|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 5 (September 1), 1999:
pp. 1820-1824
Fusion of a Novel Gene, BTL, to ETV6 in Acute Myeloid
Leukemias With a t(4;12)(q11-q12;p13)
By
Jan Cools,
Chrystèle Bilhou-Nabera,
Iwona Wlodarska,
Christine Cabrol,
Pascaline Talmant,
Philippe Bernard,
Anne Hagemeijer, and
Peter Marynen
From the Center for Human Genetics, Flanders Interuniversity
Institute for Biotechnology, University of Leuven, Leuven, Belgium;
Hematology Laboratory, University Victor Segalen Bordeaux 2, Bordeaux,
France; Hôpital Cantonal Universitaire, Genève,
Switzerland; and Centre Hospitalier Régional de Nantes, Nantes,
France.
 |
ABSTRACT |
The ETV6 gene (also known as TEL) is the main target
of chromosomal translocations affecting chromosome band 12p13. The
rearrangements fuse ETV6 to a wide variety of partner genes in
both myeloid and lymphoid malignancies. We report here 4 new cases of
acute myeloid leukemia (AML) with very immature myeloblasts
(French-American-British [FAB]-M0) and with a
t(4;12)(q11-q12;p13). In all cases, ETV6 was found recombined
to a new gene, homologous to the mouse Brx gene. The
gene was named BTL (Brx-like
Translocated in Leukemia). Reverse
transcriptase-polymerase chain reaction (RT-PCR) experiments indicate
that the expression of the BTL-ETV6 transcript, but not
of the reciprocal ETV6-BTL transcript, is a common
finding in these leukemias. In contrast to the majority of other ETV6 fusions, both the complete helix-loop-helix (HLH) and ETS
DNA binding domains of ETV6 are present in the predicted BTL-ETV6 fusion protein, and the chimeric gene is transcribed from the BTL promoter.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
ETV6 (ALSO KNOWN AS TEL) belongs to the
ETS family of transcription factors characterized by 2 important
domains: the HLH (helix-loop-helix or pointed) domain that mediates
protein-protein interactions and the ETS DNA binding domain. The gene
was originally discovered as the 12p gene involved in the
t(5;12)(q33;p13) in chronic myelomonocytic leukemia.1 It is
now clear that ETV6 is the major target of translocations
involving 12p13 in hematologic malignancies.2 In the fusion
protein resulting from these rearrangements, the HLH-domain of ETV6
activates the kinase domain of respectively PDGFRB1,
ABL3, JAK24 or modifies the properties of the
transcription factor CBFA2.5 A different type of
fusion was described for the t(3;12) in myeloid disease where
ETV6 drives the expression of
MDS1/EVI1.6 From a mechanistic point of
view, this might be similar to a t(12;13) case where the 5' part
of ETV6 drives the expression of the complete homeobox gene
CDX2.7 Still another type of fusion was
characterized from a t(12;22), which results in the fusion of MN1 to
ETV6 generating a chimeric transcription factor with the ETV6
DNA-binding domain.8
The t(4;12)(q11-q13;p12-p13) was previously described as a recurrent
translocation. Twelve cases of acute leukemia were reviewed by Harada
et al9: 3 acute lymphocytic leukemia (ALL), 8 acute myeloid leukemia (AML), and 1 acute undifferentiated leukemia (AUL). The AML cases occurred predominantly in adults, and
the ALL cases were found exclusively in children. We have collected 4 new cases (1 myeloid/natural killer [NK] cell leukemia, and 3 AML-M0), with a t(4;12)(q11-q12;p13) and characterized molecularly the
genes affected by the rearrangement.
| |
MATERIALS AND METHODS |
Case reports.
Four patients (3 men, 1 woman), aged 54 to 81, presented with acute
leukemia at 4 different hospitals. Clinical and cytogenetic data are
summarized in Table 1. The patients had no
particular antecedents, except for case 2, who was treated previously
for chronic lymphocytic leukemia (CLL). The onset of the
diseases was acute. Case 1 had extensive lymph node enlargement and was diagnosed as myeloid/NK cell leukemia,10 while the 3 other
cases were classified as AML-M0. None presented with
hepatosplenomegaly. The bone marrow showed dysplasia and blast cells of
an undifferentiated phenotype. Remarkably, all cases showed the same
very immature myeloid immunophenotype: CD7+,
CD13+, CD33+. Response to intensive
chemotherapeutic regimen for myeloid leukemia was obtained in 2 cases.
Cloning of the t(4;12) fusion.
Fluorescent in situ hybridization (FISH) was performed as described
previously.11 First-strand cDNA for anchored polymerase chain reaction (PCR) (rapid amplification of cDNA ends [RACE]) was
synthesized from 1 µg of total RNA using MuMLV-reverse transcriptase (GIBCO-BRL, Gaithersburg, MD) using, respectively, the
oligonucleotide ETV6R3a, derived from exon 3 of ETV6 for the
5'-RACE experiments and the oligonucleotide 465 for the
3'-RACE experiments (the sequence of all PCR primers is given at
the end of this section). For the 5'-RACE experiments, the
first-strand cDNA was tailed with deoxyadenosine triphosphate
(dATP). Second-strand synthesis was performed using Klenow
DNA polymerase (GIBCO-BRL) and the primers 466 (5'-RACE) and
ETV6F1a (3'-RACE). Anchored PCR was performed for 35 cycles with
primers ETV6R3b-467 (5'-RACE) and ETV6F1a-467 (3'-RACE). Nested PCR was performed with the primers ETV6R2-468 (5'-RACE) and ETV6F1b-468 (3'-RACE). PCR products were cloned into pGEM-T Easy (Promega, Madison, WI) and sequenced.
Reverse transcriptase (RT)-PCR.
RT-PCR experiments on cases 1 and 2 were performed on 1 µg of total
RNA using the Titan RT-PCR system from Boehringer (Mannheim, Germany).
The BTL-ETV6 transcript was detected using the primers BTLF1 - ETV6R3b for the first round PCR and primers BTLF2 - ETV6R2 for the nested PCR. For detection of the ETV6-BTL
transcript, the primers ETV6F1a - BTLR6a were used, followed by the
nested primers ETV6F1b - BTLR6b. For cases 3 and 4, first-strand cDNA was generated as described above using the primer 465. On 10% of this
cDNA, PCR was performed with the primers BTLF2 - ETV6R3b followed by
the nested primers BTLF3 - ETV6R2 to detect the
BTL-ETV6 transcript and with the primers ETV6F1a - BTLR6b and the nested primers ETV6F1b - BTLR4 to detect the
ETV6-BTL transcript.
Cloning of BTL.
A 500-bp BTL probe was generated from cDNA obtained from the
K562 cell line by PCR using the primers BTLF2 and BTLR6a. A human fetal
kidney cDNA library cloned into the  gt10 vector (Clontech, Palo
Alto, CA) was screened using a standard protocol. Genomic PAC clones containing BTL were isolated by
screening high-density filters carrying the RPCI1 and RPCI5 PAC
libraries (Roswell Park Cancer Institute, Buffalo, NY).
Oligonucleotides.
(Oligonucleotides derived from ETV6 and BTL are
indicated in Fig 1A).
ETV6F1a: 5' TGAGACATGTCTGAGACTCCTGCT 3'; ETV6F1b: 5'
ACTCCTGCTCAGTGTAGCATTAAG 3'; ETV6R3a: 5'
GAATGAGGAGATCGATAGCG 3'; ETV6R3b: 5'
TCCCTGCTCCAGTAAATTGGCTGCAAG 3'; ETV6R2: 5'
ACTGGAACATGAAGTGGCGT 3'; BTLF1: 5' CAGGATGGCGGATTTCGACG
3'; BTLF2: 5' GGTCACGTCACCGTATTTGGA 3'; BTLF3:
5' CGTTGGCTACTTTGTGGCTG 3'; BTLR6a: 5'
CCACACGATTCTGTAGAACC 3'; BTLR6b: 5' AATCTGGTCGAAAAATCGGTG
3'; BTLR4: 5' TCCCATTCTAATAACTTCTC 3'; 465: 5'
CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCNNNNNN 3'; 466: 5'
CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTT 3'; 467: 5'
CCAGTGAGCAGAGTGACG 3'; 468: 5' GAGGACTCGAGCTCAAGC 3'.
| |
RESULTS AND DISCUSSION |
Cloning of the t(4;12).
Metaphases from case 1, a patient with myeloid/NK cell leukemia
characterized by a t(4;12)(q11-q12;p13), were analyzed by FISH using
probes covering, respectively, the 5'- and the 3'-end of
ETV6.12,13 Cosmid 50F4 (intron 1-exon 2 of
ETV6) showed split FISH signals (results not shown), indicating
that the breakpoint occurred in intron 1 of ETV6. To identify
the fusion partner of ETV6, 5'- and 3'-RACE
experiments were performed on reverse transcribed RNA of the tumor
cells. Nested oligonucleotides located, respectively, in exons 3 and 2 of ETV6 were used for 5'-RACE and oligonucleotides located in exon 1 were designed for the 3'-RACE experiments. Both experiments showed new sequences fused in frame to, respectively, exon
2 (5'-RACE) and exon 1 (3'-RACE) of ETV6. These
sequences showed high similarity to the murine Brx gene
(Brain specific X-linked gene, Accession no.
Y11896). Therefore, the gene was named BTL (for
BRX-like Translocated in
Leukemia). In addition, 2 Caenorhabditis
elegans predicted proteins from the cosmid W06E11
(accession no. U20862) were detected in the databases.
Cloning of the BTL gene.
Oligonucleotides were designed to amplify a 500-bp fragment of the
BTL cDNA. A human fetal kidney cDNA phage library was screened with this probe and 4 positive plaques were analyzed. A 1-kb consensus cDNA sequence, containing an open reading frame of 495 bp, was constructed and submitted to GenBank (accession no. AF159423). On a
Northern blot carrying total RNA of K562 and U937 cells, 1 single
transcript of approximately 1.4 kb was detected in both cell lines
(results not shown), indicating that our 1-kb cDNA sequence is almost
full-length.
The open reading frame of BTL predicts a protein of 165 amino
acids that shows 49% similarity to the murine Brx protein. No similarity was found with any known functional protein domain, nor is
there any information available about the function of Brx. Analysis of
the amino acid sequence of BTL showed the presence of a hydrophobic
stretch of 23 amino acids, which could represent a transmembrane domain.
The 500-bp BTL cDNA probe was also used to screen a genomic PAC
library. Ten PAC clones were identified. The exact content of each PAC
was investigated by hybridization with oligonucleotides derived from
exons of the BTL gene (Fig 1A). Only PAC
238H24 contained the complete gene, whereas PAC 200D9 and PAC 1146G14
contained the 5' end and the 3' end, respectively, of
BTL. Sequence analysis of EcoRI and HindIII
subclones of these PACs showed the presence of 6 different exons. The
exon sequences confirmed the consensus cDNA sequence. The length of
introns 1 and 5 was measured by long range PCR. Intron 3 could not be
amplified by PCR, most probably because it is more than 25 kb long. A
map of the genomic structure of BTL is shown in Fig 1A.
View larger version (34K):
[in this window]
[in a new window]
| Fig 1.
RT-PCR and schematic representation of the results. (A)
Genomic structure of BTL and ETV6. The position of the
PAC clones covering BTL was determined by Southern
hybridization using oligonucleotides derived from the exon sequences
( , positive by hybridization;  , negative by hybridization). The
genomic structure of ETV6 was taken from Baens et
al.12 The different primers used for PCR are shown in
italics above the respective genomic structures. Exons are represented
by gray boxes. E, EcoRI; H, HindIII. (B) Detection of
the BTL-ETV6 and ETV6-BTL transcripts in the 4 cases by
RT-PCR. Only the results of the second-round PCR are shown. nc,
negative control. (C) Schematic representation of the predicted fusion
proteins. Sequences derived from ETV6 are drawn in italics. Arrowheads
mark the bounderies between the ETV6 and BTL parts. HR, hydrophobic
region of BTL; HLH, helix-loop-helix domain of ETV6; ETS, DNA binding
domain of ETV6.
|
|
Molecular characterization of new t(4;12) cases.
In addition to the case described above, 3 other cases with a
t(4;12)(q11-q12;p13) were collected. These 3 cases showed a very
immature myeloid immunophenotype and were diagnosed as AML-M0. First,
the rearrangements were analyzed by FISH (results not shown). PAC
1146G14 (3'-BTL) was found to span the breakpoint at 4q
in the first 3 cases, clearly indicating a break within the BTL
gene. For case 4, only interphase nuclei were available and the
colocalization of PAC 200D9 (5'-BTL) and PAC 28B5
(3'-ETV6) was observed (for localization of these probes,
see Fig 1A).
Second, RT-PCR experiments were performed as described in Materials and
Methods. All PCR products were cloned and sequenced to confirm their
identity. In all 4 cases, the same BTL-ETV6 transcript (exon 1-3 of BTL fused to exon 2-8 of ETV6) was
detected (Fig 1B). The reciprocal ETV6-BTL (exon 1-exon 4)
transcript was detected only in case 1 and absent in cases 2 and 3. In
case 4, however, a different ETV6-BTL transcript was
detected with a fusion of ETV6 exon 2 to BTL exon 2 (Fig 1B) that cannot be the reciprocal of the BTL exon
3-ETV6 exon 2 fusion detected in this case. Experiments aiming
at the detection of a BTL-ETV6 (exon 1-exon 3) fusion
transcript were consistently negative. All experiments were repeated
including the negative controls to exclude contamination and showed the same results. This suggests that case 4 involved a more complicated rearrangement with duplication of regions from 4q and/or 12p. Unfortunately, this could not be confirmed by FISH or genomic analyses,
as no metaphases or genomic DNA were available.
Taken together, these data indicate that in all 4 cases a transcript is
present predicting a protein with the amino terminal 110 amino acids of
BTL (exon 1-3) fused to the carboxyterminal 441 amino acids of ETV6
(exons 2-8) (Fig 1C).
The presence of the BTL-ETV6 transcript in 4 acute leukemia
cases strongly suggests that it is involved in the leukemogenic process. The fusion protein contains both the HLH oligomerization domain and the ETS DNA binding domain of ETV6, which is most similar to
the MN1-ETV6 fusion.8 No specific domains are present in BTL, which would shed light on its possible function. A striking feature of BTL is the presence of a hydrophobic stretch of 23 amino
acids, which is also present in the BTL-ETV6 fusion protein. It remains
to be investigated whether BTL and BTL-ETV6 are indeed membrane bound
proteins and whether this is related to the potential oncogenic
properties of this fusion protein.
At least 15 more translocations with a cytogenetically similar
t(4;12)(q11-q13;p13) have been reported in the
literature.9,14,15 Interestingly, 4 of the AML cases
reported by Harada et al9 show a similar immature
immunophenotype (CD7+, CD13+,
CD33+/CD34+) as our cases and for 2 of these
cases, evidence was collected that ETV6 is involved. The PAC
clones isolated by us for BTL should allow us to investigate
whether the 4q breakpoint is homogeneous at the molecular level.
| |
ACKNOWLEDGMENT |
We thank Dr P. Van den Berghe and Dr G. Verhoef (UZ Leuven, Leuven,
Belgium) for providing us patient material and clinical data.
| |
FOOTNOTES |
Submitted March 1, 1999; accepted April 29, 1999.
Supported by Grants No. G.0153.96 and G.0377.97 from the Fonds voor
Wetenschappelyk Onderroek, Vlaanderen (F.W.O.) (to P.M. and A.H.). This report represents results of the Belgian Program on
Interuniversity Poles of Attraction initiated by the Belgian State,
Prime Minister's Office, Science Policy Programming. P.M. is an
Onderzoeksdirecteur and J.C. an Aspirant of the Fonds voor Wetenschappelijk Onderzoek, Vlaanderen.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Peter Marynen, PhD, Center for
Human Genetics, Flanders Interuniversity Institute for Biotechnology,
University of Leuven, Campus Gasthuisberg, Herestraat 49, B-3000
Leuven, Belgium; e-mail: Peter.Marynen{at}med.KULeuven.ac.be.
| |
REFERENCES |
1.
Golub TR, Barker GF, Lovett M, Gilliland DG:
Fusion of PDGF receptor  to a novel ets-like gene, tel, in chronic myelomonocytic leukemia with t(5;12) chromosomal translocation.
Cell
77:307, 1994[Medline]
[Order article via Infotrieve]
2.
O'Connor HE, Butler TA, Clark R, Swanton S, Harrison CJ, Secker-Walker LM, Foroni L:
Abnormalities of the ETV6 gene occur in the majority of patients with aberrations of the short arm of chromosome 12: A combined PCR and Southern blotting analysis.
Leukemia
12:1099, 1998[Medline]
[Order article via Infotrieve]
3.
Papadopoulos P, Ridge SA, Boucher CA, Stocking C, Wiedemann LM:
The novel activation of ABL by fusion to an ets-related gene, TEL.
Cancer Res
55:34, 1995[Abstract/Free Full Text]
4.
Peeters P, Raynaud S, Cools J, Wlodarska I, Grosgeorge J, Philip P, Monpoux F, Van Rompaey L, Baens M, Van Den Berghe H, Marynen P:
Fusion of TEL, the Ets-variant gene 6 (ETV6) to the receptor-associated kinase JAK2 as a result of t(9;12) in a lymphoid and t(9;15;12) in a myeloid leukemia.
Blood
90:2535, 1997[Abstract/Free Full Text]
5.
Romana SP, Mauchauffe M, Le Coniat M, Chumakov I, Le Paslier D, Berger R, Bernard OA:
The t(12;21) of acute lymphoblastic leukemia results in a tel-AML1 gene fusion.
Blood
85:3662, 1995[Abstract/Free Full Text]
6.
Peeters P, Wlodarska I, Baens M, Criel A, Selleslag D, Hagemeijer A, Van Den Berghe H, Marynen P:
Fusion of ETV6 to MDS1/EVI1 as a result of t(3;12)(q26;p13) in myeloproliferative disorders.
Cancer Res
57:564, 1997[Abstract/Free Full Text]
7.
Chase A, Reiter A, Burci L, Cazzaniga G, Biondi A, Pickard J, Roberts IAG, Goldman JM, Cross NCP:
Fusion of ETV6 to the caudal-related homeobox gene CDX2 in acute myeloid leukemia with the t(12;13)(p13;q12).
Blood
93:1025, 1999[Abstract/Free Full Text]
8.
Buijs A, Sherr S, Van Baal S, Van Bezouw S, Van der Plas D, Van Kessel AG, Riegman P, Lekanne-Deprez RL, Zwarthoff E, Hagemeijer A, Grosveld G:
Translocation (12;22) (p13;q11) in myeloproliferative disorders results in fusion of the ETS-like TEL gene on 12p13 to the MN1 gene on 22q11.
Oncogene
10:1511, 1995[Medline]
[Order article via Infotrieve]
9.
Harada H, Harada Y, Eguchi M, Dohy H, Kamada N:
Characterization of acute leukemia with t(4;12).
Leuk Lymphoma
25:47, 1997[Medline]
[Order article via Infotrieve]
10.
Suzuki R, Yamamoto K, Seto M, Kagami Y, Ogura M, Yatabe Y, Suchi T, Kodera Y, Morishima Y, Takahashi T, Saito H, Ueda R, Nakamura S:
CD7+ and CD56+ myeloid/natural killer cell precursor acute leukemia: A distinct hematolymphoid disease entity.
Blood
90:2417, 1997[Abstract/Free Full Text]
11.
Wlodarska I, Mecucci C, Marynen P, Guo C, Franckx D, La Starza R, Aventin A, Bosly A, Martelli MF, Cassiman J-J, Van Den Berghe H:
TEL gene is involved in myelodysplastic syndromes with either the typical t(5;12)(q33;p13) translocation or its variant t(10; 12)(q24;p13).
Blood
85:2848, 1995[Abstract/Free Full Text]
12.
Baens M, Peeters P, Guo C, Aerssens J, Marynen P:
Genomic organisation of TEL: The human ETS-variant gene 6 (ETV6).
Genome Res
6:404, 1996[Abstract/Free Full Text]
13.
Baens M, Wlodarska I, Corveleyn A, Hoornaert I, Hagemeijer A, Marynen P:
A physical, transcript, and deletion map of chromosome region 12p12.3 flanked by ETV6 and CDKN1B: Hypermethylation of the LRP6 CpG island in two leukemia patients with hemizygous del(12p).
Genomics
56:40, 1999[Medline]
[Order article via Infotrieve]
14.
Andreasson P, Johansson B, Billström R, Garwicz S, Mitelman F, Höglund M:
Fluorescence in situ hybridization analyses of hematologic malignacies reveal frequent cytogenetically unrecognized 12p rearrangements.
Leukemia
12:390, 1998[Medline]
[Order article via Infotrieve]
15.
Birg F, Marynen P, Hagemeijer A:
The ETV6/TEL gene in haematological malignancies.
Leukemia
10:1998, 1996 (abstr)
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. J. Walter, J. E. Payton, R. E. Ries, W. D. Shannon, H. Deshmukh, Y. Zhao, J. Baty, S. Heath, P. Westervelt, M. A. Watson, et al.
Acquired copy number alterations in adult acute myeloid leukemia genomes
PNAS,
August 4, 2009;
106(31):
12950 - 12955.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. De Keersmaecker, C. Graux, M. D. Odero, N. Mentens, R. Somers, J. Maertens, I. Wlodarska, P. Vandenberghe, A. Hagemeijer, P. Marynen, et al.
Fusion of EML1 to ABL1 in T-cell acute lymphoblastic leukemia with cryptic t(9;14)(q34;q32)
Blood,
June 15, 2005;
105(12):
4849 - 4852.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. J. Seward, A. S. Koh, J. L. Boyer, and N. Ballatori
Functional Complementation between a Novel Mammalian Polygenic Transport Complex and an Evolutionarily Ancient Organic Solute Transporter, OST{alpha}-OST{beta}
J. Biol. Chem.,
July 18, 2003;
278(30):
27473 - 27482.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. G. M. Frints, P. Marynen, D. Hartmann, J.-P. Fryns, J. Steyaert, M. Schachner, B. Rolf, K. Craessaerts, A. Snellinx, K. Hollanders, et al.
CALL interrupted in a patient with non-specific mental retardation: gene dosage-dependent alteration of murine brain development and behavior
Hum. Mol. Genet.,
July 1, 2003;
12(13):
1463 - 1474.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Cools, D. J. DeAngelo, J. Gotlib, E. H. Stover, R. D. Legare, J. Cortes, J. Kutok, J. Clark, I. Galinsky, J. D. Griffin, et al.
A Tyrosine Kinase Created by Fusion of the PDGFRA and FIP1L1 Genes as a Therapeutic Target of Imatinib in Idiopathic Hypereosinophilic Syndrome
N. Engl. J. Med.,
March 27, 2003;
348(13):
1201 - 1214.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. J. Baxter, A. Hochhaus, P. Bolufer, A. Reiter, J. M. Fernandez, L. Senent, J. Cervera, F. Moscardo, M. A. Sanz, and N. C.P. Cross
The t(4;22)(q12;q11) in atypical chronic myeloid leukaemia fuses BCR to PDGFRA
Hum. Mol. Genet.,
June 1, 2002;
11(12):
1391 - 1397.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Cools, N. Mentens, M. D. Odero, P. Peeters, I. Wlodarska, M. Delforge, A. Hagemeijer, and P. Marynen
Evidence for position effects as a variant ETV6-mediated leukemogenic mechanism in myeloid leukemias with a t(4;12)(q11-q12;p13) or t(5;12)(q31;p13)
Blood,
March 1, 2002;
99(5):
1776 - 1784.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Yagasaki, D. Wakao, Y. Yokoyama, Y. Uchida, I. Murohashi, H. Kayano, M. Taniwaki, A. Matsuda, and M. Bessho
Fusion of ETV6 to Fibroblast Growth Factor Receptor 3 in Peripheral T-Cell Lymphoma with a t(4;12)(p16;p13) Chromosomal Translocation
Cancer Res.,
December 1, 2001;
61(23):
8371 - 8374.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. B. Beverloo, I. Panagopoulos, M. Isaksson, E. van Wering, E. van Drunen, A. de Klein, B. Johansson, and R. Slater
Fusion of the Homeobox Gene HLXB9 and the ETV6 Gene in Infant Acute Myeloid Leukemias with the t(7;12)(q36;p13)
Cancer Res.,
July 1, 2001;
61(14):
5374 - 5377.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Cazzaniga, M. Daniotti, S. Tosi, G. Giudici, A. Aloisi, E. Pogliani, L. Kearney, and A. Biondi
The Paired Box Domain Gene PAX5 Is Fused to ETV6/TEL in an Acute Lymphoblastic Leukemia Case
Cancer Res.,
June 1, 2001;
61(12):
4666 - 4670.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Kuno, A. Abe, N. Emi, M. Iida, T. Yokozawa, M. Towatari, M. Tanimoto, and H. Saito
Constitutive kinase activation of the TEL-Syk fusion gene in myelodysplastic syndrome with t(9;12)(q22;p12)
Blood,
February 15, 2001;
97(4):
1050 - 1055.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Buijs, L. van Rompaey, A. C. Molijn, J. N. Davis, A. C. O. Vertegaal, M. D. Potter, C. Adams, S. van Baal, E. C. Zwarthoff, M. F. Roussel, et al.
The MN1-TEL Fusion Protein, Encoded by the Translocation (12;22)(p13;q11) in Myeloid Leukemia, Is a Transcription Factor with Transforming Activity
Mol. Cell. Biol.,
December 15, 2000;
20(24):
9281 - 9293.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
Y. Iijima, T. Ito, T. Oikawa, M. Eguchi, M. Eguchi-Ishimae, N. Kamada, K. Kishi, S. Asano, Y. Sakaki, and Y. Sato
A new ETV6 / TEL partner gene, ARG (ABL-related gene or ABL2), identified in an AML-M3 cell line with a t(1;12)(q25;p13) translocation
Blood,
March 15, 2000;
95(6):
2126 - 2131.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
X. Gu, B.-H. Shin, Y. Akbarali, A. Weiss, J. Boltax, P. Oettgen, and T. A. Libermann
Tel-2 Is a Novel Transcriptional Repressor Related to the Ets Factor Tel/ETV-6
J. Biol. Chem.,
March 16, 2001;
276(12):
9421 - 9436.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Van Baelen, J. Vanoevelen, L. Missiaen, L. Raeymaekers, and F. Wuytack
The Golgi PMR1 P-type ATPase of Caenorhabditis elegans. IDENTIFICATION OF THE GENE AND DEMONSTRATION OF CALCIUM AND MANGANESE TRANSPORT
J. Biol. Chem.,
March 30, 2001;
276(14):
10683 - 10691.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION