|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 5 (September 1), 1999:
pp. 1790-1796
Functional Association of Fc RI With Arginine632 of
Paired Immunoglobulin-Like Receptor (PIR)-A3 in Murine Macrophages
By
Lynn S. Taylor and
Daniel W. McVicar
From Laboratory of Experimental Immunology, Division of Basic
Sciences, National Cancer Institute, NCI-FCRDC, Frederick, MD.
 |
ABSTRACT |
Paired immunoglobulin-like receptors (PIR) are expressed on B cells
and macrophages and include inhibitory and putative activating receptors referred to as PIR-B and PIR-A, respectively. Although PIR-B's inhibitory pathway has been described, it is unknown whether PIR-A receptors can deliver activation signals to macrophages, and if
so, through what mechanism. Here we use chimeric receptors to address
the mechanisms of PIR-A signaling. Cotransfection of chimeric receptors
comprised of the extracellular region of human CD4 and the
transmembrane and cytoplasmic domains of murine PIR-A3 showed the
ability of PIR-A3 to physically interact with the
Fc RI chain in 293T cells. This interaction is dependent on
Arg632 within the PIR-A3 transmembrane domain. We also
demonstrate PIR-A3 interaction with the endogenous FcRI of the
ANA-1 macrophage cell line, again in an Arg632-dependent
manner. Furthermore, we show that crosslinking of these chimeric
receptors synergizes with IFN- in the production of nitric oxide.
Our data are the first to show the potential of PIR-A3 to deliver
activation signals to macrophages and establish its dependence on
Arg632. These findings suggest that further study of the
PIR-A receptors should be aggressively pursued toward a complete
understanding of the intricate regulation of macrophage biology.
This is a US government work. There are no restrictions on its use.
| |
INTRODUCTION |
THE MODULATION of immune cell activation
involves the coordinate regulation of inhibitory and stimulatory
signaling pathways triggered by various cell surface receptors. The
intracellular immunoreceptor tyrosine-based inhibitory motif (ITIM),
defined as I/VxYxxL/I, is present in the cytoplasmic tails of many
inhibitory receptors.1 ITIM-containing receptors described
thus far include several members of the Ig superfamily
(killer inhibitory receptor [KIR], paired Ig-like
receptor [PIR], and immunoglobulin-like transcript [ILT]
families2-9), as well as the c-type lectin superfamily (Ly49 and NKG2 families10,11).
Each of these families of inhibitory receptors
(leukocyte inhibitory receptor [LIR], PIR, KIR, and
Ly49) contain members that lack ITIMs in their cytoplasmic
domains.2,5,7,10-12 Instead, these receptors contain a
charged amino acid within their transmembrane domains in a fashion
similar to the T-cell receptor (TCR) and some Fc receptors (FcR),
suggesting that they may also transmit activation
signals.13 The TCR and these FcR both lack intrinsic catalytic activity and therefore, transmit their activation signals via
receptor-associated chains such as the CD3 invariant complex (including
TCR ) and Fc RI, respectively.14,15 Association of
these signaling chains with the receptor complex is dependent on the
presence of oppositely charged amino acid residues within the
transmembrane region of the receptor and the signal transducing chain.16,17 Upon receptor ligation, the tyrosine residues
within the immunoreceptor tyrosine-based activation motif (ITAM)s of the signaling chains are phosphorylated and initiate intracellular signaling events.17,18
The expression of the recently described PIR family is restricted to B
and myeloid cells.7,8 This receptor family was discovered
while searching for the murine homolog of the human Fc receptor
(FcR) gene. Within the PIR family, two main isoforms have been
described. The PIR-B receptor is an inhibitory receptor containing four
cytoplasmic ITIMs. In contrast, the PIR-A receptors (PIR-A1-7) are
putative activation receptors that lack both ITIMs and ITAMs and have a
positively charged amino acid in their transmembrane domains.7
The PIR-A receptors of macrophages have a high degree of homology with
FcRs, which have been well characterized as activating receptors. For
example, stimulation of human monocytes through the FcR activates a
variety of biological responses, including tumor
necrosis factor- (TNF-), interleukin-6 (IL-6), IL-8, and IL-1.19,20 Similarly, stimulation of murine macrophages
through FcR results in the production of nitric oxide
(NO).21,22 These findings suggest that PIR-A may also be
capable, through the interaction with a signal transduction chain, of
activating macrophages to produce inflammatory cytokines and/or
reactive nitrogen intermediates. However, the lack of reagents able to
discriminate between the highly homologous PIR-A and PIR-B has hampered
the effort to determine whether the PIR-A receptors might also regulate
macrophage function. Here, we use a chimeric receptor approach to show
that PIR-A3 physically interacts with FcRI in murine macrophages
via Arg632. Moreover, we show that PIR-A3 is capable of
inducing the production of NO, a major mediator of macrophage
tumoricidal and microbicidal activity, in a manner dependent on
Arg632 and therefore, FcRI. These findings show for
the first time the potential impact of the PIR-A receptors on the
regulation of immunity through their control of macrophage function.
| |
MATERIALS AND METHODS |
Cells.
The 293T human kidney embryonic cell line was maintained in Dulbecco's
modified Eagle's medium (DMEM) containing 10% fetal bovine serum, 2 mmol/L L-glutamine, 100 U/mL penicillin, and 100 µg/mL streptomycin. The mouse macrophage cell line ANA-1 was
established by infecting fresh bone marrow-derived cells from C57BL/6
mice with the J2 (v-raf/v-myc) recombinant retrovirus and has been extensively characterized.23,24 ANA-1 macrophages were
cultured in DMEM containing 5% fetal bovine serum, glutamine, and
antibiotics as above. Stably transfected ANA-1 cell lines were
maintained as above with the addition of 200 µg/mL G418.
Antibodies.
The mouse monoclonal antibody recognizing human CD4 was purchased from
Becton Dickinson Immunocytology Systems (San Jose, CA). Biotinylated
4G10 antibody, recognizing phosphotyrosine, and streptavidin conjugated
with horseradish peroxidase were purchased from Upstate
Biotechnologies, Inc (Lake Placid, NY). The polyclonal antibody
recognizing murine FcRI was a gift from Dr J.P. Kinet (Harvard
University, Boston, MA). Goat F(ab')2 against mouse
IgG used in receptor crosslinking studies was purchased from Cappel (Durham, NC).
Plasmids.
The human CD4 cDNA was a gift from Dr Richard Axel via the AIDS
(acquired immunodeficiency syndrome) Research and Reference Reagent
Program, Division of AIDS, National Institute of Allergy and Infectious
Diseases (NIAID), National Institutes of Health (NIH).25 The murine PIR-A3 cDNA was identified by searching an Expressed Sequence Tag (EST) database using the
National Cancer Institute (NCI) Blast
program (Wisconsin Package Version 10.0, GCG, Madison,
WI). The query sequence was the murine PIR-A1 sequence reported by
Kubagawa et al.7 The EST (GenBank Accession Number AA184287) was purchased from ATCC (Rockville, MD). The CD4/PIR-A3 chimeric construct was prepared by polymerase chain
reaction (PCR) amplification of cDNA with the addition of a
VspI linker. The PCR primers used to amplify the extracellular
domain of human CD4 cDNA were 5' ATGCGGTACCATTTCTGTGGGCTCAG
3' (forward primer, adding a 5' Kpn I linker) and
the reverse primer 5' CTAGAATTAATGCCATTGGCTGCACCGG 3'
(adding a 3' VspI linker). The PCR primers used to
amplify the cDNA representing the transmembrane and intracellular
regions of murine PIR-A were 5' GATCATTAATCAGGATGGGGATGGCA
3' (adding a 5' VspI linker) and 5'
CGTAGAATTCAGAGTGTAGAACATTGA 3' (reverse primer, adding a 3'
EcoRI linker). The cDNAs were subcloned into the Kpn
I/EcoRI site of the pcDNA3 expression vector
(Promega, Madison, WI) and sequenced using the T7 Sequenase version 2.0 DNA sequencing kit (United States Biochemical, Cleveland, OH). The
resulting receptor carries the extracellular domain of human CD4 and
the transmembrane and cytoplasmic domain of PIR-A3 with the exception
of a conservative substitution of valine for isoleucine within the
transmembrane domain. The mutant chimeric receptor construct was
generated using the Transformer Site-Directed Mutagenesis Kit
(Clontech, Palo Alto, CA), in which the arginine corresponding to
Arg632 in the PIR-A3 receptor sequence was mutated to Leu
(CD4/PIR-A3R632L). The murine FcRI expression
construct was a gift from Dr J.P. Kinet (Harvard
University).26,27
Transfections.
One day before transfection, 293T cells were seeded in six-well plates
at a density of 3 × 105/well and cultured overnight.
Cells were then transfected with the indicated amounts and combinations
of constructs using the FuGENE 6 Transfection reagent as directed by
the manufacturer (Boehringer Mannheim, Indianapolis, IN). The total
amount of cDNA per transfection was 1 µg and was normalized by the
addition of pcDNA3 plasmid. ANA-1 macrophages (10 × 106) were transfected with 10 µg of the indicated
constructs using a Gene Pulser electroporator (BioRad,
Hercules, CA). After electroporation, the cells were allowed to recover
for 3 days in complete media. Cells were then selected in 1 mg/mL G418
for approximately 2 weeks, followed by subcloning. Expression of the
chimeric receptors was monitored by flow cytometry.
Biotinylation, stimulation, immunoprecipitation, electrophoresis,
and blotting.
Where specified, transfected 293T cells were biotinylated using the
Cellular Labeling and Immunoprecipitation Kit from Boehringer Mannheim,
as directed. Cells were stimulated with 1 mmol/L pervanadate for 15 minutes at 37°C as described.28 After stimulation, the cells were pelleted, the supernatant was removed, and the cells were
lysed in 1 mL lysis buffer (1% Triton X-100 [TTX-100] or 1%
Brij-96, and 50 mmol/L Tris, pH 7.4, 300 mmol/L NaCl, 2 mmol/L EDTA,
0.4 mmol/L Na3VO4, 2.5 mmol/L leupeptin, 2.5 mmol/L aprotinin, and 1 mmol/L phenylmethyl sulfonyl fluoride
[PMSF]).28 Lysates were clarified by
centrifugation and were immunoprecipitated with the specified antibody
bound to Protein G or Protein A agarose beads for 2 to 3 hours at
4°C. Immune complexes were washed in lysis buffer containing 0.1%
TTX-100 or 0.1% Brij-96. Proteins were eluted in either 2X nonreducing
or reducing Laemmli sample buffer as indicated and
separated using sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE). Proteins were transferred
to Immobilon-P membrane (Millipore, Bedford, MA) and were blocked in
phosphate-buffered saline (PBS) containing 5% bovine serum albumin
(BSA) and 0.1% Tween-20 (Sigma, St Louis, MO).
Biotinylated 4G10 antibody followed by streptavidin-conjugated
horseradish peroxidase (SA-HRP) was used in the detection of
phosphoproteins. Western blot analysis using FcRI antisera
followed by a horseradish peroxidase-linked goat antirabbit Ig
(Boehringer Mannheim) was performed using Tris-buffered saline
containing 5% nonfat milk and 0.1% Tween-20. Blots were developed
using an enhanced chemiluminescence kit (ECL; Amersham, Arlington
Heights, IL) and were exposed to XAR-5 film (Kodak, Rochester, NY).
Cell stimulation with CD4 antibody.
In experiments using anti-CD4 as a stimulus, 1 µg/mL goat antimouse
IgG in Hanks' Balanced Salt Solution (HBSS) was used to coat the wells
of a 24-well plate at 4°C overnight. The wells were
washed two times with HBSS before the addition of reagents and cells.
The following day, cells were washed in 0.1% fetal bovine
serum (FBS) in Dulbecco's phosphate buffered saline (DPBS), resuspended at 1 × 106/mL,
and incubated on ice for 1 hour with 40 µL anti-CD4 per 1 × 106 cells. After the incubation period, the cells were
washed with cold DPBS and cultured in complete media at 1 × 106/mL overnight with any additional reagents
as described below.
NO2 assay.
The accumulation of nitrite (NO2) in
macrophage culture supernatants was used as a relative measurement of
NO production.29 Transfected ANA-1 macrophages were
cultured at a concentration of 1 × 106 cells/well in
a 24-well microtiter plate containing a total volume of 1 mL. After the
indicated stimulations, 50 µL of cell-free culture supernatant was
incubated with 50 µL Griess reagent (1% sulfanilimide/0.1%
naphthylenediamine dihydrochloride/2.5% H3PO4) at room temperature for 5 minutes, and the absorbance at 550 nm was
determined in a MR500 microplate reader (Dynex
Technologies, Inc, Chantilly, VA). The concentration of
NO2 was determined from a least squares
linear regression analysis of a sodium nitrite standard curve generated
with each experiment.
| |
RESULTS AND DISCUSSION |
CD4/PIR-A3 associates with FcRI in 293T
cells.
The presence of a charged transmembrane arginine residue and the lack
of an ITAM in the cytoplasmic domain in the PIR-A receptors suggest the
ability to associate with a signal transducing chain.7 The
signal transduction chains associated with multichain immune recognition receptors such as the TCR, B-cell receptor
(BCR), FcR (reviewed in Keegan et al18),
and, most recently, the noninhibitory KIR30 and
Ly4931,32 proteins, have been described. However, the lack
of specific reagents for the putative activating PIR-A versus the
inhibitory PIR-B has precluded the study of possible signaling chains
that might interact with these new receptors. In fact, there are no
data to show the ability of PIR-A receptors to lead to a functional
outcome in any cell, suggesting that they may be incapable of
delivering enough of an intracellular signal to result in gene
transcription, cytokine production, or cytotoxicity. Therefore, to
directly examine the ability of the PIR-A receptors to form a
signal-transducing complex in macrophages, we constructed a chimeric
receptor (CD4/PIR-A3) that contains the extracellular domain of human
CD4 linked to the transmembrane and cytoplasmic domains of PIR-A3
(Fig 1). The construct (0.5 µg) was
transiently transfected into 293T cells, and the expression level of
the CD4/PIR-A3 was assessed by flow cytometry using phycoerythrin
(PE)-conjugated anti-human CD4 monoclonal antibody
(MoAb) (Fig 2A).
Transfection with these concentrations of plasmid routinely results in
more than 70% of the cells expressing the chimera. To confirm the
recognition of CD4/PIR-A3 by the human CD4 MoAb for biochemical
studies, 293T cells transiently transfected with the receptor were
surface labeled with biotin, lysed, and immunoprecipitated with
anti-CD4. The immune complexes were separated by SDS-PAGE and detected
with SA-HRP. Figure 2B shows the immunoprecipitation of a labeled
protein at approximately 48 kD consistent with the predicted mass of
the CD4/PIR-A3 chimeric receptor. Moreover, these data show that
treatment of the cells with pervanadate before lysis and
immunoprecipitation does not affect the ability of anti-CD4 to
immunoprecipitate chimeric receptors.
View larger version (23K):
[in this window]
[in a new window]
| Fig 1.
Schematic diagram of CD4/PIR-A3 chimeric receptors. The
four Ig-like extracellular domains of human CD4 were linked to the
transmembrane and cytoplasmic domains of murine PIR-A3. The
transmembrane region of PIR-A3 contains a positively charged arginine
at position 632. The gray and black areas represent human CD4 and
murine PIR-A3, respectively.
|
|
View larger version (33K):
[in this window]
[in a new window]
| Fig 2.
CD4/PIR-A3 is expressed on 293T cells and is recognized
by anti-human CD4. (A) Expression of CD4/PIR-A3 in 293T cells. 293T
cells were transfected with 0.5 µg of either pcDNA3 (thin trace) or
CD4/PIR-A3 (thick trace) cDNA. Twenty-four hours after transfection,
the cells were labeled with PE-conjugated anti-human CD4 for flow
cytometric analysis. (B) Anti-CD4 immunoprecipitates CD4/PIR-A3.
Twenty-four hours after transfection, 293T cells were surface labeled
with biotin followed by pervandate stimulation, as indicated. The cells
were lysed in a buffer containing 1% TTX-100, and lysates were
immunoprecipitated with anti-CD4. Immune complexes were eluted in
reducing Laemmli sample buffer, separated by 8% to 16% SDS-PAGE, and
detected with SA-HRP and ECL.
|
|
The PIR family was originally identified by screening mouse genomic and
splenic cDNA libraries with the chain of FcR.7,8 As
expected, the resulting receptors show high homology to several Ig-superfamily receptors, including human FcR, bovine Fc, and the
human KIRs. The transmembrane domain of PIR-A receptors is most
homologous to those of the human FcR, suggesting that the signaling
mechanisms of these two receptors may be similar.7,32 Recently, FcR has been shown to use FcRI.33,34
Transfected FcR is poorly expressed without cotransfection with
FcRI,33 and ligation of FcR results in
phosphorylation of FcRI.34 Mutations of an arginine
residue within the FcR transmembrane domain prevented its
association with FcRI and ablated its signaling capability.33 Like FcR, PIR-A3 contains an arginine in
its transmembrane domain, and this residue is in the same relative position within the membrane-spanning segment of both
receptors.7 In fact, they exist within the conserved
sequence, LIRM. This suggested that PIR-A
might use this arginine (Arg632) to couple physically
and/or functionally to FcRI. To test this hypothesis directly, we
mutated Arg632 in CD4/PIR-A3 to Leu. The mutant chimeric
receptor (CD4/PIR-A3R632L), when transiently transfected
(0.5 µg) into 293T cells, is expressed at levels similar to
CD4/PIR-A3, as assessed by flow cytometry (data not shown). Although
both chimeric receptors can be expressed on the surface of 293T cells
after transfection of large amounts of plasmid DNA (0.5 µg) in the
absence of FcRI, we considered the possibility that
cotransfection of a signaling chain might enhance the cell surface
expression of the receptors at lower plasmid DNA concentrations. To
address this possibility, 50 ng of chimeric receptor cDNA was
transfected in combination with 500 ng murine FcRI cDNA into 293T
cells. Expression of the chimeric receptors was monitored using
anti-CD4. As shown in Fig 3, cotransfection of FcRI increased the surface expression of CD4/PIR-A3
approximately threefold, while the expression of
CD4/PIR-A3R632L was virtually unchanged. Interestingly,
CD4/PIR-A3 expression in the presence of FcRI was increased to
approximately the same level as that of the mutated receptor. It is
unclear whether the lower expression of FcR and our chimera in the
absence of FcRI is the result of receptor being sequestered in
the cytoplasm caused by an inability to integrate into the plasma
membrane, or caused by degradation of uncoupled receptor similar to
that seen with the chains of the TCR.16 Regardless, our
results show that FcRI likely interacts with the transmembrane
domain of PIR-A3. Moreover, they suggest that Arg632 within
the LIRM sequence may mediate both the interaction with FcRI as
well as the sequestration and/or degradation of receptor in the absence
of coexpressed signal transduction chains.
View larger version (14K):
[in this window]
[in a new window]
| Fig 3.
Cotransfection of FcRI with CD4/PIR-A3 enhances
cell surface expression in 293T cells. Fifty nanograms of pcDNA3 ( ),
CD4/PIR-A3 ( ), or CD4/PIR-A3R632L ( ) cDNA were
transiently transfected in the absence or presence of 500 ng murine
FcRI cDNA. Twenty-four hours later, the cultures were labeled
with PE-conjugated anti-human CD4 for flow cytometric analysis.
|
|
To show a physical interaction of FcRI with CD4/PIR-A3, 293T
cells were transiently transfected with the chimeric receptors and
FcRI, using 500 ng of each DNA to ensure equivalent surface expression. After stimulation with pervanadate, the transfected cells
were lysed in Brij-96 buffer followed by immunoprecipitation with
anti-CD4. Nonreduced immunoblot analysis with antiphosphotyrosine (Fig 4A) revealed an associated,
phosphorylated protein approximately the size of FcRI from the
CD4/PIR-A3 sample specifically. The apparent 50-kD band in lanes 4 and
5 is not a consistent finding and likely represents nonspecific
reactivity with the antiphosphotyrosine. Mutation of Arg632
completely abolished the chimeric receptor's ability to interact with
FcRI. Immunoblotting with antiphosphotyrosine is extremely sensitive, but does not allow the definitive identification of the
phosphoprotein as FcRI. In addition, this result leaves open the
possibility that because of the induction of tyrosine phosphorylation,
FcRI is interacting with an intermediary protein via an src
homology 2 domain interaction. Therefore, to definitively identify the
associated polypeptide as FcRI and rule out
phosphotyrosine-mediated interactions, similar immunoprecipitations
were performed without pervanadate stimulation followed by
immunoblotting with a polyclonal antibody recognizing FcRI.
Figure 4B unequivocally reveals the coimmunoprecipitation of the chain with CD4/PIR-A3 and not with CD4/PIR-A3R632L, showing
the importance of Arg632 within the LIRM sequence for
receptor complex formation. Several other recently identified
receptors, including the ILT receptors,4 the likely human
counterparts of the PIR, and putative activating LIR,5 also
contain the sequence LIRM near the outer leaflet of the plasma
membrane, suggesting that they may also interact with FcRI.
Notably, the charged residues of the activating human KIR and murine
Ly49D are not within this context, and they are spaced so as to be
nearly exactly in the middle of their respective transmembrane domains;
this even though KIR are type 1 Ig superfamily receptors and Ly49D are
type 2 C-type lectin receptors. Both the activating KIR and activating
Ly49s have now been shown to use the newly described signaling chain,
DAP12, suggesting that relative position of a receptor's transmembrane
arginine residue may be critical in determining the signal transduction
chain used by that receptor.30-32
View larger version (35K):
[in this window]
[in a new window]
| Fig 4.
FcRI associates with CD4/PIR-A3 via
Arg632 in 293T cells. 293T cells were transfected with 500 ng of pcDNA3, CD4/PIR-A3, or CD4/PIR-A3R632L cDNA in the
absence or presence of 500 ng of FcRI DNA. (A) A tyrosine
phosphoprotein is associated with CD4/PIR-A3 after pervanadate
stimulation. The transfected cells were stimulated with pervanadate and
lysed in 1% Brij-96 buffer, and whole cell lysates were
immunoprecipitated with anti-CD4. Immune complexes were eluted in
nonreducing Laemmli sample buffer and separated by 8% SDS-PAGE
followed by immunoblotting with antiphosphotyrosine. (B) FcRI
associates with CD4/PIR-A3 via Arg632 in 293T cells. The
transfected cells were lysed and processed as above, using reducing
Laemmli sample buffer followed by separation with 4% to 20% SDS-PAGE
and immunoblotting with antimurine FcRI.
|
|
CD4/PIR-A3 associates with FcRI in
murine macrophages.
Because the expression of the native PIR proteins seems to be
restricted to B cells and myeloid cells,7,8 we transfected the chimeric receptors into the murine macrophage cell line ANA-1 to
ask whether this receptor would associate with endogenous FcRI. ANA-1 cells were transfected with the pcDNA3 vector, the CD4/PIR-A3 chimera, or the chimera carrying the R632L mutation. After
transfection, the cells were selected in G418 and cloned by limiting
dilution. Cell surface expression of the receptors on the clones was
determined by flow cytometry using anti-CD4 MoAb. Although the
expressed levels of receptor on the clones were weak, the surface
expression was consistent and easily detectable. As shown in
Fig 5A, one CD4/PIR-A3 clone and one
CD4/PIR-A3R632L clone with comparable cell surface
expression were selected for further study. After stimulation with
pervanadate, the clones were lysed in Brij-96 buffer and
immunoprecipitated with anti-CD4. Immunoblot analysis with
antiphosphotyrosine under nonreducing conditions revealed a tyrosine
phosphoprotein of approximately 28 kD in anti-CD4 immunoprecipitates of
the CD4/PIR-A3 clone only (Fig 5B). To confirm the identity of this
protein as FcRI, a similar experiment was performed under
reducing conditions without pervanadate treatment followed by
immunoblotting with anti-FcRI. As shown in Fig 5C,
coimmunoprecipitation of FcRI was detectable from the CD4/PIR-A3
clone and not from CD4/PIR-A3R632L or the vector control
clones. These data show the ability of PIR-A3 transmembrane domains to
physically associate with the endogenous FcRI of murine
macrophages. Again, this interaction was found to be dependent on
Arg632 of the PIR-A3 sequence.
View larger version (89K):
[in this window]
[in a new window]
| Fig 5.
CD4/PIR-A3 is expressed and associates with
FcRI in ANA-1 stable transfectants. (A) ANA-1 express CD4/PIR-A3
and CD4/PIR-A3R632L. ANA-1 macrophages were transfected
with pcDNA3 (thin traces), CD4/PIR-A3 (left panel, thick trace),
or CD4/PIR-A3R632L (right panel, thick trace)
expression vectors, as described in Materials and Methods. Clones were
screened for expression using PE-conjugated anti-human CD4. (B)
CD4/PIR-A3 is associated with a tyrosine phosphoprotein after
pervanadate stimulation in ANA-1. ANA-1 clones (5 × 106 cells/point) were stimulated in the absence or presence
of pervanadate followed by lysis in 1% Brij-96 buffer. Whole cell
lysates were immunoprecipitated with anti-human CD4 and eluted in
nonreducing Laemmli sample buffer. Immune complexes were separated by
4% to 20% SDS-PAGE and immunoblotted with antiphosphotyrosine. (C)
FcRI associates with CD4/PIR-A3 via Arg632. ANA-1
clones (25 × 106 cells/point) were lysed and processed as
above, using reducing Laemmli sample buffer followed by separation with
4% to 20% SDS-PAGE and immunoblotting with antimurine FcRI.
|
|
CD4/PIR-A3 activates murine macrophages.
In addition to PIR-A3, macrophages express Fc receptors that physically
associate with FcRI.17 Aggregation of these receptors with antibody or immune complexes can deliver potent activation signals
to macrophages, resulting in production of cytokines and reactive
nitrogen intermediates.21,22,35 Having established that
PIR-A3 physically interact with FcRI, we next asked whether ligation of our PIR-A3 chimera would result in macrophage activation. Others have shown an interaction between a PIR-A receptor and the
FcRI chain in mast cells.36,37 Whereas the exact
PIR-A receptor used in their study is unclear, crosslinking resulted in
calcium mobilization, although there was no indication of cellular activation. Therefore, we next tested whether PIR-A3 activation could
lead to NO production by analyzing NO (measured as accumulated NO2) release from cells after ligation
of chimeric receptors. As shown in Fig 6,
NO production (20 to 30 µmol/L) was easily detectable from
CD4/PIR-A3, CD4/PIR-A3R632L, as well as the vector control,
when the cells were stimulated with interferon (IFN-) plus lipopolysaccharide
(LPS). However, only CD4/PIR-A3 was able to produce NO
in response to IFN- plus anti-CD4. The failure of
CD4/PIR-A3R632L to produce NO is reflective of its
inability to form a signaling complex because of the mutation of its
transmembrane arginine. In addition, the lack of NO production by
CD4/PIR-A3R632L definitively rules out Fc receptor effects
in these assays.
View larger version (17K):
[in this window]
[in a new window]
| Fig 6.
CD4/PIR-A3 induces NO production in ANA-1 macrophages.
ANA-1 clones (1 × 106 cells/well) were stimulated with
medium, 100 U/mL IFN-, 1 µg/mL goat antimouse IgG, 10 ng/mL LPS,
and 40 µL anti-CD4, as indicated for 24 hours, as described in
Materials and Methods. Cell-free culture supernatants were then assayed
for NO production. (), pcDNA3; (), CD4/PIR-A3; (),
CD4/PIR-A3R632L.
|
|
Macrophages are a key element in host defense. They are an important
source of a wide variety of secretory products, including inflammatory
cytokines and NO, and are endowed with antitumoral and antimicrobicidal
activities. The ability of PIR-A3 to induce NO suggests that the PIR-A
family of receptors will play an important role in the modulation of
the macrophage-mediated immune response. Unfortunately, the ligands for
the PIR have not yet been defined. The existence of multiple genes for
PIR-A proteins would, however, suggest that these receptors will
function to regulate macrophage NO production in response to various
highly homologous ligands.7 Macrophages are found in
different tissues where they are likely to encounter various ligand
configurations. The ability of the macrophage to express multiple PIR-A
receptors might allow recognition of a variety of ligands and
therefore, complex regulation of their responses. Our data clearly show
that even low levels of PIR-A3 expression are sufficient for macrophage
activation in the presence of IFN-, but further study of PIR-A
effects on macrophage biology will be required to address whether these
receptors function independently or as coreceptors. Regardless, our
findings show the capability of this new family of receptors to
activate macrophages and suggest that the signal transduction pathways
of this activation will be similar to those defined for other
FcRI-coupled receptors, specifically the Fc receptors themselves.
Continued study of this emerging family of receptors should shed
considerable light on the role of macrophage activation in regulation
of the immune response.
| |
FOOTNOTES |
Submitted October 6, 1998; accepted April 29, 1999.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
This is a US government work. There are no restrictions on its use.
Address reprint requests to Daniel W. McVicar,
PhD, NCI-FCRDC Building 560/Room 31-93, Frederick, MD 21702;
e-mail: MCVICAR{at}NIH.GOV.
| |
REFERENCES |
1.
Burshtyn DN, Scharenberg AM, Wagtmann N, Rajagopalan S, Berrada K, Yi T, Kinet JP, Long EO:
Recruitment of tyrosine phosphatase HCP by the killer cell inhibitor receptor.
Immunity
4:77, 1996[Medline]
[Order article via Infotrieve]
2.
Long EO, Burshtyn DN, Clark WP, Peruzzi M, Rajagopalan S, Rojo S, Wagtmann N, Winter CC:
Killer cell inhibitory receptors: Diversity, specificity, and function.
Immunol Rev
155:135, 1997[Medline]
[Order article via Infotrieve]
3.
Cella M, Dohring C, Samaridis J, Dessing M, Brockhaus M, Lanzavecchia A, Colonna M:
A novel inhibitory receptor (ILT3) expressed on monocytes, macrophages, and dendritic cell involved in antigen processing.
J Exp Med
185:1743, 1997[Abstract/Free Full Text]
4.
Samaridis J, Colonna M:
Cloning of novel immunoglobulin superfamily receptors expressed on human myeloid and lymphoid cells: Structural evidence for new stimulatory and inhibitory pathways.
Eur J Immunol
27:660, 1997[Medline]
[Order article via Infotrieve]
5.
Borges L, Hsu ML, Fanger N, Kubin M, Cosman D:
A family of human lymphoid and myeloid Ig-like receptors, some of which bind to MHC class I molecules.
J Immunol
159:5192, 1997[Abstract]
6.
Cosman D, Fanger N, Borges L, Kubin M, Chin W, Peterson L, Hsu ML:
A novel immunoglobulin superfamily receptor for cellular and viral MHC class I molecules.
Immunity
7:273, 1997[Medline]
[Order article via Infotrieve]
7.
Kubagawa H, Burrows PD, Cooper MD:
A novel pair of immunoglobulin-like receptors expressed by B cells and myeloid cells.
Proc Natl Acad Sci USA
94:5261, 1997[Abstract/Free Full Text]
8.
Hayami K, Fukuta D, Nishikawa Y, Yamashita Y, Inui M, Ohyama Y, Hikida M, Ohmori H, Takai T:
Molecular cloning of a novel murine cell-surface glycoprotein homologous to killer cell inhibitory receptors.
J Biol Chem
272:7320, 1997[Abstract/Free Full Text]
9.
Blery M, Kubagawa H, Chen CC, Vely F, Cooper MD, Vivier E:
The paired Ig-like receptor PIR-B is an inhibitory receptor that recruits the protein-tyrosine phosphatase SHP-1.
Proc Natl Acad Sci USA
95:2446, 1998[Abstract/Free Full Text]
10.
Takei F, Brennan J, Mager DL:
The Ly-49 family: Genes, proteins, and recognition of class I MHC.
Immunol Rev
155:67, 1998
11.
Ryan JC, Seaman WE:
Divergent functions of lectin-like receptors on NK cells.
Immunol Rev
155:79, 1997[Medline]
[Order article via Infotrieve]
12.
Mason LH, Anderson SK, Yokoyama WM, Smith HR, Winkler-Pickett R, Ortaldo JR:
The Ly-49D receptor activates murine natural killer cells.
J Exp Med
184:2119, 1996[Abstract/Free Full Text]
13.
Vely F, Vivier E:
Conservation of structural features reveals the existence of a large family of inhibitory cell surface receptors and noninhibitory/activatory counterparts.
J Immunol
159:2075, 1997[Abstract/Free Full Text]
14.
Ravetch JV, Kinet JP:
Fc receptors.
Annu Rev Immunol
9:457, 1991[Medline]
[Order article via Infotrieve]
15.
Kennedy IC, Ortaldo JR, O'Shea JJ:
Shared structural and functional motifs for signal transduction in T lymphocytes and natural killer cells, in
Lotzova E,
Herberman RB
(eds):
NK Cell Mediated Cytotoxicity: Receptors, Signaling, and Mechanims. Boca Raton, FL, CRC, 1992, p 147.
16.
Cosson P, Lankford SP, Bonifacino JS, Klausner RD:
Membrane protein association by potential intramembrane charge pairs.
Nature
351:414, 1991[Medline]
[Order article via Infotrieve]
17.
Daëron M:
Fc receptor biology.
Annu Rev Immunol
15:203, 1997[Medline]
[Order article via Infotrieve]
18.
Keegan AD, Paul WE:
Multichain immune recognition receptors: Similarities in structure and signaling pathways.
Immunol Today
13:63, 1992[Medline]
[Order article via Infotrieve]
19.
Foreback JL, Remick DG, Crockett-Torabi E, Ward PA:
Cytokine responses of human blood monocytes stimulated with Igs.
Inflammation
21:501, 1997[Medline]
[Order article via Infotrieve]
20.
Polat GL, Laufer J, Fabian I, Passwell JH:
Cross-linking of monocyte plasma membrane Fc alpha, Fc gamma or mannose receptors induces TNF production.
Immunology
80:287, 1993[Medline]
[Order article via Infotrieve]
21.
Bayón Y, Alonso A, Crespo MS:
Stimulation of Fc receptors in rat peritoneal macrophages induces the expression of nitric oxide synthase and chemokines by mechanisms showing different sensitivities to antioxidants and nitric oxide donors.
J Immunol
159:887, 1997[Abstract]
22.
Mozaffarian N, Berman JW, Casadevall A:
Immune complexes increase nitric oxide production by interferon--stimulated murine macrophage-like J774.16 cells.
J Leukoc Biol
57:657, 1995[Abstract]
23.
Cox GW, Mathieson BJ, Gandino L, Blasi E, Radzioch D, Varesio L:
Heterogeneity of hematopoietic cells immortalized by v-myc/v-raf recombinant retrovirus infection of bone marrow or fetal liver.
J Natl Cancer Inst
81:1492, 1989[Abstract/Free Full Text]
24.
Blasi E, Radzioch D, Durum SK, Varesio L:
A murine macrophage cell line, immortalized by v-raf and v-myc oncogenes, exhibits normal macrophage functions.
Eur J Immunol
17:1491, 1987[Medline]
[Order article via Infotrieve]
25.
Maddon PJ, Littman DR, Godfrey M, Maddon DE, Chess L, Axel R:
The isolation and nucleotide sequence of a cDNA encoding the T cell surface protein T4: A new member of the immunoglobulin gene family.
Cell
42:93, 1985[Medline]
[Order article via Infotrieve]
26.
Ra C, Jouvin M-H, Kinet JP:
Complete structure of the mouse mast cell receptor for IgE (FcRI) and surface expresson of chimeric receptors (Rat-Mouse-Human) on transfected cells.
J Biol Chem
264:15323, 1989[Abstract/Free Full Text]
27.
Ra C, Jouvin M-H, Blank U, Kinet JP:
A macrophage Fc receptor and the mast cell receptor for IgR share an identical subunit.
Nature
341:752, 1989[Medline]
[Order article via Infotrieve]
28.
Mason LH, Willette-Brown J, Anderson SK, Gosselin P, Shores EW, Love PE, Ortaldo JR, McVicar DW:
Cutting edge: Characterization of an associated 16-kDa tyrosine phosphoprotein required for Ly-49D signal transduction.
J Immunol
160:4148, 1998[Abstract/Free Full Text]
29.
Ding AH, Nathan CF, Stuehr DJ:
Release of reactive nitrogen intermediates and reactive oxygen intermediates from mouse peritoneal macrophages: Comparison of activating cytokines and evidence for independent production.
J Immunol
141:2407, 1988[Abstract]
30.
Lanier LL, Corliss BC, Wu J, Leong C, Phillips JH:
Immunoreceptor DAP12 bearing a tyrosine-based activation motif is involved in activating NK cells.
Nature
391:703, 1998[Medline]
[Order article via Infotrieve]
31. Gosselin P, Mason LH, Willette-Brown J, Ortaldo JR, McVicar DW,
Anderson SK: Ly49D and Ly49H: Two mouse NK cell activating receptors
associate with the signal transduction polypeptide DAP12. J Leukoc Biol
(in press), 1999
32.
Smith KA, Wu J, Bakker ABH, Phillips JH, Lanier LL:
Ly49D and Ly49H associate with mouse DAP12 and form activating receptors.
J Immunol
161:7, 1998[Abstract/Free Full Text]
33.
Morton HC, van den Herik-Oudijk IE, Vossebeld P, Snijders A, Verhoeven AJ, Capel PJA, van de Winkel JGJ:
Functional association between the human myeloid immunoglobulin A Fc receptor (CD89) and FcR chain.
J Biol Chem
270:29781, 1995[Abstract/Free Full Text]
34.
Pfefferkorn PC, Yeaman GR:
Association of IgA-Fc receptors (FcR) with FcRI2 subunits in U937 cells: Aggregation induces the tyrosine phosphorylation of 2.
J Immunol
153:3228, 1994[Abstract]
35.
Rose DM, Winston BW, Chan ED, Riches DW, Henson PM:
Interferon-gamma and transforming growth factor-beta modulate the activation of mitogen-activated protein kinases and tumor necrosis factor-alpha production induced by Fc gamma-receptor stimulation in murine macrophages.
Biochem Biophys Res Commun
238:256, 1997[Medline]
[Order article via Infotrieve]
36.
Maeda A, Kurosaki M, Kurosaki T:
Paired immunoglobulin-like receptor (PIR)-A is involved in activating mast cells through its association with Fc receptor chain.
J Exp Med
188:991, 1998[Abstract/Free Full Text]
37.
Yamashita Y, Ono M, Takai T:
Inhibitory and stimulatory functions of paired Ig-like receptor (PIR) family in RBL-2H3 cells.
J Immunol
161:4042, 1998[Abstract/Free Full Text]
This is a US government work. There are no restrictions on its use.
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
I. Torii, S. Oka, M. Hotomi, W. H. Benjamin Jr, T. Takai, J. F. Kearney, D. E. Briles, and H. Kubagawa
PIR-B-Deficient Mice Are Susceptible to Salmonella Infection
J. Immunol.,
September 15, 2008;
181(6):
4229 - 4239.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Z. Jakus, G. Berton, E. Ligeti, C. A. Lowell, and A. Mocsai
Responses of Neutrophils to Anti-Integrin Antibodies Depends on Costimulation through Low Affinity Fc{gamma}Rs: Full Activation Requires Both Integrin and Nonintegrin Signals
J. Immunol.,
August 1, 2004;
173(3):
2068 - 2077.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. D. Mousseau, D. Banville, D. L'Abbe, P. Bouchard, and S.-H. Shen
PILRalpha , a Novel Immunoreceptor Tyrosine-based Inhibitory Motif-bearing Protein, Recruits SHP-1 upon Tyrosine Phosphorylation and Is Paired with the Truncated Counterpart PILRbeta
J. Biol. Chem.,
February 11, 2000;
275(6):
4467 - 4474.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. H. Ho, T. Uehara, C.-C. Chen, H. Kubagawa, and M. D. Cooper
Constitutive tyrosine phosphorylation of the inhibitory paired Ig-like receptor PIR-B
PNAS,
December 21, 1999;
96(26):
15086 - 15090.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y.-M. Zheng, C. Liu, H. Chen, D. Locke, J. C. Ryan, and M. L. Kahn
Expression of the Platelet Receptor GPVI Confers Signaling via the Fc Receptor gamma -Chain in Response to the Snake Venom Convulxin but Not to Collagen
J. Biol. Chem.,
April 13, 2001;
276(16):
12999 - 13006.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION