|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 5 (September 1), 1999:
pp. 1717-1726
Suppression of Interleukin-12 Production by Human Monocytes After
Preincubation With Lipopolysaccharide
By
Miriam Wittmann,
Vivi-Ann Larsson,
Petra Schmidt,
Gabriele Begemann,
Alexander Kapp, and
Thomas Werfel
From Hannover Medical University, Department of Dermatology and
Allergology, Hannover, Germany.
 |
ABSTRACT |
Interleukin-12 (IL-12) is a potent proinflammatory and
immunoregulatory cytokine skewing T lymphocytes to express a type 1 cytokine pattern. Optimal expression of IL-12 mRNA and bioactivity in
vitro requires specific priming of monocytes by interferon- (IFN-) or granulocyte-macrophage colony-stimulating factor (GM-CSF) before lipopolysaccharide (LPS) stimulation. We show here for the first
time that the production of IL-12 by IFN-- or GM-CSF-primed human
monocytes can be completely suppressed by preincubation with LPS (from
Escherichia coli Serotype 055:B5) for 6 to 24 hours before the
priming procedure. A dose-dependent suppression of IL-12p70 was
measured on the levels of intracellular cytokine production and
cytokine secretion. mRNA studies on the expression of p40 and p35
showed an LPS-induced downregulation of both subunits. The results of
several different experimental approaches suggest that IL-12
downregulation was not due to endogenous IL-10, IL-4, prostaglandin
E2 (PGE2), tumor necrosis factor- (TNF-),
or nitric oxide (NO) production induced by LPS. Moreover,
preincubation of monocytes with LPS did not lead to a downregulation of
the CD14 antigen, which is an LPS receptor. LPS preincubation in this experimental setting did not result in a general hyporesponsiveness of
the monocytes, as IL-6 production as well as IFN--induced upregulation of CD54 did not decline. Downregulation of IL-12 was not
due to changes in mRNA stability. These findings show that the
immunoregulatory important cytokine, IL-12, underlies itself a complex regulation.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
INTERLEUKIN-12 (IL-12) is a
75-kD heterodimeric cytokine that plays a crucial role in
both the innate and the acquired immune response. The major cells
producing IL-12 were found to be macrophages/monocytes, but other cell
types have also been reported to produce IL-12. These include dendritic
cells, neutrophils, keratinocytes, and murine mast cells.1
The two covalently disulfide-linked N-glycosylated polypeptide chains
of approximately 40 kD (p40) and 35 kD (p35) are encoded by two
separate genes2 located on different chromosomes and are
independently regulated.1,3 Both subunits have to be produced within the same cell to obtain the biologically active dimer.2 In contrast to p40, p35 is only secreted as part of the p70 heterodimer. The secreted monomeric p40 has no biologic activity, whereas the p40 homodimer p(40)2 binds to the
IL-12 receptor, but does not transduce a signal, thus acting as an
IL-12 antagonist.4
Although initially described as a cytokine activating cytotoxic
lymphocytes spontaneously, the major biological significance of IL-12
secretion lies in its effects on T-helper cells. IL-12 is known to
drive Th1 reactions in physiological and pathological immune responses,
mainly mediated by its capacity to stimulate growth and interferon-
(IFN-) production in T cells and natural killer (NK)
cells.5-7 Some investigators even consider this cytokine to
be an obligatory factor for Th1 generation and
proliferation.8,9
In addition to the promotion of Th1 cell development, IL-12 has a broad
range of biologic activities including the regulation and proliferation
of T and NK cells, the differentiation of CD8+ T cells, and
hematopoiesis. Its involvement in autoimmunity has been shown in
different diseases. When applied in vivo, IL-12 was shown to enhance
the resistance to bacterial and parasitic infections, to promote
antitumor immunity, and to influence antiviral responses including
human immunodeficiency virus (HIV) in vivo or in vitro. Modulation of
IL-12-dependent signaling may provide a therapeutic option for
altering the Th1-Th2 balance in allergic and autoimmune diseases, as
well as in other conditions.
Bacteria, bacterial products including lipopolysaccharide (LPS),
lipoteichonic acid, protein extracts, heat shock proteins, and
intracellular parasites have been described to induce production of
IL-12 by macrophages/monocytes.1,10,11
The most potent inhibitor of IL-12 synthesis by macrophages/monocytes
appears to be IL-10, which acts at the protein, as well as at the mRNA
level. IL-10 negatively regulates IL-12p40
expression/accumulation.12,13 Similar to IL-10, addition of
prostaglandin E2 (PGE2) to cultures of
LPS-stimulated human peripheral blood mononuclear cell (PBMC) downregulates IL-12 production.14 IL-4, IL-13, and
transforming growth factor- (TGF-) can also suppress the
production of IL-12 when added simultaneously with bacterial inducers.
In contrast, pretreatment with IL-4 or IL-13 followed by activation
with LPS enhances IL-12 production.15
In this study, we show that the well-known induction of IL-12
production with LPS also underlies a complex regulation, with a
sequence-dependent reaction to known stimuli. Preincubation with LPS
can efficiently inhibit the production of bioactive IL-12 by monocytes
stimulated with a combination of IFN- or granulocyte-macrophage colony-stimulating factor (GM-CSF) and LPS.
| |
MATERIALS AND METHODS |
Cytokines and reagents.
All cytokines were used as purified recombinant human preparations.
Human IFN- was kindly provided by Dr Karl Thomae GmbH (Biberach an
der Riss, Germany), LPS was derived from Escherichia coli
(E coli) Serotype 055:B5 (Sigma, Deisenhofen, Germany), GM-CSF (Genzyme, Rüsselsheim, Germany) anti-IL-4 antibody useful for neutralization of human IL-4 bioactivity with a low endotoxin level
(R&D Systems, Wiesbaden, Germany), neutralizing rat anti-human IL-10
monoclonal antibody (MoAb) with a low endotoxin level (PharMingen, Hamburg, Germany), neutralizing anti-human tumor necrosis factor- (TNF-) antibody with a low endotoxin level (R&D Systems),
indomethacin (Serva, Braunschweig, Germany), N-methyl-L-arginine (NMLA)
(Sigma); actinomycin D (Sigma), paclitaxel (PTXL; Taxol from Taxus
barcarta, Bristol Arzneimittel GmbH, München, Germany). For the
0.82 mmol/L stock solution of PTXL, the endotoxin content was less than
25 pg/mL as determined by the Limulus amoebocyte lysate assay.
Isolation and culture of human monocytes.
PBMC from healthy donors were separated by Ficoll-Hypaque density
gradient centrifugation and resuspended in Iscove medium supplemented
with 4% AB serum (IAB medium). Monocytes were isolated by
adherence on petri dishes (Heraeus, Hannover, Germany). After 3 hours
(37°C, 5% CO2), the nonadherent cells were removed by several washes with phosphate-buffered saline (PBS) and the adherent cell population was detached. Detached cells were washed and
resuspended in IAB medium and then incubated in round bottom 96-well
microtiter plates for several hours. Monocytes were subsequently
exposed to LPS or medium for 24 hours (here referred to as
"preincubation"). After a change of culture medium, cells were
primed with IFN- (300 U/mL) or GM-CSF (100 ng/mL) 1 to 2 hours
before additon of LPS (50 ng/mL) (in the following referred to as
"stimulation") for various times as indicated in the Results.
When indicated in the Results, monocytes were further purified after
the adherent step using Dynabeads M-450 Sheep anti-mouse
IgG (Dynal, Hamburg, Germany). Briefly, cells were incubated with a
combination of CD2 and CD21 antibodies (mouse IgG1; Dako, Hamburg,
Germany) for 2 hours at 4°. The protocol was then followed
according to the suppliers' instructions. The resulting cell
preparations contained up to 90% monocytes, as assessed by CD14
staining and fluorescence-activated cell sorting (FACS) analysis.
mRNA isolation and reverse transcription (RT).
mRNA was isolated from 100,000 monocytes/well using a mRNA isolation
kit ("mRNA direct isolation kit"; Dynal) according to the
supplier's instructions. Resulting Poly(A)+ RNA was stored
at  80°C. RNA was then subjected to first-strand cDNA
synthesis using Oligo(dT)15 for full-length cDNA synthesis. The RT reaction mixture contained final concentrations of 50 U Expand-RT (Boehringer-Mannheim, Mannheim, Germany), 20 U of RNase inhibitor (RNase out; Life Technologies, Eggenheim, Germany), 10 mmol/L
dithiothreitol (DTT), 1× first-strand RT buffer for Expand-RT, 0.5 mmol/L of each deoxynucleoside triphosphate
(dNTP) (Boehringer-Mannheim), and 80 pmol
Oligo(dT)15 (Boehringer-Mannheim). To control for DNA
contamination, cDNA synthesis was performed in the absence of RT.
First-strand cDNA was stored at 20°C.
Semiquantitative polymerase chain reaction (PCR).
A method of immunochemical detection of DNA fragments with
digoxigenin-labeled samples and biotinylated capture probes was used as
previously described.16 For PCR amplification, the
resulting cDNA was either diluted and labeled with dig-NTP
(PCR-enzyme-linked immunosorbent assay [ELISA], Dig-Labeling kit;
Boehringer-Mannheim) at a final concentration of 200 µmol/L or
undiluted cDNA without further addition of NTPs was amplified. The PCR
reaction mixture contained a final concentration of 1 mmol/L
MgCl2, 0.1 µmol/L of the specific primers and 1.25 U
Taq-Polymerase (Life Technologies). Primers specific for IL-12p40 and
p35 were purchased from Biosource (Ratingen, Germany) and Stratagene
(Heidelberg, Germany), respectively. For -actin, the following
primers were used (forward: 5'GAGCGGGAAATCGTGCGTGACATT, reverse:
5'GAAGGTAGTTTCGTG-GATGCC). PCR reactions were performed for 28 cycles with annealing temperatures of 52°C for p40, 62°C for
p35, and 60°C for -actin. To control for saturation effects of
the PCR reaction, preliminary experiments were assayed at different cycle numbers by removing part of the reaction at appropriate times.
Detection.
An aliquot of each PCR reaction was subjected to electrophoresis on a
2% agarose gel (Qualex Gold, AGS, Heidelberg, Germany) stained with
ethidium bromide, visualized, and photographed under ultraviolet (UV)
illumination. The expected size of amplified fragments was 225 bp for
-actin, 290 bp for p40, and 414 bp for p35.
Semiquantitative detection of the signals was performed using the
PCR-ELISA detection kit (Boehringer-Mannheim) according to the
supplier's instructions. Briefly, the diluted amplicon solution was
subjected to a hybridization with 21 bp biotinylated capture probes
that specifically bind at sites between the primer sequences (for
-actin: 5'BiotGTGGCCATC-TCTTGCTCGAA, for p35: 5'BiotCCGTGGCTGAGGTCTTGTCGG, for p40:
5'BiotGCT-GACGGCCCTCAGCAGGTT). The hybridization mixture was then
incubated in streptavidin-coated tubes. Using
antidigoxigenin-horseradish peroxidase (HRP) conjugate and the substrate (ABTS) as described in the protocol,
the optical density was measured at 422 nm. Positive controls (the kit
is provided with a control reaction consisting of human genomic DNA and
PCR primers for the tissue plasminogen activator [tPA] gene [to
control for the "dig-labeling" step] as well as with a
digoxigenin-labeled PCR product and a biotin-labeled capture probe that
is complementary to the control PCR fragment [to control for the
"detection"-step and as quantitative control]) and negative
controls (water and PCR without prior RT) were analyzed along with the probes.
Flow cytometric analysis of intracellular cytokines.
Intracellular staining and quantification of cytokines was performed
with modifications as previously described.17 During the
stimulation procedure, brefeldine (Sigma) was added at 3 µg/mL. Cells
were harvested and washed twice in PBS and then fixed with 4% ice-cold
phosphate-buffered paraformaldehyde for 15 minutes at 4°C and
washed in PBS. To facilitate diffusion of Ab through the cell
membranes, cells were permeabilized in PBS with 0.1% saponin (Riedel
de Haen, Seelze, Germany) for 15 minutes. Thereafter, pretitrated
cytokine-specific MoAb diluted in the permeabilization buffer
(PBS-saponin) were added and incubated for 45 min at 4°. The
PE-conjugated cytokine specific MoAb and IgG1 isotype control MoAb were
used at final concentrations of 2 µg/mL (monoclonal mouse anti-human
IL-12 [p40/p70]: this antibody reacts with human IL-12p40 monomer and
with the p70 heterodimer, but not with the p35 monomer; monoclonal rat
anti-human-IL-6; PharMingen). After subsequent washings in
permeabilization buffer, cells were resuspended and measured in PBS by
flow cytometric analysis. Expression of surface antigens on monocytes
was assessed using labeled CD14 (Coulter-Immunotech, Hamburg, Germany)
or CD54 (anti-intercellular adhesion molecule [ICAM]-1;
Coulter-Immunotech) antibodies. Samples were analyzed on a FACScan flow
cytometer (Becton Dickinson, Heidelberg, Germany).
Results were analyzed using Cellquest software (Becton Dickinson).
Cytokine determinations.
IL-12p70 ELISA was performed using an IL-12p70 detection kit (R&D
Systems), which recognizes only the IL-12p70 heterodimer. The same
samples were analyzed in another ELISA specific for p40 (R&D Systems)
to determine the amount of non-p70 bound-p40. IL-10 production was
measured by ELISA (Laboserv, Giessen, Germany).
| |
RESULTS |
Dose-dependent suppression of IL-12 production by preincubation with
LPS.
Stimulation of monocytes with 300 U/mL IFN- 2 hours before addition
of 10 to 50 ng/mL of LPS (designated as "stimulation" in this
report) resulted in a marked increase of IL-12 production measured on
mRNA level, as well as on protein level. "Stimulation" for 24 hours resulted in 23% (mean value) of monocytes stained positive for
intracellular IL-12 expression (v <0.5% unstimulated cells)
and a mean IL-12p70 contents of 35 pg/mL in the supernatants. Similar
results were obtained using GM-CSF instead of IFN-. In unstimulated
cells, IL-12p70 was undetectable with the ELISA used. LPS alone (ie,
without a priming dose of IFN- or GM-CSF) did not induce any
detectable IL-12 response on the protein level, as has been shown by
others.3
Preexposure of monocytes to LPS before the stimulation procedure
(designated as "preincubation" in this report) significantly decreased the production of bioactive IL-12. As shown in
Fig 1, preincubation with 50 ng/mL LPS
suppressed intracellular IL-12 production to nearly undetectable
levels. A clear dose dependency of this effect was evident (Figs 1 and
2), with a marked suppression of
intracellular IL-12 production using LPS doses down to 1 ng/mL. A total
of 0.1 ng/mL LPS still caused a reduction of more than 50%, while 0.01 ng/mL LPS did not alter IL-12 production as compared with the positive
control (ie, "stimulation" without "preincubation").
View larger version (11K):
[in this window]
[in a new window]
| Fig 1.
Effects of LPS preincubation on intracellular IL-12
(p40/p70) production by human monocytes. Human monocytes were
stimulated with 300 U/mL IFN- and 50 ng/mL LPS for 24 hours.
Preincubation was performed as indicated in Materials and Methods using
50 and 10 ng/mL LPS, respectively. The percentages of monocytes
positive for IL-12 (p40/p70) or IL-6, as detected by flow cytometric
measurement, are shown. Results are given as mean ± standard error of
mean (SEM) of 13 different donors. The downmodulation of IL-12 by
preincubation with LPS was significant (P < .0001 when 50 ng/mL LPS were used, P < .005 for 10 ng/mL LPS).
|
|
View larger version (36K):
[in this window]
[in a new window]
| Fig 2.
Dose-dependent effect of LPS on intracellular IL-12
(p40/p70) expression. Flow cytometric analysis of stimulated human
monocytes (IFN- 300 U/mL, LPS 50 ng/mL) pretreated for 24 hours with
varying concentrations of LPS. Intracellular cytokine staining for
IL-12 (p40/p70) and IL-6 is shown. The quadrant markers for the dot
plot were set based on the negative staining controls using
isotype-matched Ig antibodies. The percentages of cells in the
corresponding quadrants are given. On the horizontal axis, forward
scatter is depicted, and on the vertical axis, binding of PE-labeled
anti-IL-6 or anti-IL-12 (p40/p70) antibody is shown. The
corresponding results for IL-12 and IL-6 are given. (Top) Negative
control (autofluorescence of monocytes); (first two lines left panel)
stimulation with IFN-/LPS for 24 hours without LPS preincubation;
(middle) preincubation with 50 ng/mL LPS before stimulation; (right)
preincubation with 10 ng/mL LPS; (last two lines left panel) 1 ng/mL
LPS; middle: 0.1 ng/mL LPS; right: 0.01 ng/mL LPS.
|
|
Suppression was not due to downmodulation of the CD14 antigen as
determined by flow cytometric analysis of receptor expression after LPS
preincubation (81.6%; standard deviation [SD], 11.4%; n = 3, of
gated cells stained positive) as compared with LPS-free medium (86.0%;
SD, 4.42%; n = 3).
In this experimental setting, suppression was selective for IL-12, as
IL-6 downregulation was not seen under the described experimental
conditions. Figures 1 and 2 show the data obtained for IL-12 (p40/p70)
in comparison to IL-6. A general state of hyporesponsiveness to the
priming signal can be ruled out, as the upregulation of CD54 induced by
IFN- was even further increased in cells preincubated with LPS
(Fig 3).
View larger version (18K):
[in this window]
[in a new window]
| Fig 3.
Effect of LPS preincubation on ICAM-1 (CD54) expression
by stimulated monocytes. The binding of fluorescein isothiocyanate
(FITC)-labeled CD54 antibodies to monocytes is shown. An overlay
histogram is given to compare membrane expression of CD54 on
unstimulated cells (filled histogram), monocytes stimulated with
IFN- (300 U/mL) (A) or IFN-/LPS (B) (open histogram, thin line)
and IFN- (A) or IFN-/LPS (B) stimulated monocytes preincubated
with LPS for 24 hours (open histogram, thick line). One representative
experiment of 3 is depicted.
|
|
LPS preincubation did not exclusively interact with IFN--induced
signal cascade. With GM-CSF as a priming signal, similar results were
obtained: LPS preincubation-induced suppression of IL-12
(p40/p70) on monocytes primed with 100 ng/mL GM-CSF instead of
IFN- was over 95% in 2 experiments.
A dose-dependent reduction of IL-12p70 secretion was observed in
supernatants of monocytes, which had been preincubated with LPS in
varying concentrations before stimulation
(Fig 4).
View larger version (10K):
[in this window]
[in a new window]
| Fig 4.
Dose-dependent effect of LPS on the secretion of IL-12p70
and p40 by stimulated monocytes. Monocytes were pretreated with medium
alone or varying concentrations of LPS for 24 hours. After washing,
cells were challenged with IFN- (300 U/mL) and LPS (50 ng/mL) for 24 hours, culture supernatants were harvested, and assayed for IL-12p70
and p40 accumulation by ELISA. A stimulation index was calculated using
LPS/IFN--stimulated cells without pretreatment as positive control
(100%; mean of p70 positive control: 35.4 pg/mL, mean of p40 positive
control: 1,331 pg/mL). Mean values of 5 independent experiments ± SEM
are shown. The downmodulation of IL-12p40 and p70 was significant
(P < .05) for all LPS concentrations.
|
|
On the mRNA level, a dose-dependent suppression could be seen for
IL-12p40 and p35 accumulation when 10 ng/mL to 100 ng/mL LPS were used
(Fig 5 shows a representative experiment).
View larger version (54K):
[in this window]
[in a new window]
| Fig 5.
Dose-dependent suppression of p40 and p35 mRNA expression
by LPS pretreatment. Human monocytes were preincubated with varying
concentrations of LPS before stimulation with IFN-/LPS for 5 hours.
Amplified cDNA fragments for -actin, p40, and p35 were resolved on a
2% agarose gel and visualized by ethidium bromide. The amplified cDNA
fragments had the expected lengths of 290 bp for p40, 414 bp for p35,
and 225 bp for -actin.
|
|
The LPS-induced IL-12 downregulation was already detectable after a
"preincubation" period of only 2 hours and could still be
observed when supernanants were collected 48 hours after the stimulation procedure, indicating that recovery is not fast. In some
experiments, monocytes were preincubated for 24 hours with LPS, washed,
and incubated for another 6 to 48 hours before stimulation with
IFN-/LPS. In these experiments, the suppression was still the same,
showing that LPS-induced IL-12 hyporesponsiveness is long-lasting (data
not shown).
Both IL-12 subunits are suppressed by LPS preincubation.
Figures 4 and 6 show that p40 suppression
was in parallel to p70. p40 production after stimulation without
preincubation with LPS was 25-fold to 40-fold higher than p70
production (as has been described by others1,10,13).
View larger version (13K):
[in this window]
[in a new window]
| Fig 6.
Effects of blocking IL-10, IL-4, NO, or prostaglandins on
LPS-induced IL-12p70 and IL-12p40 downregulation. Monocytes were
incubated with LPS (50 ng/mL) or with LPS and neutralizing anti-IL-10
antibody (10 µg/mL), anti-IL-4 antibody (10 µg/mL), indomethacin
(1 × 10 6 mol/L) or NMLA (10 µmol/L) for 24 hours.
Supernatants were removed and cells in fresh medium were stimulated
with IFN- (300 U/mL) and LPS (50 ng/mL) for another 24 hours. The
mean values of p70 and p40 levels in the supernatants of at least 3 separate experiments are shown. Bars indicate SEM.
|
|
As shown in Figs 5 and 7, a clear reduction
of IL-12p40 and p35 mRNA accumulation was observed on stimulation with
IFN-/LPS for 5 hours after LPS preincubation. A marked suppression
of p40 and p35 mRNA was seen in LPS preincubated and
GM-CSF/LPS-stimulated monocytes as compared with monocytes stimulated
with GM-CSF/LPS alone (data not shown). Relative quantities of both
subunits were determined by PCR-ELISA. A significant reduction 5 hours
after stimulation is shown in Fig 8. A
significant inhibition was still observed for both subunits 24 hours
after stimulation (data not shown). Kinetic experiments showed a peak
in IL-12p40 mRNA accumulation between 5 and 8 hours after stimulation
with IFN-/LPS (Fig 8). LPS-pretreated monocytes reacted to
IFN-/LPS stimulation with a maximal IL-12p40 mRNA accumulation
between 5 and 8 hours as well, although on a lower absolute level (Fig
8). Using actinomycin D (5 µg/mL), which blocks transcription, we
could not detect any difference in RNA stability between LPS pretreated
and nonpretreated monocytes: in both experimental settings, a marked
decline of mRNA specific for IL-12p40 was observable 6 to 8 hours after
addition of actinomycin D.
View larger version (52K):
[in this window]
[in a new window]
| Fig 7.
Effects of LPS or PTXL pretreatment on the mRNA
expression for IL-12p40 and p35 in human monocytes. Human monocytes
were preincubated with LPS (50 ng/mL) or PTXL (10 µmol/L) for 24 hours before stimulation with IFN-/LPS. Five hours after the
stimulation procedure, mRNA was isolated and expression of p40, p35,
and -actin was determined by RT-PCR. The resulting cDNA fragments
were resolved on a 2% agarose gel and visualized by ethidium bromide.
The amplified cDNA fragments had the expected lengths of 290 bp for
p40, 414 bp for p35, and 225 bp for -actin. One representative of 5 independent experiments is shown.
|
|
View larger version (15K):
[in this window]
[in a new window]
| Fig 8.
Effect of LPS pretreatment on IL-12p40 mRNA expression.
RT-PCR analysis of IL-12p40 in monocytes stimulated with and without
prior exposure to LPS for 24 hours. Cells were harvested 5 hours after
the stimulation procedure. Relative quantities of RT-PCR signal for p40
as determined by PCR-ELISA followed by normalization to -actin are
shown. Results are given as box plots with vertical lines displaying
the 10th and 90th percentile. Horizontal lines show the median of the
results of 10 independent experiments. For statistical analysis, the
Mann-Whitney Rank Sum Test was performed. A representative kinetic
experiment shows IL-12p40 mRNA, which was harvested at different time
points between 2 hours to 48 hours after the stimulation procedure.
|
|
LPS-induced IL-12 suppression is not due to enhanced endogenous
production of IL-10, IL-4, PGE2, TNF-, or nitric oxide
(NO).
IL-10, IL-4, and PGE2 have been shown to downregulate IL-12
production under defined experimental conditions. We therefore tested
whether endogenous production of these mediators might be responsible
for the LPS-induced IL-12 downregulation using indomethacin or
neutralizing antibodies for IL-4 and IL-10, respectively. The
downregulatory effect of LPS remained stable in the presence of
neutralizing anti-IL-10, anti-IL-4 antibodies, and the prostaglandin synthesis inhibitor, indomethacin, respectively, during preincubation with a secretion of IL-12 diminished to nearly undetectable levels. Figure 6 summarizes the amounts of IL-12 in the supernatants as determined by an ELISA specific for p70 and p40, respectively. Figure 9 shows the results obtained for
intracellular cytokine staining.
View larger version (34K):
[in this window]
[in a new window]
| Fig 9.
Effect of neutralizing anti-IL-10 and anti-IL-4
antibody on intracellular IL-12 (p40/p70) staining of human monocytes
pretreated with LPS or medium. Immunofluorescence was performed with
human monocytes stimulated as described for 24 hours. The binding of
phycoerythrin (PE)-labeled mouse anti-human IL-12 (p40/p70) is shown
(vertical; horizontal: forward scatter). Quadrants were set according
to the isotype-matched controls. The percentages of cells in the
corresponding quadrants are given. (Left) Stimulation; (middle)
preincubation with 50 ng/mL LPS; (right) preincubation with 50 ng/mL
LPS and neutralizing IL-10 antibody or neutralizing IL-4 antibody,
respectively.
|
|
The LPS preincubation induced effect could be seen on monocytes
obtained via adherent step, as well as on highly purified monocytes
using Dynabeads.
Using an ELISA specific for IL-10, it could be shown that IL-10
production increased after LPS/IFN- stimulation. LPS preincubation did not, however, further induce IL-10 secretion (data not shown).
NO and TNF- have both been implicated in IL-12 suppression in the
murine system. The NO-synthase inhibitor NMLA (Fig 6), as well as a
neutralizing anti-human TNF- antibody, had no effect on the
reduction of IL-12 on preincubation with LPS. The mean IL-12 (p40/p70)
inhibition seen with LPS preincubation in the presence of 5 µg/mL
anti-human TNF- neutralizing antibody was 98.7% (±1.3% SD) as
compared with 99.4% (±0.9% SD) inhibition without the antibody,
as determined in 3 independent experiments by intracellular cytokine staining.
Suppression of IL-12 production is induced by PTXL preincubation on
intracellular level, but not on mRNA level.
The ability of PTXL, known to stimulate monocytes via a similar
intracellular transduction pathway as LPS, to downregulate IL-12
production was tested in some experiments in parallel to LPS. In
contrast to LPS, we detected no downregulation of p40 and p35 mRNA
neither 5 nor 24 hours after the stimulation procedure (Fig 7). On the
intracellular level, however, we detected a marked downregulation of
IL-12 (p40/p70) (Fig 10) using 5 to 20 µmol/L PTXL. IL-6 production remained stable (Fig 10) when monocytes
were preincubated with the same doses of PTXL before IFN-/LPS
stimulation. Cells were shown to survive the stimulation procedure in
separate experiments (data not shown).
View larger version (11K):
[in this window]
[in a new window]
| Fig 10.
Effects of PTXL preincubation on the intracellular IL-12
(p40/p70) production of human monocytes. Monocytes were preincubated
with medium, LPS (50 ng/mL), or PTXL (10 µmol/L) for 24 hours.
Subsequently, cells were stimulated with 300 U/mL IFN- and 50 ng/mL
LPS for another 24 hours. The percentage of monocytes positive for
IL-12 (p40/p70) or IL-6 as detected by flow cytometric measurement are
shown. Results are given as mean ± SEM of 5 independent experiments,
performed with cells from different donors.
|
|
| |
DISCUSSION |
In the present study, we provide evidence that the important
proinflammatory and immunoregulatory cytokine, IL-12, can be selectively downregulated by preincubation with LPS before stimulation with IFN- or with GM-CSF and LPS.
Endotoxic LPS, a major component of the outer membrane of gram-negative
bacteria, is known to activate the immune system by inducing the
release of inflammatory mediators. Monocytes/macrophages require a
priming "signal" before LPS stimulation for the optimal production of proinflammatory mediators. Previously, it was described that IFN- efficiently primes monocytes for IL-12 production in response to LPS,3,18 which could be confirmed in this study.
LPS can induce a state of hyporesponsiveness to its own effects, a
phenomenon mediated by monocytes/macrophages.19 An
LPS-induced "tolerance" has been described for TNF, IL-6, IL-8,
IL-10, NO, and other cytokines,20-27 characterized by a
diminished synthesis of these mediators by monocytes. This phenomenon
has been extensively studied in various animal species and cell types
in vitro and in vivo, but the cellular and molecular changes that
contribute to this kind of induced hyporesponsiveness are not fully
understood. It has been demonstrated that the sequence, amount, and
duration of stimuli given is crucial in this context. LPS-induced
tolerance appears to be a complex process and may vary considerably in
different experimental models. The ability of LPS to inhibit subsequent induction of IL-12p70 is a new finding. This may be of particular importance because of the crucial role of IL-12 in acute bacterial infections, in autoimmune disorders, and in the development of specific
immunity against a number of intracellular pathogens. Moreover, our
findings point to the necessity to deplete LPS from reagents in
studies, which address the regulation of IL-12.
In further experiments, we examined whether endogenous production of
known IL-12 antagonists play a causal role in LPS-mediated IL-12 suppression.
The most potent inhibitor of IL-12 synthesis by monocytes/macrophages
appears to be IL-10, which acts at the protein as well as at the mRNA
level.12,13 IL-10 itself can be affected by LPS-induced
hyporesponsiveness.28 Randow et al28 have
identified IL-10 and TGF- as an endogenous mediator for LPS-mediated
TNF downregulation. In contrast, we did not observe an enhancement of
IL-12 production by neutralization of endogenously produced IL-10 in
our experimental setting.
IL-4 is another antagonist of proinflammatory monokines, which has been
shown to downregulate IL-12,13,15 as well as the expression
of CD14 in normal human monocytes.29 Similar to IL-10, the
addition of neutralizing anti-IL-4 antibody to monocyte cell cultures
failed to overcome the LPS-mediated suppression of IL-12 release.
Moreover, LPS-induced IL-12 downregulation was also observed in highly
purified monocytes containing only small amounts of potentially IL-4
producing lymphocytes, which suggests that T-cell-derived IL-4 is not
causal for the observed effects.
Recently, it was reported that PGE2 is a potent
downregulator of IL-12p40 subunit production by LPS-stimulated
monocytes in whole blood cultures.14 Both IL-12 and
PGE2 are secreted by monocytes, macrophages, and other
antigen presenting cells (APC) in response to a variety
of compounds, including bacterial products.30 Indomethacin
did not revert the suppressive effect of LPS, which excludes a role of
endogenously produced PGE2 in our experiments. This is in
accordance with the studies by Bodgan et al,20 who could
not define a role of PGE2 in LPS-mediated suppression of IFN--induced reactive nitrogen intermediates (RNI) release.
It is well known that LPS can induce the expression of the TNF receptor
on murine macrophages, as well as the secretion of TNF
protein,31 suggesting that LPS effects are in part mediated by the autocrine action of TNF-.
IL-12p40 gene expression in murine macrophages has been shown to be
also regulated by NO.32 It has been discussed that
endogenous NO is involved in LPS-induced desensitization of mouse
macrophages.33 In the murine system, both
TNF-34 and NO35 have been shown to be
involved in IL-12 suppression in certain conditions. Using the
NO-synthase inhibitor, NMLA, and a neutralizing anti-human TNF-
antibody, respectively, we were able to show that in our experimental
setting, neither molecule is responsible for the LPS-mediated
suppression of IL-12 production.
LPS-induced cytokine downregulation may function in at least 2 different ways in monocytes. LPS preincubation may either induce a
general "hyporesponsiveness"/"desensitization" affecting a
broad range of proinflammatory responses or it may deviate the monocyte in a specific way. Bogdan et al20 pointed to the difference between LPS hyporesponsiveness in which monocytes/macrophages exposed
to a primary dose of LPS become refractory to a challenge dose of LPS,
and the suppressive activity that LPS exerts on certain mediators, such
as NO. The data presented in this report point to a restricted
modulation of monocyte functions.
In our experimental setting, LPS pretreatment did not result in a
complete desensitization of monocytes, as IL-6 was not affected by
LPS-mediated downregulation. This is in accordance with an in vivo
study of Mackensen et al,22 who found a marked
downregulation of TNF, IL-8, G-CSF, M-CSF, but not of IL-6 after
repeated injections of LPS. Mengozzi et al23 also
demonstrated IL-6 to be unaffected by LPS tolerance in human monocytes.
In different experimental settings, however, others found IL-6 to be
affected by downregulation in vitro27 and in
vivo.21
A general state of hyporesponsiveness to the priming signal can also be
ruled out, as the upregulation of CD54 on IFN- priming was increased
in monocytes preincubated with LPS.
Furthermore, we were able to show that LPS preincubation did not
interfere exclusively with IFN- signal transduction pathways, as the
same effect on IL-12 expression was observable when GM-CSF instead of
IFN- was used as a priming signal.
Enhanced expression of IL-12p40 leads to formation of the p40
homodimer, which has been shown in a murine cell system to antagonize IL-12 activities.36 Experiments with recombinant
(p40)2 indicate that an about 10-fold to 100-fold excess of
IL-12(p40)2 over IL-12 is required to achieve a 50% to
90% inhibition of the effects of IL-12 on Th1 cells.1 In
accordance with the findings of others,3,13 we found that
both subunits of IL-12 are inducible by stimulation with IFN-/LPS
and that both are downregulated on LPS preincubation. We found that p40
parallels the downregulation of p70 protein. On the mRNA level, a
reduction of both p35 and p40 accumulation was observed, which confirms
very recent data by Karp et al.37 With the methodical
approach performed, there is no indication for this mRNA reduction to
be regulated on the level of mRNA stability.
We used amplification by RT-PCR to facilitate detection of the mRNA
species, arguing that although RT-PCR is a nonquantitative method,
large differences in the intensity of the bands obtained with the same
primer set should nonetheless reflect significant differences in the
expression levels of the amplified mRNA. We have checked to be within
the linear range with the cycle numbers performed. Using the PCR-ELISA,
our main point was to depict differences between two samples within the
same experiment. With this semiquantitative method, absolute mRNA
amounts were not determined, as a competetive PCR was not performed.
LPS-induced IL-12 suppression was not due to downmodulation of the LPS
receptor, CD14. This is in accordance with published data.21,26,38 Other investigators were able to detect an
LPS-induced downmodulation of CD14 expression.23
Differences may be due to different stimulation schemes and incubation
times, as well as different sources of monocytes.
Furthermore Fahmi et al,39 who examined the LPS-binding
sites in LPS-tolerant mouse macrophages, found no correlation between desensitization of macrophages to endotoxin effects and downregulation of LPS-binding sites. They concluded that downregulation of LPS receptors is not a prerequisite for the induction of LPS tolerance, and
that different LPS substructures can downregulate differently the
various responses of the cells to LPS, thus suggesting that different
pathways are operative for induction of endotoxin tolerance.
LPS and the antitumor agent, PTXL, induce similar responses in murine
macrophages, although there are no obvious structural similarities
between the 2 agents. Like LPS, PTXL provides a "second" signal
for macrophage activation to tumoricidal activity.40 PTXL-induced macrophage stimulation requires an LPS-responsive genetic
background41 (most probably the wild-type Tlr-4 [LPS] receptor42) and PTXL-induced macrophage stimulation could
be blocked by well-characterized LPS antagonist.43 These
data imply an intimate association of LPS and PTXL signaling mechanisms
leading to macrophage activation.
PTXL interacts with the cytoskeleton by binding on -tubulin and
stabilizing microtubules. Probably other molecular targets and
signaling mechanisms of PTXL are involved in the reaction by which PTXL
mimics LPS effects in macrophages. In our study, we found a
PTXL-induced IL-12 downregulation on the protein, but not on the mRNA
level. This indicates that downregulation of IL-12 is a complex process.
The herein described suppression of IL-12 production by preincubation
with LPS seems to be specific for LPS and cannot be completely mimicked
by PTXL, despite similar signaling mechanisms. Because different
substructures of LPS can have different downregulatory effects on
macrophages (at least in murine models36), the
identification of the responsible "active side" in LPS-induced
IL-12 suppression should be addressed in further studies.
Sutterwala et al44 have recently demonstrated that ligation
of phagocytic receptors like the scavenger and Fc receptor may be an
important downmodulator of IL-12 mRNA synthesis and protein secretion.
In addition, we could recently show that the anaphylatoxin C5a leads to
a marked downregulation of IL-12 in IFN--primed
monocytes.45 In conclusion, the clearance of extracellular bacteria or opsonized particles, the contact of monocytes/macrophages to C5a, or a LPS-induced state of hyporesponsiveness may contribute to
the cessation of IL-12 production. This downmodulation can potentially
influence the development of immunity to both extracellular and
intracellular pathogens.
LPS can act as a bifunctional modulator on IL-12 production, exerting
either enhancing or suppressive effects, depending on its
concentration, sequence, and duration of its addition with respect to
costimulators. The complete elucidation of the cellular events induced
by LPS will aid in understanding inflammatory processes and may
potentially lead to novel therapeutic strategies in sepis, shock,
allergic, and autoimmune diseases.
| |
FOOTNOTES |
Submitted May 1, 1998; accepted May 5, 1999.
Supported by DFG Grants No. SFB 244, C13, and DFG We 1289/2-1.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Miriam Wittmann, MD, Hannover Medical
University, Department of Dermatology and Allergology, Ricklinger Str.
5, D-30449 Hannover, Germany.
| |
REFERENCES |
1.
Germann T, Rude E:
Interleukin-12.
Int Arch Allergy Immunol
108:103, 1995[Medline]
[Order article via Infotrieve]
2.
Gubler U, Chua AO, Schoenhaut DS, Dwyer CM, McComas W, Motyka R, Nabavi N, Wolitzky AG, Quinn PM, Familletti PC:
Coexpression of two distinct genes is required to generate secreted bioactive cytotoxic lymphocyte maturation factor.
Proc Natl Acad Sci USA
88:4143, 1991[Abstract/Free Full Text]
3.
Hayes MP, Wang J, Norcross MA:
Regulation of interleukin-12 expression in human monocytes: Selective priming by interferon-gamma of lipopolysaccharide-inducible p35 and p40 genes.
Blood
86:646, 1995[Abstract/Free Full Text]
4.
Ling P, Gately MK, Gubler U, Stern AS, Lin P, Hollfelder K, Su C, Pan YC, Hakimi J:
Human IL-12 p40 homodimer binds to the IL-12 receptor but does not mediate biologic activity.
J Immunol
154:116, 1995[Abstract]
5.
Gately MK, Desai BB, Wolitzky AG, Quinn PM, Dwyer CM, Podlaski FJ, Familletti PC, Sinigaglia F, Chizonnite R, Gubler U:
Regulation of human lymphocyte proliferation by a heterodimeric cytokine, IL-12 (cytotoxic lymphocyte maturation factor).
J Immunol
147:874, 1991[Abstract]
6.
Hsieh CS, Macatonia SE, Tripp CS, Wolf SF, O'Garra A, Murphy KM:
Development of TH1 CD4+ T-cells through IL-12 produced by Listeria-induced macrophages.
Science
260:547, 1993[Abstract/Free Full Text]
7.
Wolf SF, Temple PA, Kobayashi M, Young D, Dicig M, Lowe L, Dzialo R, Fitz L, Ferenz C, Hewick RM:
Cloning of cDNA for natural killer cell stimulatory factor, a heterodimeric cytokine with multiple biologic effects on T and natural killer cells.
J Immunol
146:3074, 1991[Abstract]
8.
Manetti R, Parronchi P, Giudizi MG, Piccinni MP, Maggi E, Trinchieri G, Romagnani S:
Natural killer cell stimulatory factor (interleukin 12) induces T helper type 1 (Th1)-specific immune responses and inhibits the development of IL-4-producing Th cells.
J Exp Med
177:1199, 1993[Abstract/Free Full Text]
9.
Trinchieri G:
Interleukin-12 and its role in the generation of TH1 cells.
Immunol Today
14:335, 1993[Medline]
[Order article via Infotrieve]
10.
D'Andrea A, Rengaraju M, Valiante NM, Chehimi J, Kubin M, Aste M, Chan SH, Kobayashi M, Young D, Nickbarg E:
Production of natural killer cell stimulatory factor (interleukin 12) by peripheral blood mononuclear cells.
J Exp Med
176:1387, 1992[Abstract/Free Full Text]
11.
Skeen MJ, Miller MA, Shinnick TM, Ziegler HK:
Regulation of murine macrophage IL-12 production. Activation of macrophages in vivo, restimulation in vitro, and modulation by other cytokines.
J Immunol
156:1196, 1996[Abstract]
12.
D'Andrea A, Aste-Amezaga M, Valiante NM, Ma X, Kubin M, Trinchieri G:
Interleukin 10 (IL-10) inhibits human lymphocyte interferon gamma-production by suppressing natural killer cell stimulatory factor/IL-12 synthesis in accessory cells.
J Exp Med
178:1041, 1993[Abstract/Free Full Text]
13.
Snijders A, Hilkens CM, Van der Pouw Kraan TC, Engel M, Aarden LA, Kapsenberg ML:
Regulation of bioactive IL-12 production in lipopolysaccharide-stimulated human monocytes is determined by the expression of the p35 subunit.
J Immunol
156:1207, 1996[Abstract]
14.
Van der Pouw Kraan TC, Boeije LC, Snijders A, Smeenk RJ, Wijdenes J, Aarden LA:
Regulation of IL-12 production by human monocytes and the influence of prostaglandin E2.
Ann N Y Acad Sci
795:147, 1996[Medline]
[Order article via Infotrieve]
15.
D'Andrea A, Ma X, Aste-Amezaga M, Paganin C, Trinchieri G:
Stimulatory and inhibitory effects of interleukin (IL)-4 and IL-13 on the production of cytokines by human peripheral blood mononuclear cells: Priming for IL-12 and tumor necrosis factor alpha production.
J Exp Med
181:537, 1995[Abstract/Free Full Text]
16.
Zerbini M, Gibellini D, Musiani M, Venturoli S, Gallinella G, Gentilomi G:
Automated detection of digoxigenin-labelled B19 parvovirus amplicons by a capture hybridization assay.
J Virol Methods
55:1, 1995[Medline]
[Order article via Infotrieve]
17.
Jung T, Schauer U, Heusser C, Neumann C, Rieger C:
Detection of intracellular cytokines by flow cytometry.
J Immunol Methods
159:197, 1993[Medline]
[Order article via Infotrieve]
18.
Ma X, Chow JM, Gri G, Carra G, Gerosa F, Wolf SF, Dzialo R, Trinchieri G:
The interleukin 12 p40 gene promoter is primed by interferon gamma in monocytic cells.
J Exp Med
183:147, 1996[Abstract/Free Full Text]
19.
Freudenberg MA, Galanos C:
Induction of tolerance to lipopolysaccharide (LPS)-D-galactosamine lethality by pretreatment with LPS is mediated by macrophages.
Infect Immun
56:1352, 1988[Abstract/Free Full Text]
20.
Bogdan C, Vodovotz Y, Paik J, Xie QW, Nathan C:
Traces of bacterial lipopolysaccharide suppress IFN-gamma-induced nitric oxide synthase gene expression in primary mouse macrophages.
J Immunol
151:301, 1993[Abstract]
21.
Granowitz EV, Porat R, Mier JW, Orencole SF, Kaplanski G, Lynch EA, Ye K, Vannier E, Wolff SM, Dinarello CA:
Intravenous endotoxin suppresses the cytokine response of peripheral blood mononuclear cells of healthy humans.
J Immunol
151:1637, 1993[Abstract]
22.
Mackensen A, Galanos C, Wehr U, Engelhardt R:
Endotoxin tolerance: Regulation of cytokine production and cellular changes in response to endotoxin application in cancer patients.
Eur Cytokine Netw
3:571, 1992[Medline]
[Order article via Infotrieve]
23.
Mengozzi M, Fantuzzi G, Sironi M, Bianchi M, Fratelli M, Peri G, Bernasconi S, Ghezzi P:
Early down-regulation of TNF production by LPS tolerance in human monocytes: Comparison with IL-1 beta, IL-6, and IL-8.
Lymphokine Cytokine Res
12:231, 1993[Medline]
[Order article via Infotrieve]
24.
Takasuka N, Tokunaga T, Akagawa KS:
Preexposure of macrophages to low doses of lipopolysaccharide inhibits the expression of tumor necrosis factor-alpha mRNA but not of IL-1 beta mRNA.
J Immunol
146:3824, 1991[Abstract]
25.
Zhang X, Morrison DC:
Lipopolysaccharide-induced selective priming effects on tumor necrosis factor alpha and nitric oxide production in mouse peritoneal macrophages.
J Exp Med
177:511, 1993[Abstract/Free Full Text]
26.
Ziegler-Heitbrock HW, Frankenberger M, Wedel A:
Tolerance to lipopolysaccharide in human blood monocytes.
Immunobiology
193:217, 1995[Medline]
[Order article via Infotrieve]
27.
Ziegler-Heitbrock HW, Blumenstein M, Kafferlein E, Kieper D, Petersmann I, Endres S, Flegel WA, Northoff H, Riethmuller G, Haas JG:
In vitro desensitization to lipopolysaccharide suppresses tumour necrosis factor, interleukin-1 and interleukin-6 gene expression in a similar fashion.
Immunology
75:264, 1992[Medline]
[Order article via Infotrieve]
28.
Randow F, Syrbe U, Meisel C, Krausch D, Zuckermann H, Platzer C, Volk HD:
Mechanism of endotoxin desensitization: Involvement of interleukin 10 and transforming growth factor beta.
J Exp Med
181:1887, 1995[Abstract/Free Full Text]
29.
Lauener RP, Goyert SM, Geha RS, Vercelli D:
Interleukin 4 down-regulates the expression of CD14 in normal human monocytes.
Eur J Immunol
20:2375, 1990[Medline]
[Order article via Infotrieve]
30.
Hilkens CM, Snijders A, Vermeulen H, van der Meide PH, Wierenga EA, Kapsenberg ML:
Accessory cell-derived IL-12 and prostaglandin E2 determine the IFN-gamma level of activated human CD4+ T-cells.
J Immunol
156:1722, 1996[Abstract]
31.
Tannenbaum CS, Major JA, Hamilton TA:
IFN-gamma and lipopolysaccaride differentially modulate expression of tumor necrosis factor receptor mRNA in murine peritoneal macrophages.
J Immunol
151:6833, 1993[Abstract]
32.
Rothe H, Hartmann B, Geerlings P, Kolb H:
Interleukin-12 gene-expression of macrophages is regulated by nitric oxide.
Biochem Biophys Res Commun
224:159, 1996[Medline]
[Order article via Infotrieve]
33.
Fahmi H, Charon D, Mondange M, Chaby R:
Endotoxin-induced desensitziation of mouse macrophages is mediated in part by nitric oxide production.
Infect Immun
63:1863, 1995[Abstract]
34.
Hodge-Dufour J, Marino MW, Horton MR, Jungbluth A, Burdick MD, Strieter RM, Noble PW, Hunter CA, Pure E:
Inhibition of interferon gamma induced interleukin 12 production: A potential mechanism of the anti-inflammatory activities of tumor necrosis factor.
Proc Natl Acad Sci USA
95:13806, 1998[Abstract/Free Full Text]
35.
Huang FP, Niedbala W, Wei XQ, Xu D, Feng GJ, Robinson JH, Lam C, Liew FY:
Nitric oxide regulates Th1 cell development through the inhibition of IL-12 synthesis by macrophages.
Eur J Immunol
28:4062, 1998[Medline]
[Order article via Infotrieve]
36.
Mattner F, Fischer S, Guckes S, Jin S, Kaulen H, Schmitt E, Rude E, Germann T:
The interleukin-12 subunit p40 specifically inhibits effects of the interleukin-12 heterodimer.
Eur J Immunol
23:2202, 1993[Medline]
[Order article via Infotrieve]
37.
Karp CL, Wysocka M, Ma X, Marovich M, Factor RE, Nutman T, Armant M, Wahl L, Cuomo P, Trinchieri G:
Potent suppression of IL-12 production from monocytes and dendritic cells during endotoxin tolerance.
Eur J Immunol
28:3128, 1998[Medline]
[Order article via Infotrieve]
38.
Breuninger L, Goonewardene IM, Dempsey WL, Murasko DM:
Monocyte culture and adherence modifies LPS-induced IL-6 production and inhibition by hydrocortisone.
Clin Immunol Immunopathol
72:264, 1994[Medline]
[Order article via Infotrieve]
39.
Fahmi H, Chaby R:
Desensitization of macrophages to endotoxin effects is not correlated with a down-regulation of lipopolysaccharide-binding sites.
Cell Immunol
150:216, 1993
40.
Manthey CL, Perera PY, Salkowski CA, Vogel SN:
Taxol provides a second signal for murine macrophage tumoricidal activity.
J Immunol
152:825, 1994[Abstract]
41.
Ding AH, Porteu F, Sanchez E, Nathan CF:
Shared actions of endotoxin and taxol on TNF receptors and TNF release.
Science
248:370, 1990[Abstract/Free Full Text]
42.
Poltorak A, He X, Smirnova I, Liu MY, Huffel CV, Du X, Birdwell D, Alejos E, Silva M, Galanos C, Freudenberg M, Ricciardi-Castagnoli P, Layton B, Beutler B:
Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: Mutations in Tlr4 gene.
Science
282:2085, 1998[Abstract/Free Full Text]
43.
Manthey CL, Qureshi N, Stutz PL, Vogel SN:
Lipopolysaccharide antagonists block taxol-induced signaling in murine macrophages.
J Exp Med
178:695, 1993[Abstract/Free Full Text]
44.
Sutterwala FS, Noel GJ, Clynes R, Mosser DM:
Selective suppression of interleukin-12 induction after macrophage receptor ligation.
J Exp Med
185:1977, 1997[Abstract/Free Full Text]
45.
Wittmann M, Zwirner J, Larsson V-A, Kirchhoff K, Begemann G, Kapp A, Götze O, Werfel T:
C5a suppresses the production of IL-12 by IFN--primed and lipopolysaccharide-challenged human monocytes.
J Immunol
162:6763, 1999[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
V. Marin-Esteban, M. Abdul, D. Charron, A. Haziot, and N. Mooney
Dendritic Cells Differentiated in the Presence of a Single-Stranded Viral RNA Sequence Conserve Their Ability To Activate CD4 T Lymphocytes but Lose Their Capacity for Th1 Polarization
Clin. Vaccine Immunol.,
June 1, 2008;
15(6):
954 - 962.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D.-M. Kuang, Y. Wu, N. Chen, J. Cheng, S.-M. Zhuang, and L. Zheng
Tumor-derived hyaluronan induces formation of immunosuppressive macrophages through transient early activation of monocytes
Blood,
July 15, 2007;
110(2):
587 - 595.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Zakharova and H. K. Ziegler
Paradoxical Anti-Inflammatory Actions of TNF-{alpha}: Inhibition of IL-12 and IL-23 via TNF Receptor 1 in Macrophages and Dendritic Cells
J. Immunol.,
October 15, 2005;
175(8):
5024 - 5033.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. P. Ryan, S. J. Pollack, T. I. Murant, S. H. Bernstein, R. E. Felgar, and R. P. Phipps
Activated Human B Lymphocytes Express Cyclooxygenase-2 and Cyclooxygenase Inhibitors Attenuate Antibody Production
J. Immunol.,
March 1, 2005;
174(5):
2619 - 2626.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Luppi
In response to Faas et al.
J. Leukoc. Biol.,
February 1, 2004;
75(2):
155 - 156.
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Sato, O. Takeuchi, T. Fujita, H. Tomizawa, K. Takeda, and S. Akira
A variety of microbial components induce tolerance to lipopolysaccharide by differentially affecting MyD88-dependent and -independent pathways
Int. Immunol.,
July 1, 2002;
14(7):
783 - 791.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Wittmann, P. Kienlin, S. Mommert, A. Kapp, and T. Werfel
Suppression of IL-12 Production by Soluble CD40 Ligand: Evidence for Involvement of the p44/42 Mitogen-Activated Protein Kinase Pathway
J. Immunol.,
April 15, 2002;
168(8):
3793 - 3800.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Harizi, M. Juzan, V. Pitard, J.-F. Moreau, and N. Gualde
Cyclooxygenase-2-Issued Prostaglandin E2 Enhances the Production of Endogenous IL-10, Which Down-Regulates Dendritic Cell Functions
J. Immunol.,
March 1, 2002;
168(5):
2255 - 2263.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Kobayashi, E. Azuma, M. Ido, M. Hirayama, Q. Jiang, S. Iwamoto, T. Kumamoto, H. Yamamoto, M. Sakurai, and Y. Komada
A Pivotal Role of Rho GTPase in the Regulation of Morphology and Function of Dendritic Cells
J. Immunol.,
October 1, 2001;
167(7):
3585 - 3591.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Wysocka, S. Robertson, H. Riemann, J. Caamano, C. Hunter, A. Mackiewicz, L. J. Montaner, G. Trinchieri, and C. L. Karp
IL-12 Suppression During Experimental Endotoxin Tolerance: Dendritic Cell Loss and Macrophage Hyporesponsiveness
J. Immunol.,
June 15, 2001;
166(12):
7504 - 7513.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Alexander and E. Th. Rietschel
Invited review: Bacterial lipopolysaccharides and innate immunity
Innate Immunity,
June 1, 2001;
7(3):
167 - 202.
[Abstract]
[PDF]
|
|
|
|
|
|
|
G. Eissner, S. Kirchner, H. Lindner, W. Kolch, P. Janosch, M. Grell, P. Scheurich, R. Andreesen, and E. Holler
Reverse Signaling Through Transmembrane TNF Confers Resistance to Lipopolysaccharide in Human Monocytes and Macrophages
J. Immunol.,
June 15, 2000;
164(12):
6193 - 6198.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION