors in HPCs and during their
differentiation/maturation along the erythroid (E), granulocytic (G),
monocytic (Mo), and Mk lineages. Furthermore, we correlated the
receptor/coreceptor expression to the permissiveness of M- and T-tropic
HIV strain replication and evaluated the degree of infection inhibition
by the natural ligands of the HIV coreceptors.
| |
MATERIALS AND METHODS |
Hematopoietic Growth Factors (HGFs) and Culture Media
Recombinant human interleukin-3 (rhIL-3; 2 × 106
U/mg), granulo-monocytic colony-stimulating factor (rhGM-CSF), and
rhIL-6 were supplied by the Genetics Institute (Cambridge, MA);
erythropoietin (rhEpo; 1.2 × 105 U/mg) by Amgen
(Thousand Oaks, CA); and flt3-ligand (rhFL; 1.9 × 106
U/mg) by Immunex (Seattle, WA). rhG-CSF (1 × 108
U/mg) and rhM-CSF (6 × 107 U/mg) were purchased from
R&D Systems Inc (Minneapolis, MN), and thrombopoietin (rhTpo) was from
Pepro Tech, Inc (Rocky Hill, NJ). Iscove's modified Dulbecco's medium
(IMDM; GIBCO, Grand Island, NY) was prepared weekly before each
purification experiment.
HPC Purification
Adult PB was obtained from 20- to 40-year-old healthy male donors after
informed consent. PB HPCs were purified from the buffy coat by a slight
modification26,27 of the method described by Gabbianelli et
al.28 Briefly, a negative selection of low-density cells
was performed with an anti-T, -B, -natural killer (NK)
lymphocyte, -monocyte, and -granulocyte monoclonal antibody (MoAb)
cocktail supplemented with anti-CD45, -CD11a, and -CD71 MoAbs (Becton
Dickinson, Mountain View, CA). The adherent fraction of PB mononuclear
cells (PBMCs) obtained during HPC purification was used as the source of monocytic cells (92% to 96% CD14+). Neutrophils were
isolated by sedimentation through a cushion of succinyl gelatine.
To obtain CD34+ cells, HPCs were incubated with a
saturating amount of anti-CD34 directly conjugated with fluorescein
isothiocyanate (FITC) (8G12 clone; Becton Dickinson), washed, and run
on a FACSVantage (Becton Dickinson) cell sorter. The CD34+
subpopulation was sorted on the basis of fluorescence emission.
HPC Characterization
Immunofluorescence assay.
Anti-CD34-FITC (8G12 clone) MoAb was used to characterize the membrane
phenotype of purified HPCs. After the labeling procedure described by
Testa et al,25 at least 4,000 cells for each determination were analyzed by fluorescence-activated cell sorting (FACScan; Becton
Dickinson) for fluorescence intensity.
HPC clonogenetic assay.
In fetal calf serum (FCS)+ cultures,
purified HPCs were seeded (1 × 102 cells/mL dish, 2 or 3 plates per point) and cultured in 0.9% methylcellulose, 40% FCS
in IMDM supplemented with -thioglycerol (10 4
mol/L) (Sigma, St Louis, MO), ferric ammonium citrate (10 µg/mL), pure human transferrin (0.7 mg/mL), and different HGFs as detailed below, at 37°C in a 5% CO2/5% O2/90%
N2 humidified atmosphere. In FCS
cultures, FCS was substituted by bovine serum albumin (BSA), pure human
transferrin, human low-density lipoproteins, insulin, sodium pyruvate,
L-glutamine (2 × 103 mol/L), rare inorganic
elements25 supplemented with iron sulfate (4 × 108 mol/L), and nucleosides. Both FCS+
and FCS cultures were supplemented with FL (100 ng/mL), kit ligand (KL; 100 ng), IL-3 (100 U), Tpo (100 ng), GM-CSF (10 ng), Epo (3 U), M-CSF (250 U), and G-CSF (500 U).
CFU-GEMM, BFU-E, CFU-MK, and CFU-GM colonies were
scored on days 14-15 and 16-17 in FCS+ and
FCS cultures, respectively.
Unilineage HPC Liquid Suspension Culture
HPCs were seeded at 5 × 104 cells/mL, grown in liquid
suspension culture, and induced to specific differentiation by addition of appropriate HGF combinations: (1) in FCS
erythropoietic (E) culture, very low doses of IL-3 (0.01 U/mL) and
GM-CSF (0.001 ng/mL), and a saturating level of Epo (3 U); (2) in
FCS granulopoietic (G) culture, low amounts of IL-3
(1 U) and GM-CSF (0.1 ng), and a saturating amount of G-CSF (500 U);
(3) in FCS megakaryocytopoietic (Mk) culture,
saturating doses of Tpo (100 ng); and (4) in FCS+
monocytopoietic (Mo) culture, IL-6 (1 ng) and saturating amounts of
both FL (100 ng) and M-CSF (500 U). Cells were periodically counted and
analyzed for morphology and membrane phenotype through the 12 to 14 days of culture.
For the morphology analysis, cells were cytocentrifuged onto glass
slides and stained with May-Grünwald-Giemsa (Sigma).
Immunofluorescence Analysis
The following MoAbs (from Becton Dickinson, unless otherwise indicated)
directly conjugated with FITC were used to characterize the membrane
phenotype on cell samples collected at different days of culture:
glycophorin A (Immunotech, Marseilles, France) for
erythroid cells; CD11b or CD15 for granulocytic cells; CD14 for
monocytic cells; and CD61 for megakaryocytic cells. CD4 expression was assessed using anti-CD4 MoAb Leu3A directly conjugated with phycoerythrin (PE). PE-labeled anti-CXCR4 (clone 12G5; Pharmigen, San
Diego, CA) or anti-CCR5 (clone 2D7; Pharmigen) MoAbs were used for the
study of chemokine receptors expression. Cells were washed twice in
phosphate-buffered saline (PBS) and Fc-blocked by a 15-minute treatment
at room temperature with 10 µg/mL human IgG. Cells were then
incubated for 45 minutes at 4°C in the presence of appropriate
amounts of specific MoAbs. After 3 washes with cold PBS containing 2 mg/mL BSA, cells were resuspended in 0.2 mL PBS/2.5% formaldehyde and
analyzed by FACScan using the Lysis II program for fluorescence
intensity analysis. CXCR4 and CCR5 expression on HPCs was investigated
using anti-CXCR4 (clone 12G5) or anti-CCR5 (clone 2D7) MoAb along with
CD34 MoAb, by the double-labeling procedure described above. HPCs were
also labeled with a different CCR5 MoAb (clone 45502.111; R&D Systems)
that requires a demasking step to enhance anti-CCR5 MoAb recognition:
cells were first Fc-blocked by treatment with 10 µg/mL of human IgG,
washed twice in PBS, and then incubated for 15 minutes at 4°C in
PBS containing 4% formaldehyde. After 3 washings with PBS/BSA, the
cells were incubated for 45 minutes with anti-CCR5-FITC and CD34-PE
MoAbs, washed, and analyzed by flow cytometry.
Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) Analysis
Total RNA from 1 to 3 × 104 cells derived from each
lineage was extracted by the CsCl gradient technique, and Moloney
murine leukemia virus (Mo-MuLV) reverse transcribed
according to the manufacturer's instructions (Boehringer, Mannheim,
Germany). RT-PCR was performed in a final volume of 50 µL in the
presence of 2.5 U of Taq polymerase (Perkin-Elmer Cetus, Norwalk, CT)
as described.23 The cDNAs were normalized by the GAPDH gene
as described in Carè et al.29
To evaluate coreceptor mRNA expression, aliquots of cDNA were amplified
within the linear range by 40 PCR cycles with primers specific for
CXCR4, CCR5, and CCR3. PCR products were then electrophoresed on
agarose gel, transferred onto nylon membranes, and hybridized with the
specific probes. The following primers and probes were used: CXCR4
forward 5'CCTCTATGCTTTCCTTGG3', reverse
5'CCTGAAGACTCAGACTCA3' and probe
5'AGCAGAGGGTCCAGCCTCAAGAT CCTCT3'; CCR5 forward
5'TCACTTGGGTGGTGGCTGTG3', reverse
5'CCTGCATAGCTTGGTCCAAC3' and probe
5'GAAATGAGAAGAAGAGGCACAGGGCTGTGA3'; CCR3 forward
5'CCAGCTCTGTCTCTCCATCCA 3', reverse
5'GGGTTGATGATGAGTACGCTG3' and probe
5'GGTCAGATGCAGAAAATTGCCTA3'.
Virus Preparations and Infections
HIV-1 BaL virus preparations were obtained as described by Gartner et
al30 and titrated in terms of both picograms per milliliter of HIV p24 protein (by quantitative enzyme-linked immunosorbent assay
[ELISA]; Abbott, North Chicago, IL) and 50% tissue culture infectious dose per milliliter (TCID50/mL) by the end
dilution method31 performed on ex vivo monocyte-macrophage
cultures. Four to 7 × 104 cells/mL
were incubated overnight in the presence of lineage-specific HGFs
described above at 0.01 to 0.1 multiplicity of infection (m.o.i.) of BaL.
NL4-3 lymphotropic HIV-1 strain was prepared as described by Chelucci
et al,23 with viral titer ranging from 3 × 106 to 107 TCID50/mL. Cell pellets
(4 to 7 × 104 cells) were challenged with 0.01 to 0.1 m.o.i. of NL4-3 for 2 hours at 37°C. Complete lineage-specific
medium was then added and the cells were incubated overnight at
37°C.
Infected cells were extensively washed, diluted at 4 × 104/mL, and grown in liquid suspension culture for 12 to 14 days as described above. Aliquots of supernatants were removed every 2 to 3 days and stored at  80°C until used. Cell concentration
was adjusted with fresh medium and HGFs to 1 × 105
cells/mL.
A CD4+ UT-7 human megakaryoblastic cell line, resistant to
HIV infection,32 and a CEMss cell line and ex vivo
monocytic macrophagic cells were used as negative and positive
controls, respectively.
Chemokine-Mediated HIV Inhibition
Cell pellets of Mk and Mo precursors (day 5) were incubated with 1 µg/mL of SDF-1 or a cocktail of 500 ng/mL each of MIP-1, MIP-1,
and RANTES for 2 hours at 37°C in a final volume of 30 to 50 µL.
The cells were then challenged with T-lymphotropic or M-tropic HIV
strains as described above. After extensive washes, cells were
resuspended in medium containing specific HGFs and supplemented with
chemokines at the same concentration used in the preincubation step.
Complete medium was collected every 2 days and the cells resuspended in
fresh medium at 1 × 105/mL. Detection of p24 antigen
was performed by ELISA on serially diluted culture supernatants.
Positive and negative controls were those described for virus infection.
| |
RESULTS |
Unilineage HPC Differentiation/Maturation in Liquid Suspension Culture
The main characteristics of these culture systems have been extensively
reported25-28,33-35 and reviewed.36 The
purified HPC population is characterized by 92.3% ± 1.0% (mean ± SEM from 10 separate experiments) CD34+ cells as
evaluated by flow cytometry. The mean frequency of HPCs (BFU-E + CFU-MK + CFU-GM + CFU-GEMM) was 91.0% ± 1.45% (mean ± SEM from 10 separate experiments) as evaluated by
clonogenic assay, thus in line with previous
reports.25,27,28,36
Highly purified HPCs grown in liquid suspension culture supplemented
with the specific growth factors (see Materials and Methods) undergo a
gradual and homogeneous wave of differentiation specifically along the
E, G, Mk, and Mo pathway. Fluorescence studies showed that the gradual decrease of CD34+ membrane marker observed
in the first days of culture is followed by the progressive increasing
expression of glycophorin A, CD15, CD61, and CD14 markers in E, G, Mk,
and Mo cultures, respectively. At the end of the cultures,
cytofluorimetric and morphological analyses showed the following: 97%
erythroid cells in E cultures, greater than 98% granulopoietic cells
in G cultures, 97% to 99% megakaryocytes in Mk culture, and 95% to
100% monocytes/macrophages in Mo culture. These results indicate a
unilineage HPC proliferation, ie, growth of E-, G-, Mk-, Mo-committed
HPCs in the corresponding culture, as previously
reported26,33-36 (also see Figs 3 and 4).
Chemokine Receptor mRNA and Protein Expression in Quiescent HPCs and
During E, G, Mk, and Mo Differentiation/Maturation
CXCR4, CCR5, and CCR3 mRNA expression was analyzed by RT-PCR on total
cellular RNA on both quiescent HPCs and differentiating Mk, Mo, E, and
G cells. Results showed that day 0 quiescent HPCs express significant
levels of both CXCR4 and CCR5 (Fig 1A) and are negative
for CCR3 mRNA (data not shown). Identical results were obtained on mRNA
purified from CD34+ sorted HPCs (ie, >99.9%
CD34+ cells), thus excluding positive hybridization signals
from few contaminating cells present in purified HPCs (data not shown). Coreceptor expression was then examined in unilineage Mk, G, Mo, and E
pathways: at different days of differentiation/maturation, total RNA
was isolated and specifically amplified (Fig 1B). CXCR4 mRNA expression
is sustained up to late stages of both Mk and G maturation,
downmodulated at terminal days of Mo culture, and totally absent in E
culture. CCR5 mRNA was constantly expressed from the early to late
stages of Mo differentiation/maturation, and absent in Mk, G, and E
lineages. CCR3 mRNA was not detected in any of the unilineage cultures
(data not shown).
View larger version (17K):
[in this window]
[in a new window]
| Fig 1.
Representative results of CXCR4 and CCR5 mRNA expression
analyzed by RT-PCR in quiescent HPCs after purification (A) and during
in vitro megakaryocytic (Mk), monocytic (Mo), granulocytic (G), or
erythroid (E) differentiation (B). In this experiment, HPCs were 97%
CD34+ as evaluated by flow cytometry and 95%
clonogenetic progenitors. Total RNA from CEM cell line (CXCR4) and
monocytes (CCR5) and from UT-7 cell line was used as positive and
negative controls, respectively. RT-PCR samples were normalized for
GAPDH.
|
|
For CCR5 protein expression, 2 different MoAbs were used: 45502.111 clone that requires a demasking step to allow MoAb recognition, and 2D7
clone (see Materials and Methods). The latter MoAb was more suitable
for double labeling of Mo precursor cells (see below). In fact, we
observed that formaldehyde treatment used for 45502.111 clone labeling
markedly reduced the CD14 MoAb recognition.
Double-fluorescence analyses using 12G5-PE CXCR4 or 45502.111-FITC CCR5
MoAb in combination with an MoAb specific for human CD34 showed surface
expression of CXCR4 and CCR5 (Fig 2C and D). CXCR4 and
CCR5 expression was found on 50% and 60%, respectively, of the
CD34+ quiescent HPCs. Using the 2D7 CCR5 MoAb, less than
5% of CD34+/CCR5+ cells were found (not
shown).
View larger version (32K):
[in this window]
[in a new window]
| Fig 2.
Flow cytometric analyses of CXCR4 and CCR5 on 97%
CD34+ HPCs. (A) Unstained control for evaluation of HPC
physical parameters. (B) HPCs stained with PE- or FITC-conjugated
control antibodies. Cells were double-labeled with an FITC-conjugated
anti-CD34 along with CXCR4-PE MoAb (C) or CD34-PE along with
anti-CCR5-FITC MoAb (clone 45502.111) (D) as described in Materials
and Methods.
|
|
In Mk liquid differentiation culture, the fraction of
CD61+/CXCR4+ cells rapidly increased starting
from day 4-5, reaching more than 80% at terminal maturation
(Fig 3). In the Mo lineage, a significant
proportion (up to 80%) of
CD14+/CXCR4+ cells was present until day 9-12 of maturation, and then decreased to 30% at day 14. Mo precursors
showed a relatively broad doublet for CXCR4. We then investigated
whether this phenomenon could be related to a different stage of
maturation and/or to a heterogeneity in monocytic cell population.
Thus, according to the intensity of CXCR4 single labeling, we sorted
day 10 Mo precursors into CXCR4dim and
CXCR4bright populations: morphological analysis showed that
the former one was predominantly composed by mature monocytic cells
(ie, 76% of mature monocytes, 24% of pro-monocytes), while the latter
one mostly contained immature monocytic elements (ie, 35% mature
monocytes and 65% pro-monocytes) (data not shown). This observation
indicates that the different reactivity of anti-CXCR4 MoAb is related
to monocytic maturation: immature Mo precursors exhibiting higher labeling with respect to mature Mo cells.
View larger version (46K):
[in this window]
[in a new window]
| Fig 3.
Flow cytometric analysis of CXCR4 along megakaryocytic
(Mk), monocytic (Mo), granulocytic (G), and erythroid (E) HPC
differentiation. Cells were collected for analysis at the indicated
days of culture and double-labeled with PE-conjugated anti-CXCR4 MoAb
along with the specific cell-lineage FITC-conjugated MoAbs (-CD61,
-CD14, -CD15, -Glyc-A). Representative results from 1 of 3 independent
experiments are shown.
|
|
At day 5 of G differentiation, CXCR4+ cells represented
80% of the total population and decreased to 10% to 20% at the
end of the culture (day 14). Double-immunofluorescence analysis with CXCR4 MoAb and CD15 MoAb that recognizes neutrophilic granulocytes showed 2 distinct cell populations,
CXCR4+/CD15 and
CXCR4/CD15+, whose percentage decreased
and increased, respectively, during maturation (Fig 3). These 2 cell
populations were separated by sorting at day 12 of the culture,
cytocentrifuged onto glass slides, and identified by morphology
analysis. Most of the CXCR4/CD15+ cells
were neutrophilic granulocytes (60% mature band-neutrophils and 40%
neutrophilic metamyelocytes), whereas the large majority (90%) of
the CXCR4+/CD15 elements were
eosinophils and the remaining cells immature myelocytes (10%) (data
not shown). This result showed that the acquisition of the CD15 marker
by maturing neutrophilic cells is coupled with the loss of the CXCR4
receptor, which is expressed on almost all mature eosinophils. Maturing
E cells were negative for CXCR4 receptor at all
differentiation/maturation stages (Fig 3).
The same unilineage populations were analyzed for the expression of
CCR5 receptor together with the lineage-specific membrane markers
(Fig 4). Among the 4 lineages, only
differentiating monocytes expressed the HIV CCR5 coreceptor;
particularly, the CCR5+/CD14+ fraction
progressively increased during the monocytic maturative process and
reached 70% at the end of the culture. Moreover, labeling of
maturing Mo cells by using the 45502.111 CCR5 MoAb revealed the same
percentage of CCR5+ cells compared with those obtained in
double-labeling experiments using 2D7 clone (data not shown).
View larger version (41K):
[in this window]
[in a new window]
| Fig 4.
Flow cytometric analysis of CCR5 during megakaryocytic
(Mk), monocytic (Mo), granulocytic (G), and erythroid (E)
differentiation of HPCs. Cells were collected for analysis at the
indicated days of culture and double-labeled with PE-conjugated
anti-CCR5 MoAb (clone 2D7) along with the specific FITC-conjugated cell
lineage MoAbs. Representative results from 1 of 3 independent
experiments are shown.
|
|
Control experiments performed on freshly isolated monocytes and
neutrophils from PB showed a pattern of CXCR4 and CCR5 expression similar to that observed in Mo and neutrophilic cells grown in vitro
(Fig 5).
View larger version (34K):
[in this window]
[in a new window]
| Fig 5.
Immunofluorescence labeling of CXCR4 and CCR5 in normal
monocytes and neutrophilic granulocytes isolated from PB. (A and D)
Staining using matched control antibodies. Monocytes were stained with
either PE-conjugated CXCR4 (B) or CCR5 (C) MoAb along with CD14-FITC
MoAb; neutrophils were labeled with either PE-conjugated CXCR4 (E) or
CCR5 (F) MoAb along with CD15-FITC MoAb.
|
|
CD4 Protein Expression
We have previously shown that a consistent fraction (15%) of HPCs
are CD4+.23 In the Mo lineage, CD4+
cells represent 15% of the total population during early
differentiation (day 2-3) and reach greater than 80% at day 14-16 of
culture when the cells are fully differentiated. In both E and G
cultures, CD4 rapidly decreases, becoming barely detectable at the
final days of culture. In the Mk lineage, CD4+ cells
increased from 15% at day 0 to 30% at day 12 of culture as
previously described24 (and Fig
6).
View larger version (12K):
[in this window]
[in a new window]
| Fig 6.
Percentage of CD4+ cells during HPC ( ),
monocytic ( ), megakaryocytic ( ), granulocytic ( ), and
erythroid ( ) differentiation (mean ± SEM values from 4 separate
experiments). Cells from unilineage culture, collected
at the indicated days, were labeled with PE-conjugated Leu3A MoAb and
analyzed by FACS for fluorescence intensity.
|
|
T- and M-Tropic HIV Challenge of HPC and Mo, G, E, Mk Progenies:
CXCR4 and CCR5 Natural Ligands Inhibit HIV Infection
HPCs were challenged at day 0 with NL4-3 (T-tropic) or BaL (M-tropic)
viral strains as described in Materials and Methods. At day 1, after
extensive washing the treated cells were resuspended at 1 × 105 cells/mL in Mk-, Mo-, G-, or E-specific media.
Infection of HPCs was evaluated by measuring the p24 level in
supernatants collected every 2 to 3 days from each unilineage
differentiating culture starting from day 5 after infection. Both HIV
strains were able to infect the CD34+ HPCs; in particular,
challenge with T-tropic virus resulted in HIV replication in HPCs
committed to Mk differentiation and with M-tropic HIV in Mo cultures.
Finally, no viral replication was observed in HPCs committed to G or E
differentiation (data not shown).
We then evaluated the infection susceptibility of hematopoietic
precursors by challenging day 5 HPCs differentiating cells along the
Mk, Mo, G, and E pathways with either BaL or NL4-3 HIV strains. Our
results showed the following: (1) Mk precursors do not replicate
M-tropic virus (data not shown) whereas, as already reported,24 they are fully permissive for
T-tropic HIV replication (Fig 7A and B);
(2) no p24 release was detected in supernatants from G and E cultures
infected with either strain (data not shown); (3) Mo precursors were
permissive to infection with M-tropic (BaL) and, to a lesser extent,
with T-tropic (NL4-3) HIV strains (Fig 8A
and B).
View larger version (16K):
[in this window]
[in a new window]
| Fig 7.
Inhibition of T-tropic HIV infection of Mk precursors by
SDF-1. Day 5 Mk culture cells were treated or not with 1 µg/mL SDF-1
and then inoculated with 0.1 m.o.i of NL4-3. HIV p24 production was
measured through 9 days postinfection (p.i.) as described in Materials
and Methods. (A) Percentage of p24 level decrease in SDF-1 treated from
untreated (control values) Mks (mean ± SEM values from 3 independent
experiments). (B) Infection inhibition results from a representative
experiment. ( ), NL4-3; ( ), NL4-3 + SDF-1.
|
|
View larger version (14K):
[in this window]
[in a new window]
| Fig 8.
Inhibition of M-tropic (A) and T-tropic (B) HIV infection
of day 5 Mo precursors. Cells were treated or not with a cocktail of
MIP-1, MIP-1, and RANTES or SDF-1, and then inoculated with
either BaL or NL4-3 HIV strains, respectively (see Materials and
Methods). HIV p24 production was measured for 14 days postinfection
(p.i.). Representative results from 1 of 3 independent experiments are
shown. (), BaL; (), BaL + MIP-1, MIP-1, RANTES; (),
NL4-3; (), NL4-3 + SDF-1.
|
|
The role of CXCR4 and CCR5 in HIV infection was evaluated by blocking
experiments on the hematopoietic precursors susceptible to infection
with T-tropic (Mo and Mk) or M-tropic (Mo) HIV strains. At day 5 of HPC
differentiation, precursor cells were incubated with the specific
chemokines, SDF-1 or a cocktail of MIP-1, MIP-1, and RANTES, and
then infected with NL4-3 and BaL HIV isolates, respectively. The results shown in Fig 7 demonstrate a
significant level of inhibition of HIV spread on NL4-3-infected Mks
similar to that previously obtained by pretreating Mk precursors with anti-CD4 antibodies.24 Furthermore, a total block of viral
spread was observed in NL4-3-challenged Mo cells up to 14 days after infection (Fig 8B). Finally, treatment of Mo precursors with the MIP-1, MIP-1, RANTES cocktail inhibited the release of HIV at early culture times (day 5-9), while at later days viral release overcame the chemokine-induced antiviral effect (Fig 8A).
| |
DISCUSSION |
We previously showed in vitro infection of HPCs with T-tropic HIV
strains by testing single HPC-derived colonies for HIV mRNA expression
and/or p24 production.23 These results were supported by
the finding that T-tropic strains also replicate in HPCs induced to Mk
differentiation in liquid suspension culture.24 HPC and Mk
susceptibility to HIV infection was attributed to detectable levels of
the major HIV receptor, CD4, expressed on CD34+
cells23 and Mk precursors.24 However, the
recently demonstrated role of chemokine coreceptors in HIV entry and
replication argues against an exclusive correlation between HIV
susceptibility and CD4 receptor expression.
In the present study we evaluated the expression and role of the most
commonly used HIV coreceptors, CXCR4, CCR5, and CCR3, in HPCs and
precursor cells, particularly at discrete stages of HPC
differentiation/maturation along the E, G, Mk, and Mo lineages.
Consistent with mRNA expression, cytofluorimetric analyses showed that
50% of CD34+ cells were CXCR4+. This
finding is in line with our previous studies23,24 on the
susceptibility to T-lymphotropic NL4-3 virus of day 0 HPCs. RT-PCR on
purified CD34+ HPCs revealed the presence of CCR5
transcripts, in line with the cytofluorimetric results using the
45502.111 clone (60% of CCR5+ cells). A markedly lower
CD34+/CCR5+ cell fraction (<5%) was found
using the 2D7 clone. Because both anti-CCR5 MoAbs give a virtually
identical labeling pattern on Mo precursors (Fig 4 and data not shown),
the discrepancy found in CCR5 labeling of CD34+ cells may
be related to a differential epitope conformation of CCR5 molecule
expressed on HPCs. Along these lines, controversial data on CCR5
protein expression by CD34+ cells have been reported. Ruiz
et al19 showed the presence of CCR5 protein on PB-derived
CD34+ cells, whereas other investigators15,17
did not detect CCR5 protein on most BM HPCs.
Productive infection by M-tropic BaL strain was observed only when
challenged HPCs were induced to differentiate along the Mo lineage.
This finding is not surprising considering that, differently than Mk,
E, and G, Mo precursors exhibited a sustained CCR5 expression during
the whole maturative process.
The study of the chemokine coreceptor pattern through Mo, Mk, G, or E,
unilineage culture showed that CXCR4 mRNA and protein are significantly
expressed in all the series, with the exception of E lineage. In the Mk
culture, we observed a high and almost constant expression during all
differentiation/maturation stages, while in the Mo pathway a
downmodulation of CXCR4 is observed at both mRNA and protein level at
the late stage of maturation. In the G lineage, progressive decrease of
CXCR4 protein during maturation was shown coupled with the acquisition
of CD15 marker by maturing neutrophilic granulocytes. This finding is
in line with a recent study showing that circulating neutrophils are
CXCR4.37 Interestingly, in late G
culture we observed that the minority of cells exhibiting the
CXCR4+/CD15 phenotype were predominantly
eosinophils, suggesting a possible role for SDF-1, the natural ligand
of CXCR4, in the migration/chemotaxis of these cells. Finally, we
showed that the expression of CCR5 is restricted to Mo lineage from
early to late stages of differentiation-maturation, in agreement with
the well-defined functions of CCR5 natural ligands (ie, MIP-1,
MIP-1, and RANTES), involved mostly in the recruitment and
activation of monocytic-macrophagic cells.1,3,38
The present data on HIV receptor and coreceptor expression correlate
with the precursor infection susceptibility, in that (1) resistance of
G and E cells to both HIV strains may be related to the virtual lack of
CD4 expression; (2) Mk cells expressing CD4 and CXCR4 molecules were
able to replicate T-tropic virus, but were resistant to M-tropic HIV
replication; (3) Mo precursor cells expressing both CD4 and CCR5/CXCR4
receptors were permissive to replication of both HIV strains.
Susceptibility to T-tropic HIV by Mo precursors is intriguing,
considering the numerous initial reports on monocytic infectability
restricted to M-tropic HIV stains. In this study, we infected an Mo
precursor population which, at this stage of differentiation (day 5),
is composed of 68% monoblasts, 27% promonocytes, 2% mature
monocytes, and few contaminating (2%), but not infectable,
granulocytic precursors (our unpublished results,
1994). Thus, our results are not comparable with those
regarding fully mature PB-derived monocytic/macrophagic cells. Recent
studies indicate that monocytes express CXCR4 and may be entered by
T-lymphotropic HIV strains.39,40 However, as a consequence
of an intracellular block, macrophage-derived monocytes lack the
ability to productively replicate the virus.40 Thus, the
macrophagic terminal differentiation may lead to the loss of
intracellular factor(s) critical for the full replication of T-tropic
HIV that, conversely, may be present in differentiating precursor
cells. The reduced susceptibility of macrophages to infection by
T-tropic HIV strains may also be related to the marked decline of CXCR4
expression observed during monocyte to macrophage maturation.41 Furthermore it has been reported that the
T-tropic HIV-1MN strain can replicate in CD34+
cell-derived monocytes, even at high m.o.i.,42 and a recent study showed that BM-derived Mo progenitors and precursors may be
infected in vitro by both M- and T-tropic HIV strains.18 Taken together, these observations suggest that cells pertaining to the
monocytic lineage are infectable by both T- and M-tropic HIVs, from
precursors up to the monocyte stage, while at terminal maturation
(macrophages) they are only infectable by M-tropic viruses.
The role of chemokine receptors in HIV infection of Mo and Mk
precursors was analyzed by inhibition experiments that consisted of
treating cells with saturating amounts of either CXCR4 or CCR5 ligand,
ie, SDF-1 (T-tropic HIV infection), or a cocktail of MIP-1, MIP-1, and RANTES (M-tropic infection), respectively. The
significant reduction of viral spread observed in both cases strongly
suggests that HIV entry in Mk and Mo precursors is largely mediated by the CD4/CXCR4 or CD4/CCR5 receptors, respectively. However, in the case
of Mk precursors infected with T-tropic strain, the inhibition of
replication did not appear complete, suggesting the existence of
additional mechanisms of viral entry. This observation is in line with
our previous study showing a similar partial inhibition in Mk
precursors treated with anti-CD4 MoAb.24 Similarly, even large amounts of the MIP-1, MIP-1, and RANTES cocktail only delay
the spread of M-tropic HIV in Mo cells. Consistent with this finding,
an incomplete or ineffective block of HIV replication by the CCR5
ligands on monocytes-macrophages has been described.11,43 Altogether, these data suggest the intrinsic ability of HIV to use
alternative routes of entry (ie, endocytosis, phagocytic mechanisms) and/or different coreceptors to infect both Mk and Mo precursors.
In conclusion, our studies on the modulation of CXCR4 and CCR5
chemokine receptors along the 4 hematopoietic differentiation pathways
shed light on the differential susceptibility of hematopoietic precursors to different HIV-1 strains and may represent a useful tool
to investigate the role of these chemokines in the control of normal hematopoiesis.
| |
ACKNOWLEDGMENT |
The 12G5 MoAb was obtained through the AIDS Research and Reference
Reagent Program, AIDS Program, National Institute of Allergy and
Infective Diseases, National Institutes of Health,
from Dr James Hoxie. We are grateful to Dr Ian Clark-Lewis (Biomedical Research Centre, University of British Columbia, Vancouver,
Canada) for kindly providing SDF-1.
| |
FOOTNOTES |
Submitted June 15, 1998; accepted May 4, 1999.
Supported by the AIDS Project (no. 10A/N) of the Ministry of Health,
Rome, Italy.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to C. Peschle, MD, Thomas Jefferson
University, Kimmel Cancer Center, Bluemle Life Sciences Bldg, Room 902, 233 S 10th St, Philadelphia, PA 19107-5541.
| |
REFERENCES |
1.
Baggiolini M, Dewald B, Moser B:
IL-8 and related chemotactic cytokines-CXC and CC chemokines.
Adv Immunol
55:97, 1994[Medline]
[Order article via Infotrieve]
2.
Murphy PM:
The molecular biology of leukocyte chemoattractant receptors.
Annu Rev Immunol
12:593, 1994[Medline]
[Order article via Infotrieve]
3.
Shall TJ, Bacon KB:
Chemokines, leukocyte trafficking, and inflammation.
Curr Opin Immunol
6:865, 1994[Medline]
[Order article via Infotrieve]
4.
Feng Y, Broden CC, Kennedy PE, Berger EA:
HIV-1 entry cofactor: Functional cDNA cloning of a seven-transmembrane G protein coupled receptor.
Science
272:872, 1996[Abstract]
5.
Bleul CC, Farzan M, Choe H, Parolin C, Clark-Lewis I, Sodroski J, Springer TA:
The lymphocyte chemoattractant SDF-1 is a ligand for LESTR/fusin and blocks HIV-1 entry.
Nature
382:829, 1996[Medline]
[Order article via Infotrieve]
6.
Oberlin E, Amara A, Bachelerie F, Bessia C, Virelizier JL, Arenzana Seisdedos F, Schwartz O, Heard JM, Clark-Luis I, Leler D, Loetscher M, Baggiolini M, Moser B:
The CXC chemokine SDF-1 is the ligand for LESTR/fusin and prevents infection by T-cell-line-adapted HIV-1.
Nature
382:833, 1996[Medline]
[Order article via Infotrieve]
7.
Alkhatib G, Combadiere C, Broder CC, Feng Y, Kennedy PE, Murphy PM, Berger EA:
CC CKR5: A RANTES, MIP-1, MIP-1 receptor as a fusion cofactor for macrophage-tropic HIV-1.
Science
272:1955, 1996[Abstract]
8.
Choe H, Farzan M, Sun Y, Sullivan N, Rollins B, Ponarth PD, Wu L, Mackay CR, La Rosa G, Newman W, Gerard N, Gerard C, Sodroski J:
The -chemokines receptor CCR3 and CCR5 facilitate infection by primary HIV-1 isolates.
Cell
85:1135, 1996[Medline]
[Order article via Infotrieve]
9.
Deng HK, Liu R, Ellmeier W, Choe S, Unutmaz D, Burkhart M, Di Marzio P, Marmon S, Sutton RE, Hill CM, Davis CB, Peiper SC, Schall TJ, Littman DR, Landau NR:
Identification of a major coreceptor for primary isolates of HIV-1.
Nature
381:661, 1996[Medline]
[Order article via Infotrieve]
10.
Doranz BJ, Rucker J, Yi Y, Smyth RJ, Samson M, Peiper S, Parmentier M, Collman RJ, Doms RW:
A dual-tropic, primary HIV-1 isolate that use fusin and the -chemokine receptors CKR5, CKR3, and CKR2b as fusion cofactors.
Cell
85:1149, 1996[Medline]
[Order article via Infotrieve]
11.
Dragic T, Litwin V, Allaway GP, Martin SR, Huang Y, Nagashima KA, Cayanan C, Maddon PJ, Koup RA, Moore JP, Paxton WA:
HIV-1 entry into CD4+ cells is mediated by the chemokine receptor CC-CKR-5.
Nature
381:667, 1996[Medline]
[Order article via Infotrieve]
12.
Cocchi F, De Vico AL, Garzino-Demo A, Arya SK, Gallo RC, Lusso P:
Identification of RANTES, MIP-1, and MIP-1 as the major HIV- suppressive factors produced by CD8+ T cells.
Science
270:1811, 1995[Abstract/Free Full Text]
13.
Connor RI, Sheridan KE, Ceredini D, Choe S, Landau NR:
Change in coreceptor use correlates with disease progression in HIV-1-infected individuals.
J Exp Med
185:621, 1997[Abstract/Free Full Text]
14.
Wang JF, Liu ZY, Groopman JE:
The -chemokine receptor CXCR4 is expressed on megakaryocytic lineage from progenitor to platelets and modulates migration and adhesion.
Blood
92:756, 1998[Abstract/Free Full Text]
15.
Berkowitz RD, Beckerman KP, Schall TJ, McCune JM:
CXCR4 and CCR5 expression delineates targets for HIV-1 disruption of T cell differentiation.
J Immunol
161:3702, 1998[Abstract/Free Full Text]
16.
Su S, Mukaida N, Wang J, Zhang Y, Takami A, Nakao S, Matsushima K:
Inhibition of immature erythroid progenitor cell proliferation by macrophage inflammatory protein-1 by interacting mainly with a C-C chemokine receptor, CCR1.
Blood
90:605, 1997[Abstract/Free Full Text]
17.
Lee B, Retajczak J, Doms RW, Gewirtz AM, Ratajczak MZ:
Coreceptor/chemokine receptor expression on human hematopoietic cells: Biological implications for human immunodeficiency virus-type 1 infection.
Blood
93:1145, 1999[Abstract/Free Full Text]
18.
Carr JM, Ramshaw HS, Li P, Burrell CJ:
CD34+ cells and their derivatives contain mRNA for CD4 and human immunodeficiency virus (HIV) co-receptors and are susceptible to infection with M- and T-tropic HIV.
J Gen Virol
79:71, 1998[Abstract]
19.
Ruiz ME, Cicala C, Arthos J, Kinter A, Catanzaro AT, Adelsberger J, Holmes KL, Cohen OJ, Fauci AS:
Peripheral blood-derived CD34+ progenitor cells: CXC chemokine receptor 4 and CC chemokine receptor 5 expression and infection by HIV.
J Immunol
161:4169, 1998[Abstract/Free Full Text]
20.
Deichmann M, Kronenwett R, Haas R:
Expression of the human immunodeficiency virus type-1 coreceptors CXCR-4 (fusin, LESTR) and CKR-5 in CD34+ hematopoietic progenitor cells.
Blood
89:3522, 1997[Abstract/Free Full Text]
21.
Hamada T, Mohle R, Hesselgesser J, Hoxie J, Nachman RL, Moore MAS, Refli S:
Transendothelial migration of megakaryocytes in response to stromal cell-derived factor 1 (SDF-1) enhances platelet formation.
J Exp Med
188:539, 1998[Abstract/Free Full Text]
22.
Riviere C, Subra F, Cohen-Solal K, Cordette-Lagarde V, Letestu R, Auclair C, Vainchenker W, Louache F:
Phenotypic and functional evidence for the expression of CXCR4 receptor during megakaryocytopoiesis.
Blood
93:1511, 1999[Abstract/Free Full Text]
23.
Chelucci C, Hassan HJ, Locardi C, Bulgarini D, Pelosi E, Mariani G, Testa U, Federico M, Valtieri M, Peschle C:
In vitro human immunodeficiency virus-1 infection of purified hematopoietic progenitors in single-cell culture.
Blood
85:1181, 1995[Abstract/Free Full Text]
24.
Chelucci C, Federico M, Guerriero R, Mattia G, Casella I, Pelosi E, Testa U, Mariani G, Hassan HJ, Peschle C:
Productive HIV-1 infection of purified megakaryocytic progenitors/precursors and maturing megakaryocytes.
Blood
91:1225, 1998[Abstract/Free Full Text]
25.
Testa U, Fossati C, Samoggia P, Masciulli R, Mariani G, Hassan HJ, Sposi NM, Guerriero R, Rosato V, Gabbianelli M, Pelosi E, Valtieri M, Peschle C:
Expression of growth factor receptors in unilineage differentiation culture of purified hematopoietic progenitors.
Blood
88:3391, 1996[Abstract/Free Full Text]
26.
Guerriero R, Testa U, Gabbianelli M, Mattia G, Montesoro E, Macioce G, Pace A, Ziegler B, Hassan HJ, Peschle C:
Unilineage megakaryocytic proliferation and differentiation of purified hematopoietic progenitors in serum-free liquid culture.
Blood
86:3725, 1995[Abstract/Free Full Text]
27.
Labbaye C, Valtieri M, Testa U, Giampaolo A, Meccia E, Sterpetti P, Parolini I, Pelosi E, Bulgarini D, Cayre YE, Peschle C:
Retinoic acid downmodulates erythroid differentiation and GATA-1 expression in purified adult progenitor culture.
Blood
83:651, 1994[Abstract/Free Full Text]
28.
Gabbianelli M, Sargiacomo M, Pelosi E, Testa U, Isacchi G, Peschle C:
"Pure" human hematopoietic progenitors: permissive action of fibroblast growth factor.
Science
249:1561, 1990[Abstract/Free Full Text]
29.
Carè A, Silvani A, Meccia E, Mattia G, Stoppacciaro A, Parmiani G, Peschle C, Colombo M:
HOXB7 constitutively activates basic fibroblast growth factor in melanomas.
Mol Cel Biol
16:4842, 1996[Abstract]
30.
Gartner S, Markovitz P, Markovitz DM, Kaplan MH, Gallo RC, Papovic P:
The role of mononuclear phagocytes in HTLV-III/LAV infection.
Science
233:215, 1986[Abstract/Free Full Text]
31.
Federico M, Taddeo B, Carlini F, Nappi F, Verani P, Rossi GB:
A recombinant retrovirus carrying a nonproducer human immunodeficiency virus (HIV) type 1 variant induces resistance to superinfecting HIV.
J Gen Virol
74:2099, 1986[Abstract/Free Full Text]
32.
Baiocchi M, Olivetta E, Chelucci C, Santarcangelo AC, Bona R, D'Aloja P, Testa U, Komatsu N, Verani P, Federico M:
HIV-resistant CD4 positive UT-7 megakaryocytic human cell line becomes highly HIV-1 and HIV-2 susceptible upon CXCR4 transfection: induction of cell differentiation by HIV-1 infection.
Blood
89:2670, 1997[Abstract/Free Full Text]
33.
Sposi NM, Zon LI, Caré A, Valtieri M, Testa U, Gabbianelli M, Mariani G, Bottero L, Mather C, Orkin SH, Peschle C:
Cell cycle-dependent initiation and lineage-dependent abrogation of GATA-1 expression in pure differentiating progenitors.
Proc Natl Acad Sci USA
89:6353, 1992[Abstract/Free Full Text]
34.
Labbaye C, Valtieri M, Barberi T, Meccia E, Masella B, Pelosi E, Condorelli G, Testa U, Peschle C:
Differential expression and functional role of GATA-2, NF-E2 and GATA-1 in normal adult hematopoiesis.
J Clin Invest
95:2346, 1995
35.
Gabbianelli M, Pelosi E, Montesoro E, Valtieri M, Lucchetti L, Samoggia P, Vitelli L, Barberi T, Testa U, Lyman S, Peschle C:
Multi-level effects of flt3 ligand on human hematopoiesis: Expansion of putative stem cells and proliferation of granulomonocytic progenitors/monocytic precursors.
Blood
86:1661, 1995[Abstract/Free Full Text]
36.
Ziegler B, Testa U, Condorelli G, Vitelli L, Valtieri M, Peschle C:
Unilineage hematopoietic differentiation in bulk and single cell culture.
Stem Cells
16:51, 1998
37.
Hori T, Sakaida H, Sato A, Nakajima T, Shida H, Yoshie O, Uchiyama T:
Detection and delineation of CXCR-4 (fusin) as an entry and fusion cofactor for T cell-tropic HIV-1 by three different monoclonal antibodies.
J Immunol
160:180, 1998[Abstract/Free Full Text]
38.
Luster AD:
Chemokines: Chemotactic cytokines that mediate inflammation.
N Engl J Med
338:436, 1998[Free Full Text]
39.
Verani A, Pesenti E, Polo S, Tresoldi E, Scarlatti G, Lusso P, Siccardi AG, Vercelli D:
Cutting edge: CXCR4 is a functional coreceptor for infection of human macrophages by CXCR4-dependent primary HIV isolates.
J Immunol
161:2084, 1998[Abstract/Free Full Text]
40.
Zaitseva M, Blauvelt A, Lee S, Lapham CK, Klaus-Kovtun V, Mostowski H, Manischewitz J, Golding H:
Expression and function of CCR5 and CXCR4 on human Langerhans cells and macrophages: Implications for HIV primary infection.
Nat Med
3:1369, 1997[Medline]
[Order article via Infotrieve]
41.
Naif HM, Li S, Alali M, Sloane A, Wu L, Kelly M, Lynch G, Lloyd A, Cunningham AL:
CCR5 expression correlates with susceptibility of maturing monocytes to human immunodeficiency virus type 1 infection.
J Virol
72:830, 1998[Abstract/Free Full Text]
42.
Warren MK, Rose WL, Cone JL, Rice WG, Turpin JA:
Differential infection of CD34+ cell-derived dendritic cells and monocytes with lymphocyte-tropic and monocyte-tropic HIV-1 strains.
J Immunol
158:5035, 1997[Abstract]
43.
Cheng Mayer C, Liu R, Landau NR, Stamatatos L:
Macrophage tropism of human immunodeficiency virus type 1 and utilization of the CC-CKR5 co-receptor.
J Virol
71:1657, 1997[Abstract]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
Related Letter in Blood Online:
-
Homogeneous expression of CXC chemokine receptor 4 (CXCR4) on G-CSF-mobilized peripheral blood CD34+ cells
- Sergio Rutella, Luca Pierelli, Giuseppina Bonanno, Giovanni Scambia, Giuseppe Leone, and Carlo Rumi
Blood 2000 95: 4015-4016.
[Full Text]
[PDF]
This article has been cited by other articles:
|
|
|
|
 
C. A. Williams, D. Mondal, and K. C. Agrawal
The HIV-1 Tat Protein Enhances Megakaryocytic Commitment of K562 Cells by Facilitating CREB Transcription Factor Coactivation by CBP
Experimental Biology and Medicine,
December 1, 2005;
230(11):
872 - 884.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Mondal, C. A. Williams, M. Ali, M. Eilers, and K. C. Agrawal
The HIV-1 Tat Protein Selectively Enhances CXCR4 and Inhibits CCR5 Expression in Megakaryocytic K562 Cells
Experimental Biology and Medicine,
October 1, 2005;
230(9):
631 - 644.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. S. Koka, C. M. R. Kitchen, and S. T. Reddy
Targeting c-Mpl for Revival of Human Immunodeficiency Virus Type 1-Induced Hematopoietic Inhibition When CD34+ Progenitor Cells Are Re-Engrafted into a Fresh Stromal Microenvironment In Vivo
J. Virol.,
October 15, 2004;
78(20):
11385 - 11392.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Thiebot, F. Louache, B. Vaslin, T. de Revel, O. Neildez, J. Larghero, W. Vainchenker, D. Dormont, and R. Le Grand
Early and Persistent Bone Marrow Hematopoiesis Defect in Simian/Human Immunodeficiency Virus-Infected Macaques despite Efficient Reduction of Viremia by Highly Active Antiretroviral Therapy during Primary Infection
J. Virol.,
December 1, 2001;
75(23):
11594 - 11602.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
R. Guerriero, G. Mattia, U. Testa, C. Chelucci, G. Macioce, I. Casella, P. Samoggia, C. Peschle, and H. J. Hassan
Stromal cell-derived factor 1{alpha} increases polyploidization of megakaryocytes generated by human hematopoietic progenitor cells
Blood,
May 1, 2001;
97(9):
2587 - 2595.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. S. Kim, X. J. You, M.-E. Harmon, J. Overbaugh, and H. Fan
Use of Helper-Free Replication-Defective Simian Immunodeficiency Virus-Based Vectors To Study Macrophage and T Tropism: Evidence for Distinct Levels of Restriction in Primary Macrophages and a T-Cell Line
J. Virol.,
March 1, 2001;
75(5):
2288 - 2300.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
L. Alessandrini, A. C. Santarcangelo, E. Olivetta, F. Ferrantelli, P. d’Aloja, K. Pugliese, E. Pelosi, C. Chelucci, G. Mattia, C. Peschle, et al.
T-tropic human immunodeficiency virus (HIV) type 1 Nef protein enters human monocyte-macrophages and induces resistance to HIV replication: a possible mechanism of HIV T-tropic emergence in AIDS
J. Gen. Virol.,
December 1, 2000;
81(12):
2905 - 2917.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
S. Rutella, L. Pierelli, G. Bonanno, G. Scambia, G. Leone, and C. Rumi
Homogeneous expression of CXC chemokine receptor 4 (CXCR4) on G-CSF-mobilized peripheral blood CD34+ cells
Blood,
June 15, 2000;
95(12):
4015 - 4016.
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Nagase, M. Miyamasu, M. Yamaguchi, T. Fujisawa, K. Ohta, K. Yamamoto, Y. Morita, and K. Hirai
Expression of CXCR4 in Eosinophils: Functional Analyses and Cytokine-Mediated Regulation
J. Immunol.,
June 1, 2000;
164(11):
5935 - 5943.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION