|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 6 (September 15), 1999:
pp. 1878-1889
Nuclear Factor- B-Dependent Induction of Interleukin-8
Gene Expression by Tumor Necrosis Factor : Evidence for an
Antioxidant Sensitive Activating Pathway Distinct From Nuclear
Translocation
By
Spiros Vlahopoulos,
Istvan Boldogh,
Antonella Casola, and
Allan R. Brasier
From the Departments of Internal Medicine, Microbiology & Immunology,
the Sealy Center for Molecular Sciences, and the Department of
Pediatrics, University of Texas Medical Branch, Galveston,
TX.
 |
ABSTRACT |
Tumor necrosis factor (TNF ) is a pluripotent activator of
inflammation by inducing a proinflammatory cytokine cascade. This
phenomenon is mediated, in part, through inducible expression of the
CXC chemokine, interleukin-8 (IL-8). In this study, we investigate the
role of TNF -inducible reactive oxygen species (ROS) in IL-8
expression by "monocyte-like" U937 histiocytic lymphoma cells.
TNF is a rapid activator of IL-8 gene expression by U937, producing
a 50-fold induction of mRNA within 1 hour of treatment. In gene
transfection assays, the effect of TNF requires the presence of an
inducible nuclear factor- B (NF- B) (Rel A) binding site in the
IL-8 promoter. TNF treatment induces a rapid translocation of the 65 kD transcriptional activator NF- B subunit, Rel A, whose binding in the nucleus occurs before changes in intracellular ROS.
Pretreatment (or up to 15 minutes posttreatment) relative to TNF
with the antioxidant dimethyl sulfoxide (DMSO) (2% [vol/vol]) blocks
80% of NF- B-dependent transcription. Surprisingly, however, DMSO
has no effect on inducible Rel A binding. Similar selective effects on
NF- B transcription are seen with the unrelated antioxidants, N-acetylcysteine (NAC) and vitamin C. These data indicate that TNF
induces a delayed ROS-dependent signalling pathway that is required for
NF- B transcriptional activation and is separable from that required
for its nuclear translocation. Further definition of this pathway will
yield new insights into inflammation initiated by TNF signalling.
© 1999 by The American Society of Hematology.
 |
INTRODUCTION |
THE PLURIPOTENT CYTOKINE tumor necrosis
factor (TNF ) has been shown to be an endogenous mediator of
inflammation and cellular immune responses.1 Binding to
ubiquitously expressed receptors, TNF is capable of eliciting a wide
spectrum of physiologic and cellular responses to acute endotoxemia,
acute respiratory distress syndrome, and infection with protozoal,
bacterial, and viral pathogens. In circulating blood, monocytes are
important target cells of TNF action where it induces parallel
cellular (enhanced cytotoxic capacity) and genetic programs (enhanced
secretion of additional inflammatory mediators, including interleukin-1 [IL-1], IL-8, and platelet activating factor) that allow acquisition of a phagocytic phenotype. In fact, monocytic cells represent the major
source of TNF -inducible IL-8 secretion in human blood.2
The actions of TNF are mediated by single transmembrane spanning
receptors lacking intrinsic kinase activity (reviewed in Smith et
al3). Circulating and binding as a trimeric peptide, TNF
induces receptor trimerization. Trimerization, an event required for
receptor activation, results in protein recruitment to the intracellular (cytoplasmic) domain of the receptor.4 These signal transducing proteins, termed TNF receptor death domain protein
(TRADD), and TRADD-associated factors (TRAFs) apparently control the
activity of intracellular serine-threonine kinase cascades and protease
activation.4 In addition, it has been appreciated that TNF
receptor activation also results in the generation of putative second
messenger molecules including ceramide, 1,2-diacylglycerol, arachidonic
acid, and reactive oxygen species (ROS).
IL-8 is an important paracrine mediator of inflammation of the CXC
chemokine family that amplifies inflammatory signals by demargination,
activation, and chemotaxis of polymorphonuclear leukocytes.5,6 Encoded by a highly inducible gene, TNF
is a potent inducer of IL-8 secretion in a variety of cell types through a transcriptional mechanism primarily regulated by nuclear factor- B (NF- B).2,7-11 NF- B is a heterodimeric
protein composed of the transactivating subunit (Rel A) associated with
the DNA binding subunit (NF- B1) sequestered in a latent cytoplasmic
form by association with I B inhibitor. In response to cytokine
stimulation, Rel A-I B dissociates and I B is proteolyzed,
allowing the liberated cytoplasmic NF- B to be translocated into the
nucleus, where it binds to genomic targets and initiates
transcription.12
ROS are ubiquitous highly diffusable and reactive molecules
produced as a result of reduction of molecular oxygen, and include species such as hydrogen peroxide, superoxide anion, and hydroxyl radical.13 Recently, a role of ROS in cellular responses to growth factor signalling has been described for platelet-derived growth
factor14 and basic fibroblast-derived growth
factor.15 In these examples, hormone receptor-activated ROS
were involved in proliferative and programmed cell death. The
contribution of ROS as second messenger molecules in TNF signalling
is controversial. Although others have shown that extracellular
oxidants (H2O2) and enzymatic oxidative
stress-inducing systems are capable of activating IL-8
secretion,16 these systems may be artifactual because they
may not reproduce hormone receptor-induced ROS production in magnitude,
kinetics, or ROS concentrations in proper subcellular compartments.17
Here we investigate the role of ROS in mediating TNF -inducible
expression of IL-8 in the histiocytic lymphoma cell line U937. U937 cells share phenotypic (IgG receptor expression and inducible differentiation) and functional (inducible cytokine expression) features with normal monocytes.18,19 We show that TNF is
a potent and rapid inducer of IL-8 protein secretion and gene
expression. This effect is, in part, through enhanced transcription
mediated through a single inducible cis regulatory element that binds
to the inducible NF- B transcription factor. In parallel, TNF
induces ROS generation as measured by the specific fluorescent
2',7'dichlorofluescein oxidation assay.20 Pretreatment of
U937 cells with the antioxidant dimethyl sulfoxide (DMSO) blocks
inducible ROS generation and NF- B transcriptional activity.
Surprisingly, the effect of DMSO occurs without altering either NF- B
nuclear abundance or DNA-binding activity. The unrelated antioxidants,
vitamin C and N-acetylcysteine (NAC), also selectively inhibit NF- B
transcriptional activity without detectable effects on NF- B binding.
These data indicate that an antioxidant pathway is required for NF- B
transcriptional activity that is separate and independent of signals
coupled to NF- B nuclear translocation.
 |
MATERIALS AND METHODS |
Materials.
Recombinant human TNF was obtained from Calbiochem (San
Diego, CA). DMSO, NAC, vitamin C, and vitamin E were purchased from Sigma (St Louis, MO).
N-[2-hydroxyethyl]piperazine-N'-[2-ethanesulfonic acid] (HEPES),
sodium lauryl sulfate (SDS), sodium chloride, sodium citrate, and
ethylenediaminetetraacetic Acid (EDTA) were from Fischer Scientific
(Pittsburgh, PA). Dichlorofluorescein diacetate (DCF-DA) was obtained
from Molecular Probes (Eugene, OR).
Cell culture and treatment.
U937 human histiocytoma lymphoma cells were obtained from the
American Type Culture Collection (ATCC; Rockville, MD) and
grown as a suspension in RPMI medium containing 10% (vol/vol) fetal bovine serum, 10 mmol/L glutamine, 100 IU/mL penicillin, and 100 µg/mL streptomycin (GIBCO, Gaithersburg, MD) in an atmosphere of 5%
CO2, at 37°C. TNF was added to the medium at a final
concentration of 20 ng/mL, unless otherwise stated. For antioxidant
treatments, cells were pretreated either with indicated concentrations
of DMSO (1 hour before TNF , unless otherwise indicated), or NAC (7.5 mmol/L, 2 hours before TNF ), or with vitamin C (4 mmol/L, 2 hours
before TNF ).
Assesment of intracellular ROS generation.
U937 cells were preloaded with 5 µmol/L DCF-DA in fully
supplied culture medium containing 20 mmol/L HEPES, pH 7.4 for 20 minutes at 37°C. The cells were washed by centrifugation at
200g and resuspended in serum-containing fresh medium buffered
in 20 mmol/L HEPES pH 7.4. After stimulation with TNF , the cells
were placed in a Becton Dickinson FACScan flow cytometer
(excitation 485 nm; emission 530 nm; Becton Dickinson, Franklin Lakes,
NJ) to quantitate oxidation into fluorescent DCF (an indicator of the
intracellular ROS production20). A minimum of 10,000 cells was analyzed and the results expressed as fluorescence mean ± standard deviation (SD) of n = 3 independent experiments.
IL-8 enzyme-linked immunosorbent assay (ELISA).
Immunoreactive IL-8 was quantitated in cell culture
supernatants by a double-antibody ELISA kit using recombinant IL-8 as a
standard (R&D Systems, Minneapolis, MN) following the manufacturer's protocol. This assay has a sensitivity of detection of 200 pg/mL.
Northern blot analysis.
Total RNA was extracted from control, TNF -treated, or
antioxidant plus TNF -treated cells by the RNAzol kit (Teltest,
Friendswood, TX) and RNA abundance quantitated spectrophotometrically.
Twenty micrograms of RNA was fractionated on a 1.2%
agarose-formaldehyde gel and transferred to nylon-reinforced
nitrocellulose membrane (MSI, Westboro, MA). The RNA was then
hybridized using polymerase chain reaction (PCR)-generated
body-labeled cDNA probe for IL-8,7 followed by an 18S
rRNA-cDNA probe using previously reported conditions.21 Blots were washed in 5% SDS, 1 × sodium chloride sodium citrate (SSC) buffer at 50°C 3 times, 15 minutes each, and
quantitated by exposure to a Molecular Dynamics (Sunnyvale,
CA) Phosphorimager cassette. After quantitation, the blots
were exposed to a Kodak XAR5 film (Rochester, NY).
Plasmid construction and transient transfections.
5' deletion constructs of the human IL-8 (hIL-8)
promoter2` were produced using the PCR with -1498/+44
hIL-8/Luc reporter plasmid8 as a template and a downstream
oligonucleotide hybridizing +86 to +557 of the luciferase
(LUC) cDNA.22 Upstream primers were used to produce
5' deletions at nucleotide -162, -132, -99, and -54 by
incorporating a unique Bam H1 restriction site immediately upstream.
The PCR products were restricted with Bam H1 and Hind III, gel
purified, and subcloned into the poLUC reporter vector.22 Site-directed mutagenesis of the NF- B site in the context of -162/+44 hIL-8 were introduced using the technique of PCR
"SOEING"8 with the mutagenic primers (mutations
underlined):
5'-TTCATTATGTCAGA AAATT CGATTT-3' and
5'-TTGCAAATCG AATTT TCTGACAATA-3'.
For the NF-IL-6 binding site-mutation, the primers
5'-GCCATCAG T C A TCGTGGAATTTCCTCTGA-3' and
5'-GAAATTCCACGA T G A CTGATGGCCCATCC-3'
were used. For the activator protein (AP)-1 binding site
mutation, the primers
5'-GAGTGTGAT CTCAGGTTTGCCCTGA-3' and
5'-CAAACCTGAG ATCACACTTCCTA-3' were used.
Multimeric binding sites were constructed by ligation of 3 copies of
the NF- B 5'-GATCCATCAGCTACGAGTCGTGGAATTTCCTCTA-3', AP-1 5'-GATCCGAGTGTGATGACTCAGGTTTGCCCTTTA-3' and
NF-IL-6 5'-GATCCATCAGTTGCAAATCGTTTAATTTCCTCTA-3' DNA
sequences (having previously annealed them to complementary overlapping
oligonucleotides) upstream of the -54 hIL-8/LUC promoter. Plasmids for
use in transfection were purified by ion exchange (Qiagen, Chatsworth,
CA) and sequenced to verify authenticity.
Transient transfections were performed in 107
logarithmically growing U937 cells using a mixture of 60 µg
diethylaminoethyl-dextran with 45 µg of hIL-8/LUC reporter and 9 µg
of SV40/alkaline phosphatase-internal control plasmid. After 20 minutes
at room temperature, the cells were centrifuged (at 300xg),
resuspended in fresh culture medium, and distributed into 9 60-mm
plates, and returned to the incubator. Cells were treated 16 hours
after transfection. Six hours after treatment, cells were harvested,
cytoplasmic lysates prepared, and luciferase activity
measured.8 As an internal control for transfection
efficiency, alkaline phosphatase activity was measured in 50 µg cell
lysate by the dephosphorylation of alkaline phosphatase substrate
(Sigma) in DEA buffer (1 mol/L Diethanolamine, pH 9.85, 0.28 mol/L
NaCl, 0.5 mol/L MgCl2). Fold induction of reporter activity
(by treatment with TNF ) was calculated by division of the mean
normalized luciferase activity from 3 treated cultures, by the mean
normalized luciferase activity from 3 untreated cultures.
Electrophoretic mobility shift assays (EMSAs)
and microaffinity purification.
Sucrose-cushion purified nuclear extracts (NE) of U937 cells
were prepared using hypotonic/nonionic detergent lysis as described previously.7,23 After extraction, nuclear protein was
normalized by protein assay and used to bind to duplex oligonucleotides
corresponding to -96 to -69 bp of hIL-8 promoter shown below
(underlines indicate site mutations that disrupt NF- B
binding).NF- B: GATCCATCAGTTGCAAATCGTGGAATTTCCTCTA GTAGTCAACGTTTAGCACCTTAAAGGAGATCTAG
NF- B
mut:
GATCCATCAGTTGCAAATCGT AATTT TCTA GTAGTCAACGTTTAGCA TTAAA AGATCTAG
EMSAs included 10 µg of nuclear protein, 1.5 µg of
polydeoxyadenylic-thymidylic acid (dA/dT), and 30,000 cpm
32P-labeled double-stranded IL-8 probe. For competition
50-fold molar excess of unlabeled competitor was included in the
initial binding reaction. Antibody interference assays were as
described for the supershift.8
Microaffinity purification of proteins binding to NF- B wild-type
(WT) was performed using a 2-step biotinylated DNA-streptavidin capture
assay.7 In this assay, duplex NF- B WT oligonucleotides were chemically synthesized containing 5' biotin (Bt) on a
flexible linker (Genosys, The Woodlands, TX). Identical amounts of
nuclear protein from control and hormone-stimulated extracts were
incubated with 50 pmoles Bt-NF- B WT DNA in the presence of 8 µg
poly dA/dT (as nonspecific competitor) in 800 µL (final volume) of
binding buffer (8% [vol/vol] glycerol, 5 mmol/L MgCl2, 1 mmol/L dithiothreitol [DTT], 60 mmol/L KCl, 1 mmol/L
EDTA, 12 mmol/L HEPES, pH 7.8) at 4°C for 1 hour. A total of 100 µL of a 50% slurry of prewashed streptavidin-agarose beads was then
added to the sample and incubated at 4°C for an additional 20 minutes with shaking. Pellets were washed twice with 500 µL binding
buffer and then resuspended in 100 µL 1X sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) buffer for
analysis by Western immunoblot.
Western immunoblot.
Proteins were fractionated by SDS-PAGE and transferred onto
polyvinylene difluoride membranes as described.23,24
Affinity-purified rabbit polyclonal antibodies to Rel A and I B
were obtained commercially (Santa Cruz Biotechnology, Santa Cruz, CA).
Mouse monoclonal antibody to -Actin was from Sigma. Secondary
detection was using horseradish peroxidase-coupled donkey antirabbit or
goat antimouse antibody in the ECL enhanced chemiluminescence assay
(Amersham Life Sciences Arlington Heights, IL) as
described.8,23
Statistical analysis.
Data from experiments involving multiple samples subject to each
treatment were analyzed by the Student Newman Keuls t-test for multiple
pairwise comparisons.
 |
RESULTS |
Induction of the IL-8 gene expression by TNF .
The mechanism for TNF -induced IL-8 expression was studied in U937
histiocytic lymphoma cells. First, U937 cells were stimulated by
maximal doses of TNF and changes in IL-8 mRNA detected by Northern
blot assay at various times of stimulation
(Fig 1A). TNF induced the rapid
appearance of a 1.8-kb transcript, detectable at 10-fold (relative to
control) with 30 minutes and peaked at a 50-fold induction between
60 to 180 minutes. At later times, IL-8 expression began to fall,
indicating the effect of TNF was rapid, but transient (not shown).
The dose-response relationship of IL-8 mRNA was next investigated. At
TNF concentrations between 0.0064 ng/mL to 0.8 ng/mL, IL-8 gene
expression was strongly induced in a dose-dependent manner (Fig 1B).
Further increasing the dose of TNF produced a flat dose-response
curve (not shown), indicating receptor saturation. To determine whether
IL-8 was secreted in parallel to the changes in IL-8 gene expression,
IL-8 protein was assayed in U937 cell culture supernatants (Fig 1C).
Although a 3-fold increase in IL-8 could be detected after 2 hours of TNF , significant secretion of the protein was maximal at 16 hours. The delay relative to mRNA accumulation presumably reflects the time required for mRNA translation and protein secretion.



View larger version (64K):
[in this window]
[in a new window]
| Fig 1.
TNF inducible IL-8 expression in the U937 monocytic
cell line. (A) TNF rapidly induces IL-8 mRNA abundance. U937 cells
were untreated (control) or stimulated with 20 ng/mL TNF for the
indicated times (in minutes, at top). Total RNA was extracted and
analyzed by Northern analysis by hybridization with a hIL-8 cDNA probe
(top) and an 18S cDNA probe (bottom) as an internal control. Shown is a
representative Northern blot. Relative to control, IL-8 increases
10-fold (30 minutes), 37-fold (45 minutes), and 56-fold (60 minutes).
This experiment was reproduced 2 times with similar results. (B) TNF
induces a dose-dependent increase in IL-8 mRNA abundance. Cells
unstimulated/stimulated with the indicated doses (in ng/mL) TNF for
1 hour were lysed and the total RNA subject to Northern analysis by
hybridization with a hIL-8 cDNA probe (top) and an 18S cDNA probe
(bottom) as an internal control. Relative to control, 0.0064 ng/mL
TNF increased normalized IL-8 signal by 2-fold, 0.032 ng/mL TNF
increased IL-8 signal by 7-fold, 0.16 ng/mL TNF increased IL-8
signal by 21-fold; 0.8 ng/mL increased IL-8 signal by 38-fold. This
experiment was reproduced 2 times with similar results. (C) TNF
induces a time-dependent increase in IL-8 protein secretion. Duplicate
cultures were untreated (control) or stimulated with 20 ng/mL TNF .
At indicated times, cell culture supernatants were harvested and
immunoreactive IL-8 determined by ELISA. Shown is the mean ± SD of n
= 2 independent experiments. TNF increases IL-8 secretion by
2.4-fold at 2 hours and 10-fold by 16 hours. Basal secretion is 500 pg/mL and unchanged any time of this experiment (P < .0001 for unstimulated v stimulated).
|
|
To test whether transcription was a component of IL-8 gene induction by
TNF , the reporter gene luciferase under the control of various
lengths of IL-8 promoter7 was transfected into U937 cells.
TNF stimulation resulted in a strong induction of the native -1498
nucleotide (nt) IL-8 promoter-mediated luciferase activity
(Fig 2A). 5' deletion
from -1498 to -162 nt resulted in no significant change in either
basal or inducible luciferase activity. However, deletion from-162 to
-99 nt reduced the basal and fold induction by approximately 2-fold
(47-fold became 19-fold). Stimulation of -54 hIL-8/LUC showed it to be
completely inert to TNF . These data indicate that TNF induction
of the IL-8 promoter requires 2 domains, the first between -162 to
-99 and the second between -99 to -54 for full inducibility.



View larger version (56K):
[in this window]
[in a new window]
| Fig 2.
Identification of TNF -inducible IL-8
cis elements in U937 cells. (A) 5'-deletions of the human IL-8
promoter/Luciferase reporter (hIL-8/LUC) were transfected into U937
cells. Sixteen hours later, cells were stimulated with 20 ng/mL TNF
for 6 hours before luciferase assay. Shown is the normalized Luciferase
activity from a representative transfection plotted on a
semilogarithmic graph. Above the TNF -stimulated bar is the fold
activation of the Luciferase activity by TNF (fold: activity of
stimulated divided by activity of unstimulated). (B) Site mutations of
NF- B, NF-IL6, and AP-1 sites in the context of the -162hIL-8/LUC
were analyzed for their inducibility by TNF . Shown is the normalized
Luciferase activity in a representative transfection (mean ± SD,
P < .0001 for all comparisons of unstimulated v
stimulated, except NF- B). (C) Multimers of NF- B, NF-IL6, and
AP-1 sites ligated upstream of an inert hIL-8 TATA box were analyzed
for their inducibility by TNF . As a positive control, the AP-1
multimer was treated for 6 hours with 1 µmol/L phorbol myristyl
acetate (PMA). Shown is the normalized Luciferase activity from a
representative transfection. TNF stimulated the NF- B multimer,
and PMA stimulated the AP-1 multimer (P < .0001 for
comparisons of unstimulated v stimulated).
|
|
The IL-8 gene promoter contains 3 binding sites for known transcription
factors: (1) AP-1, a protein binding between -127 and -119 nt; (2)
NF-IL6, a protein that binds between -94 and -81 nt; and (3) NF- B,
a protein that binds between -80 and -70 nt.10 We next
tested the individual role for each of these sites by producing
site-directed mutations in the context of the -162 hIL-8 promoter. As
shown in Fig 2B, mutation of the NF- B site completely abolished
TNF -inducible transcription. Mutation of the AP-1 site reduced
induction by 2-fold (from 45-fold to 20-fold), whereas mutation of
the NF-IL6 site was silent. These data indicate that although the AP-1
site participates in basal and TNF -inducible activity of the IL-8
promoter, only the NF- B site is absolutely required. To determine
whether these sites are independently TNF -inducible, reporter genes
containing multimers of either the AP-1, NF- B, or NF-IL6 elements
ligated upstream of an inert TATA box were transfected into U937 and
stimulated with TNF (Fig 2C). The NF- B multimer was 32-fold
inducible by TNF, whereas other sites were not significantly
TNF-inducible. Although the AP-1 site was not TNF -inducible, it was
strongly induced by the diacylglycerol agonist, phorbol 12-myristate
13-acetate. We conclude that the NF- B site is the only
TNF -inducible promoter element in the IL-8 promoter, whose presence
is both necessary and sufficient for the TNF transcription.
TNF induces NF- B binding and
I B proteolysis.
One mechanism for NF- B activation is enhanced nuclear DNA binding of
the Rel A transactivator subunit. To verify this mechanism, sucrose
cushion-purified nuclear extracts from TNF -stimulated U937 cells
were assayed for NF- B binding in EMSA
(Fig 3A). In control
extracts, a constitutive binding activity (C3) was observed. Within 5 minutes stimulation, 2 additional closely comigrating complexes (C1 and
C2) were induced to bind that apparently peaked at 30 minutes. Sequence
specificity of C1, 2, and 3 complexes is seen by ability of 50-fold
molar excess of unlabeled wild-type, but not site mutation, of the
NF- B contact points23 to compete for their binding (Fig
3A). Inducible complexes C1 and C2 contain the Rel A transactivating
subunit as indicated by ability of Rel A antibody, but not preimmune
sera, to selectively attenuate their binding (Fig 3B).



View larger version (148K):
[in this window]
[in a new window]
| Fig 3.
TNF induces NF- B binding and I B
proteolysis. (A) TNF rapidly induces nuclear NF- B Rel A DNA
binding. U937 cells unstimulated or stimulated with 20 ng/mL TNF for
the indicated times (at top). Cells were lysed, the nuclei were
isolated, and subjected to EMSA analysis with a radiolabeled IL-8
NF- B site. The bound complexes (C1-C3) are indicated. Unlabeled
duplex wild-type (wt) or mutant NF- B ( ) competitors were
included where indicated. (B) Antibody interference. EMSA of
TNF-stimulated nuclear extract was prepared. Either normal rabbit serum
(NRS), anti-p50, or anti-Rel A antibodies were preincubated for 1 hour
before the assay as indicated. Asterix is a faint supershifted band. C1
and C2 are completely attenuated by the Rel A antibody. Bottom: lighter
exposure. C3, C2, and C1 are attenuated by the p50 antibody. (C) TNF
induces time-dependent proteolysis of the I B protein. Cells
unstimulated/stimulated with 20 ng/mL TNF for the indicated times
(top) were lysed and the cytosols were prepared. Top panel, Western
immunoblot with anti-I B antibody; bottom panel, Western
immunoblot with an anti- -actin antibody (internal control).
|
|
We and others have shown that Rel A is tethered in the cytoplasm by
association with I B inhibitor, which must be degraded to release
Rel A into the nucleus.23,25,26 Western immunoblot of
cytoplasmic extracts from control and treated U937 cells was performed
to determine changes in steady state I B protein (Fig 3C). TNF
induced a rapid proteolysis of I B at 5 minutes, followed by its
reappearance (due to resynthesis) at 60 minutes. This data indicates
NF- B is activated by TNF in a conventional pathway requiring
I B proteolysis.
TNF induces ROS formation.
The precise role of ROS in TNF signaling is
controversial.17 Because extracellular oxidants can
activate NF- B binding in some cell lines and high concentrations of
antioxidants block TNF -induced NF- B activation, NF- B is
considered to be an ROS-responsive transcription
factor.17,25,27,28 It is, however, unclear whether these
pharmacological studies are relevant to hormone-induced cell signaling.
To determine whether TNF -induced ROS in U937, we monitored ROS
formation by oxidation of DCF, a standard indicator of intracellular
oxidation.20 TNF stimulation induced a highly reproducible and significant change in DCF fluorescence, first detectable between 5 and 8 minutes (Fig 4).
The plateau in ROS formation was transient, peaking at 2-fold increase
in mean fluorescence intensity at 15 minutes, and declined thereafter,
even in the continuous presence of hormone. Various concentrations of
antioxidants were used in preliminary studies to identify the smallest
concentrations that could suppress TNF -induced DCF fluorescence (not
shown). We found that 2% (vol/vol) DMSO, 4 mmol/L vitamin C, and 7.5 mmol/L NAC were sufficient to significantly block the inducible ROS
formation in U937 cells (Fig 4).

View larger version (21K):
[in this window]
[in a new window]
| Fig 4.
TNF induces intracellular oxidation in U937.
DCF-DA-loaded cell cultures were left untreated or stimulated with 20 ng/mL TNF in the absense or presence of pretreatment with
antioxidant (2% [vol/vol] DMSO, 7.5 mmol/L NAC, or 4 mmol/L vitamin
C; determined to be effective concentrations in preliminary
experiments). Mean fluorescence intensity, each point representing
104 cells, is plotted as a function of time. The error bars
represent SD from 3 independent experiments. Statistical analysis of
the TNF -only stimulated cells (at 12, 15, and 18 minutes) versus
unstimulated or versus TNF plus antioxidant, yields P < .0001.
|
|
Antioxidants block IL-8 gene expression.
Identification of the minimum effective dose of antioxidants enabled us
to test whether TNF stimulation of IL-8 gene expression is mediated
by ROS. To determine whether antioxidants interfere with TNF -induced
IL-8 expression, IL-8 protein secretion from DMSO-pretreated cells was
measured by ELISA. The presence of 2% DMSO significantly interfered
with over 90% of inducible IL-8 secretion without affecting cell
viability or cell number (Fig 5A).



View larger version (52K):
[in this window]
[in a new window]
| Fig 5.
TNF stimulation of IL-8 is dependent on
intracellular oxidation. (A) Inducible IL-8 protein secretion is
sensitive to DMSO. Triplicate cultures of U937 cultures were untreated
(control) or stimulated with 20 ng/mL TNF in the absence or presence
of 2% (vol/vol) DMSO. At indicated times, cell culture supernatants
were harvested and immunoreactive IL-8 determined by ELISA. Shown is
the mean ± SD of n = 3 independent experiments (for both time
points shown, P < .0001 for nonpretreated v
pretreated with 2% (vol/vol) DMSO). (B) DMSO causes a dose-dependent
inhibition of TNF -inducible IL-8 mRNA. Cells were
unstimulated/stimulated with 20 ng/mL TNF (1 hour) in the
absense/presence of DMSO of indicated concentrations (vol/vol). Cells
were lysed and the total RNA subject to Northern analysis by
hybridization with a hIL-8 cDNA probe (top) and an 18S cDNA probe
(bottom) as an internal control. (C) DMSO causes a dose-dependent
inhibition of TNF -inducible IL-8 promoter activity. Triplicate cell
cultures were transfected with the -162 IL-8/LUC reporter plasmid and
an SV40/alkaline phosphatase plasmid as an internal control. Cells were
unstimulated/stimulated with 20 ng/mL TNF in the absence or presence
of indicated concentrations of DMSO (in % [vol/vol]). Fold-induction
of the Luciferase activity of stimulated (calculated from unstimulated)
cells is shown (P < .0001 for stimulated v pretreated
with 2% (vol/vol) DMSO before stimulation.
|
|
Northern blot analysis to assay changes in endogenous IL-8 expression
was next performed in U937 cells stimulated in the presence of
increasing concentrations of DMSO. Compared with TNF alone, treatment with 0.4% DMSO inhibited IL-8 mRNA induction by 35% and
treatment with 2% DMSO inhibited IL-8 induction by 85% (Fig 5B). This
apparently was not a nonspecific effect because steady state levels of
18S RNA and total cell number were unchanged (not shown).
To determine whether the antioxidant effect influenced IL-8 gene
expression at the transcriptional level, the same experiment was
conducted in U937 cells transiently transfected with the -162 hIL-8/LUC reporter gene. A similar inhibition was seen; treatment with
0.4% DMSO inhibited TNF -inducible IL-8 induction by 40%, and
treatment with 2% DMSO inhibited IL-8 induction by 90% (Fig 5C).
These data indicate the antioxidant effect occurs by interference of
TNF -inducible transcription.
Identification of antioxidant sensitive site on the IL-8 promoter.
The effect of DMSO on transcription could be through interference of
the AP-1 or NF- B activities. Transient transfections of hIL-8/LUC
5' deletions were next tested to localize the DMSO effect. All of
the 5' deletions that were TNF inducible, including the -99
hIL-8/LUC (that contains only the NF- B site), were potently inhibited by DMSO (over 90%) and therefore antioxidant sensitive (Fig 6A). Site mutations of
NF- B, AP-1, and NF-IL6 were similarly tested (Fig 6B). All mutations
containing the NF- B site were inhibited more than 80%, while
mutation at the NF- B site abolished both inducibility by TNF and
sensitivity to DMSO. Finally, multimers of each element were tested
(Fig 6C). No significant inhibition of reporter gene activity driven by
NF-IL6 or AP-1 was seen; only the NF- B site was inhibited by
treatment with 2% DMSO (90% inhibition). Taken together, these data
indicate antioxidant effect is predominantly mediated by interference
with NF- B transcriptional activity.



View larger version (41K):
[in this window]
[in a new window]
| Fig 6.
Antioxidant effect maps to the NF- B element.
(A) Serial 5' deletions of the IL-8 promoter analyzed for their
DMSO-sensitivity. Triplicate cell cultures were transfected with the
indicated IL-8/LUC reporter plasmids and an SV40/alkaline phosphatase
plasmid as an internal control. Cells were unstimulated/stimulated with
20 ng/mL TNF in the absence or presence of 2% (vol/vol) DMSO.
Fold-induction of the Luciferase activity of stimulated cells is shown
(P < .0001 for -99, -162, -1498: nonpretreated v
pretreated with 2% (vol/vol) DMSO). (B) DMSO-sensitivity of IL-8
promoter point mutations. Triplicate cell cultures were transfected
with the indicated IL-8/LUC reporter plasmids and an SV40/alkaline
phosphatase plasmid as an internal control. Cells were
unstimulated/stimulated with 20 ng/mL TNF in the absence/presence of
2% (vol/vol) DMSO. Fold-induction of the Luciferase activity of
stimulated cells is shown (P < .0001 for nonpretreated
v DMSO-pretreated, except NF- B). (C) DMSO effects on IL-8
multimers. Multimers of NF- B, NF-IL6, and AP-1 sites ligated
upstream of an inert hIL-8 TATA box were analyzed for their DMSO
sensitivity. Triplicate cell cultures were transfected with the
indicated IL-8/LUC reporter plasmids and a SV40/alkaline phosphatase
plasmid as an internal control. Cells were untreated or stimulated with
20 ng/mL TNF in the absence or presence of 2% (vol/vol) DMSO.
Fold-induction of stimulated Luciferase activity is shown (for NF- B
multimer nonpretreated v DMSO-pretreated, P < .0001).
|
|
We tested whether TNF -inducible proteolysis of I B is affected
by antioxidant concentrations effective in our experiments. Western
immunoblots were performed to measure changes in I B abundance in
DMSO-pretreated cells at various doses of TNF
(Fig 7A). Surprisingly,
I B was rapidly proteolyzed equivalently in the DMSO-pretreated
cells. This indicated that DMSO effect was apparently not mediated by
influencing NF- B translocation. To further show this, sucrose
cushion-purified nuclear extracts were assayed for steady state changes
in Rel A by Western immunoblot assay (Fig 7B). Untreated nuclei contain
very low levels of Rel A, whereas nuclear Rel A abundance is strongly
induced after TNF -treatment; these data indicate pretreatment with
2% DMSO does not change nuclear Rel A abundance.





View larger version (91K):
[in this window]
[in a new window]
| Fig 7.
DMSO effect is independent of NF- B binding and
translocation. (A) Two percent (vol/vol) DMSO pretreatment has no
effect on I B proteolysis. Cells were stimulated with the
indicated concentrations of TNF , in the absence or presence of 1 hour pretreatment with 2% (vol/vol) DMSO. Top panel, Western
immunoblot with anti-I B antibody; bottom panel, Western
immunoblot with an anti- -actin antibody (internal control). (B) Two
percent (vol/vol) DMSO pretreatment has no effect on Rel A nuclear
translocation. Cells were stimulated with 20 ng/mL TNF , in the
absence or presence of 1 hour pretreatment with 2% (vol/vol) DMSO.
Nuclei were purified over sucrose cushion and tested by Western
immunoblot with anti-Rel A antibody. Sixty-five kD Rel A is strongly
induced by TNF in the absence or presence of DMSO. A nonspecific
band serves here as an internal control for protein loading (control).
(C) Effect of TNF on NF- B binding in the presence of DMSO. Cells
were stimulated with increasing concentrations of TNF (indicated at
top), in the absence or presence of 1 hour pretreatment with 2%
(vol/vol) DMSO. Shown is EMSA analysis of nuclear extracts for binding
to radiolabeled NF- B. C1/C2 binding increases proportionally with
TNF dose. 0.032 ng/mL TNF yields a 7-fold weaker signal than 20 ng/mL (360,351 v 2,645,248 arbitrary units [a.u.]). In
contrast, 2% (vol/vol) DMSO pretreatment does not reduce NF- B
binding (2,691,962 a.u.). For nuclear extracts, stimulated with 20 ng/mL TNF , various concentrations of protein were used to determine
assay linearity with protein input (compare lanes 7, 6, and 4). (D) DMSO inhibits IL-8 promoter induction
independently of TNF -induced changes in NF- B Rel A DNA binding.
Luciferase induction of the IL-8 promoter by the indicated amounts of
TNF . Triplicate cell cultures were transfected with the -162
IL-8/LUC reporter plasmid and an SV40/alkaline phosphatase plasmid as
an internal control. Cells were unstimulated/stimulated with the
indicated doses (in ng/mL) TNF . The fold-induction of Luciferase
activity of stimulated cells is shown (P < .005 for all
pairwise comparisons). 0.032 ng/mL TNF activates the
NF- B-dependent promoter 7-fold weaker than 20 ng/mL. Two percent
(vol/vol) DMSO pretreatment reduces TNF -inducible promoter activity
by 8-fold. (E) Abundance of TNF -inducible NF- B Rel A binding is
not changed by pretreatment with promoter-inhibitory doses of DMSO.
Cells unstimulated/stimulated with 20 ng/mL TNF for 15 minutes in
the absence or presence of 2% (vol/vol) DMSO. After treatment, nuclear
extracts were analyzed for NF- B binding by microaffinity isolation.
Shown is the Western immunoblot with rabbit antihuman Rel A polyclonal
antibody (NS, nonspecific).
|
|
Activation of NF- B DNA binding activity has been reported to be
antioxidant-sensitive in some cell systems.17,25,27,28 To
determine whether DMSO treatment interfered with Rel A binding, sucrose
cushion purified nuclear extracts were analyzed by EMSA (Fig 7C). Under
EMSA conditions shown, a linear relationship was observed between
TNF dose (up to 20 ng/mL) and C1/C2 binding (cf, lanes 1 to 4).
Also, a linear relationship of C1/C2 binding was observed as a function
of input nuclear proteins (cf, lanes 7, 6, and 4). However,
pretreatment with DMSO had no detectable influence on the magnitude of
inducible NF- B DNA binding.
These data indicate that DMSO influenced NF- B-dependent
transcription without influencing its DNA binding. To verify this surprising result, transfection studies were conducted to determine the
transcriptional dose-response relationship (as for the DNA binding
experiment in Fig 7C). As shown in Fig 7D, 2% DMSO inhibited the
transcriptional induction of IL-8 by 90%, to a level produced by 0.032 ng/mL TNF . However, the amount of NF- B binding activity in the
presence of 2% DMSO is not reduced accordingly (cf, Fig 7C),
indicating the transcriptional inhibition is mechanistically separate
from inhibition of DNA binding. To further exclude the potential
possibility that DMSO interfered with selective recruitment of Rel A
transactivator on the NF- B site that might not be detected in EMSA,
we performed a 2-step microaffinity isolation/Western immunoblot. In
this assay, biotinylated NF- B binding site is used to pull down
NF- B proteins that are subsequently detected by Western. We have
previously shown that this assay detects NF- B members in a
sequence-specific fashion.7 As shown in Fig 7E, TNF
strongly induces 65-kD Rel A binding; the abundance of Rel A is not
influenced by pretreatment with 2% DMSO. These data indicate the
antioxidant DMSO selectively blocks TNF -inducible NF- B
transcription without affecting I B proteolysis, Rel A
translocation, or NF- B binding activity.
Antioxidant inhibition of IL-8 expression occurs after
I B proteolysis.
After TNF treatment, I B proteolysis was complete within 5 minutes (Fig 3C), whereas ROS production was delayed 8 to 15 minutes
(Fig 4). This suggests that temporally, the requirement for ROS
production in NF- B-activated IL-8 transcription may be after
NF- B translocates. If so, posttreatment with DMSO (relative to TNF
stimulation) would still interfere with IL-8 gene expression. U937
cells were pre or posttreated with 2% DMSO relative to a 1-hour
stimulation with TNF . IL-8 gene expression was quantitated by
Northern blot (Fig 8A). We found that
delaying DMSO treatment up to 15 minutes after TNF stimulation
produced a similar, significant inhibition of IL-8 mRNA induction.
Again, the DMSO effect was independent of I B proteolysis (Fig 8B)
or changes in NF- B DNA binding (Fig 8C). These data strongly argue
that the antioxidant sensitive pathway is separate and distinct from
NF- B translocation.



View larger version (93K):
[in this window]
[in a new window]
| Fig 8.
Antioxidant effect at times subsequent to I B
proteolysis. (A) Effect of posttreatment on TNF -inducible IL-8 mRNA
accumulation. Cells were unstimulated or stimulated with 20 ng/mL
TNF in the absence or presence of 2% (vol/vol) DMSO. DMSO was
administered at the indicated times (before [-] or after [+]
TNF administration). (B) Posttreatment with 2% (vol/vol) DMSO has
no effect on I B proteolysis. Cells were unstimulated or
stimulated with 20 ng/mL TNF in the absence or presence of 2%
(vol/vol) DMSO. DMSO was administered at the indicated times (preceding
[-] or succeeding [+] TNF administration). Top panel, Western
immunoblot with anti-I B antibody; bottom panel, Western
immunoblot with an anti- -actin antibody (internal control). (C) Pre
or posttreatment with 2% (vol/vol) DMSO has no effect on Rel A DNA
binding in EMSA. Cells were unstimulated/stimulated with 20 ng/mL
TNF in the absence or presence of 2% (vol/vol) DMSO. DMSO was
administered at the indicated times (before [-] or after [+]
TNF administration). Nuclei were isolated and subjected to EMSA
analysis with a radiolabeled NF- B site. Only bound complexes are
shown.
|
|
Antioxidants NAC and vitamin C also selectively affect
NF- B transcription.
To exclude nonspecific effects of DMSO, other chemically unrelated
antioxidants NAC and vitamin C were tested for ability to interfere
with TNF -inducible NF- B transcriptional activity. Transient
transfection assays using the NF- B multimer /LUC reporter indicated
that doses of antioxidants at concentrations that block ROS formation
(7.5 mmol/L NAC, 4 mmol/L vitamin C, see Fig 4) similarly significantly
block NF- B-dependent transcription (60% by NAC, 85% by vitamin
C). These antioxidant effects are independent from changes in NF- B
binding as measured in EMSA (not shown). Taken together, these data
indicate the requirement of an ROS-dependent activation pathway of
NF- B that is distinct from the nuclear translocation pathway
responsible for inducible DNA-binding.
 |
DISCUSSION |
In a variety of pathophysiological states initiated by infectious or
inflammatory agents, TNF secretion is responsible for activating the
cytokine cascade required for appropriate cellular responses in the
target tissue. An important cellular target of TNF is the
circulating monocyte, wherein TNF induces a program of phenotypic
changes required for phagocytosis and by inducing the secretion of
other inflammatory mediators, allowing for the recruitment of
neutrophils into the target tissue. Specifically, production of IL-8
allows for the activation, demargination, and chemotaxis of neutrophils
into the inflamed tissue. This study provides additional mechanistic
information to the observations of others where TNF has been shown
to induce IL-8 secretion in whole blood, the majority of which is
derived from monocytes.2
We observe here that TNF activates IL-8 expression through the
participation of 2 regulatory factors. Although both AP-1 and NF- B
are required for maximal IL-8 gene expression, only NF- B is truly
TNF inducible. In unstimulated cells, NF- B is maintained in an
inactive state in the cytoplasm through association with the I B
inhibitors. Dissociation of Rel A from I B is a prerequisite for Rel
A cytoplasmic-to-nuclear translocation.29,30 This is accomplished through a 2-step mechanism, where first the I B inhibitor is phosphorylated at serine residues 32 and 36 by the ubiquitous I B kinase, IKK,31 and second the
phospho-I B is polyubiquitinated and proteolyzed through the 26S
proteasome.32 Our data shows that I B proteolysis is a
consequence of TNF stimulation in U937 cells and occurs
coincidentally with Rel A translocation. The Rel A NF- B subunit is
the major TNF -inducible transactivator of the IL-8 promoter in a
variety of cell types, including epithelial,7
fibrosarcoma,10 and histiocytic cells (this study).
Consistent with these findings, in U937 cells, our antibody
interference assays indicate that Rel A is largely responsible for the
strongly inducible C1 and C2 complexes (Fig 3A), and microaffinity isolation/Western immunoblot assays indicate Rel A binding is strongly
induced after TNF treatment (Fig 7E).
Although Rel A translocation has been thought to be necessary and
sufficient for transcriptional activation of IL-8, our observations show that pretreatment with antioxidants dissociates the 2 processes (of translocation and transcriptional activation). Our conclusions are
based on the lack of antioxidant effect on inducible changes in steady
state Rel A abundance in the nuclear compartment (by Western blot) and
the measurement of Rel A binding in microaffinity capture and EMSA
assays (Fig 7). It is important to highlight that changes in Rel A
binding detected by EMSA correlate linearly with NF- B transcription
over the TNF dose-response curve (Fig 7). In this experiment, 0.032 ng/mL TNF activates the NF- B-dependent promoter 7-fold weaker
than 20 ng/mL and yields a corresponding 7-fold weaker signal in EMSA
analysis. In sharp contrast, 2% (vol/vol)-DMSO pretreatment reduces
TNF -inducible promoter activity by 8-fold; this would be expected to
reduce NF- B binding by a similar extent (7-fold to 8-fold). However,
because no such reduction in NF- B is observed, we interpret the
antioxidant effect is clearly independent of changes in Rel A DNA
binding activity.
Our study indicates that ROS production is a necessary prerequisite for
IL-8 production by TNF through a requirement for the transcriptional
function of NF- B. TNF induces ROS production in numerous
independent assays, including depletion of antioxidant pools,33 elicitation of Electron Paramagnetic
Resonance-detectable 2,2,6,6,-tetramethyl-1-piperidine-n-oxyl
decay,34 by 5',5'-dimethylpyrroline-N-oxide spin
trapping,35 thiobarbituric acid-detectable lipid
peroxidation,36 and DCF oxidation (this study).
Importantly, our data indicates that TNF induces I B
proteolysis and ROS production in U937 cells with discrete kinetics. In
these cells, I B proteolysis, Rel A translocation, and NF- B
binding occur unmeasurably rapidly (within 5 minutes); however, the
kinetics of ROS production are delayed, being first detectable at 8 minutes, with a peak 15 minutes after stimulation. Although this
apparent delay may be the consequence of the kinetics of DCF
oxidation, this explanation is unlikely for 2 reasons. First, DCF
oxidation indicates within seconds an immediate and steep increase in
oxidant levels in response to H202-treatment
(data not shown and Bass et al20), which shows that the
oxidation lag in response to TNF is not a detection artifact.
Second, addition of antioxidant (up to) 15 minutes after TNF
administration still blocks inducible IL-8 transcription (Fig 8).
These observations strongly argue that the ROS transcriptional activation pathway is distinct (temporally and mechanistically) from
that involved in NF- B translocation.
Although it is widely appreciated that the transcription factor,
NF- B, is activated by pharmacologic doses of oxidants,37 the administration of extracellular oxidants may not faithfully reproduce the kinetics, magnitude, or subcellular compartmentalization of ROS produced as a consequence of hormone receptor activation. For
example, addition of extracellular H202 to
Jurkat T cells, HeLa cervical carcinoma, L6 skeletal muscle, and other
cells is sufficient to induce NF- B translocation.17,37
However, the degree of intracellular oxidation required for NF- B
translocation by extracellular H202 is at least
an order of magnitude more than that produced by TNF (data not
shown; Schmid et al38); these results, therefore, are of
uncertain relevance to hormone-induced signaling.
Conversely, other studies have shown that antioxidants inhibit
inducible NF- B binding. In murine macrophage cells, 1% DMSO inhibits lipopolysaccharide (LPS)-induced NF- B
translocation.39 In another study, almost complete
inhibition of TNF -induced Rel A translocation was produced with 10 mmol/L NAC in synovial fibroblasts.40 Previously reported
studies of antioxidant inhibition of stimulus-dependent NF- B
translocation have been conducted using 20 mmol/L NAC (or higher) and
100 µmol/L pyrrolidine dithiocarbamate.17,25,27 In these
studies, antioxidant pretreatment dramatically decreased PMA-,
TNF -or H2O2-induced NF- B binding in
several cell types, including Jurkat T cells, Ltk-mouse
fibroblasts, 70Z/3 mouse pre B cells. The antioxidant effect on NF- B
translocation, therefore, appears to be cell-type-dependent and
stimulus-dependent.
As a specific example, NAC concentrations that inhibited
TNF -induced NF- B binding in Jurkat T cells fail to inhibit it in endothelial cells.36 Also, although IL-1 caused ROS
formation and antioxidant-sensitive NF- B translocation in 70Z/3
lymphoid cells, in ovarian carcinoma (OVCAR-3) epithelial
cells, IL-1 failed to cause detectable ROS formation and activates
NF- B translocation in antioxidant-insensitive manner.41
These studies indicate the existence of ROS-dependent pathway(s) for
NF- B translocation are found in a cell-type restricted manner.
Our observations indicate the presence of an antioxidant-sensitive
signalling pathway in U937 cells; this pathway is sensitive to
low doses of antioxidants that inhibit inducible, but not constitutive,
ROS production and functions at a level independently of NF- B translocation.
Along with this study, several lines of evidence are consistent with
the existence of an independent NF- B activating pathway. For
example, translocation of NF- B has been shown insufficient for
IL-1 or TNF -induced NF- B-dependent transcription in airway epithelial cells.42 In that study, NF- B-dependent
transcription, but not translocation, was blocked by pretreatment with
protein kinase inhibitors of the p38 and MAP kinases. However, the
relationship of the MAP kinase cascade to ROS production was unexplored
and will require further investigation. In another study, DMSO
interfered with LPS-induced liver cytokine expression through a
mechanism that could not be readily explained by the slight attenuation DMSO caused on NF- B translocation.43 We speculate that
the ROS signalling pathway could affect posttranslational modification of Rel A, the recruitment of coactivators to the IL-8 promoter, or the
assembly of an NF- B driven preinitiation complex.7 One
inducible event that is clearly distinct from the nuclear translocation
and DNA binding of Rel A is the phosphorylation of Rel A in response to
TNF ,44 LPS,45 and PMA.46
Intriguingly, LPS-induced phosphorylation of Rel A was completely
blocked by an antioxidant.45 Further definition of this
pathway will be required experimentally.
In U937, ROS may be important general second messenger signals for
cytokine production. Treatment with the potent NF- B activating agent, LPS, also increases intracellular ROS production.47
At low concentrations, the antioxidants pyrrolidine dithiocarbonate (PDTC) and NAC completely blocked LPS-inducible ROS
formation, without significant inhibition of NF- B binding (less than
20%).47 The oxidant pathway may be mediating
transcriptional activation in several receptor-mediated pathways that
activate NF- B. It will be interesting to compare the requirement of
other NF- B activating cytokines on ROS signalling.
Antioxidants have been shown effective in reducing IL-8 secretion and
the severity of septic shock48 and airway
inflammation49 in humans. Identification of the component
of signal transduction that is sensitive to antioxidants will open the
door to more selective treatment of inflammatory disorders without
occurrence of side effects that would arise from the complete
deactivation of the TNF signaling cascade.
 |
ACKNOWLEDGMENT |
The authors thank D. Wang for the gift of 18S plasmid and the
current and previous members of the Brasier Lab for valuable suggestions and ideas.
 |
FOOTNOTES |
Submitted February 4, 1999; accepted May 12, 1999.
Supported in part by Grant No. 1 R01 55630 from the National Heart,
Lung and Blood Institute (to A.R.B.), Grant No. 1 R01 AI40218 from the
National Institute of Allergy and Infectious Diseases (to A.R.B.), and
Grant No. ES06676 from the National Institute of Environmental Health
Sciences (to R.S. Lloyd). A.R.B. is an Established Investigator of the
American Heart Association.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Allan R. Brasier, MD, M.R.B.
8.138, University of Texas Medical Branch, 301 University Blvd,
Galveston, TX 77555-1060; e-mail: arbrasie{at}utmb.edu.
 |
REFERENCES |
1.
Beutler B:
TNF, immunity and inflammatory disease: Lessons of the past decade.
J Invest Med
43:227, 1995[Medline]
[Order article via Infotrieve]
2.
Fujishima S, Hoffman AR, Vu T, Kim KJ, Zheng H, Daniel D, Kim Y, Wallace EF, Larrick JW, Raffin TA:
Regulation of neutrophil interleukin-8 gene expression and protein secretion by LPS, TNF-alpha, and IL-1 beta.
J Cell Physiol
154:478, 1993[Medline]
[Order article via Infotrieve]
3.
Smith CA, Farrah T, Goodwin RG:
The TNF receptor superfamily of cellular and viral proteins: Activation, costimulation, and death.
Cell
76:959, 1994[Medline]
[Order article via Infotrieve]
4.
Tartaglia LA, Rothe M, Hu YF, Goeddel DV:
Tumor necrosis factor's cytotoxic activity is signaled by the p55 TNF receptor.
Cell
73:213, 1993[Medline]
[Order article via Infotrieve]
5.
Miyamoto K, Matsukawa A, Ohkawara S, Takagi K, Yoshinaga M:
IL-8 is involved in homologous TNF alpha-, but not in IL-1 beta-induced neutrophil infiltration in rabbits.
Inflamm Res
46:472, 1997[Medline]
[Order article via Infotrieve]
6.
Harada A, Sekido N, Akahoshi T, Wada T, Mukaida N, Matsushima K:
Essential involvement of interleukin-8 (IL-8) in acute inflammation.
J Leukoc Biol
56:559, 1994[Abstract]
7.
Brasier AR, Jamaluddin M, Casola A, Duan W, Shen Q, Garofalo R:
A promoter recruitment mechanism for TNF -induced IL-8 transcription in type II pulmonary epithelial cells: Dependence on nuclear abundance of Rel A, NF- B1 and c-Rel transcription factors.
J Biol Chem
273:3551, 1998[Abstract/Free Full Text]
8.
Garofalo R, Sabry M, Jamaluddin M, Yu RK, Casola A, Ogra PL, Brasier AR:
Transcriptional activation of the interleukin-8 gene by RSV infection in alveolar epithelial cells: Nuclear translocation of the Rel A transcription factor as a mechanism producing airway mucosal inflammation.
J Virol
70:8773, 1996[Abstract]
9.
Kunsch C, Rosen CA:
NF-kappa B subunit-specific regulation of the interleukin-8 promoter.
Mol Cell Biol
13:6137, 1993[Abstract/Free Full Text]
10.
Okamoto S, Mukaida N, Yasumoto K, Horiguchi H, Matsushima K:
Molecular mechanism of interleukin-8 gene expression, in
Lindley IJD
(ed):
The Chemokines. New York, NY, Plenum, 1993.
11.
Matsushima K, Morishita K, Yoshimura T, Lavu S, Kobayashi Y, Lew W, Appella E, Kung HF, Leonard EJ, Oppenheim JJ:
Molecular cloning of a human monocyte-derived neutrophil chemotactic factor (MDNCF) and the induction of MDNCF mRNA by interleukin 1 and tumor necrosis factor.
J Exp Med
167:1883, 1988[Abstract/Free Full Text]
12.
Siebenlist U, Franzoso G, Brown K:
Structure, regulation and function of NF- B.
Annu Rev Cell Biol
10:405, 1994
13.
Khan AU, Wilson T:
Reactive oxygen species as cellular messengers.
Chem Biol
2:437, 1995[Medline]
[Order article via Infotrieve]
14.
Sundaresan M, Yu Z-X, Ferrans V, Irani K, Finkel T:
Requirement for generation of H202 for platelet-derived growth factor signal transduction.
Science
270:296, 1995[Abstract/Free Full Text]
15.
Lo YY, Cruz TF:
Involvement of reactive oxygen species in cytokine and growth factor induction of c-fos expression in chondrocytes.
J Biol Chem
270:11727, 1995[Abstract/Free Full Text]
16.
DeForge LE, Preston AM, Takeuchi E, Kenney J, Boxer LA, Remick DG:
Regulation of interleukin 8 gene expression by oxidant stress.
J Biol Chem
268:25568, 1993[Abstract/Free Full Text]
17.
Ginn-Pease ME, Whisler RL:
Redox signals and NF- B activation in T cells.
Free Rad Biol Med
25:346, 1998[Medline]
[Order article via Infotrieve]
18.
Anderson CL:
Isolation of the receptor for IgG from a human monocyte cell line (U937) and from human peripheral blood monocytes.
J Exp Med
156:1794, 1982[Abstract/Free Full Text]
19.
Biswas P, Delfanti F, Bernasconi S, Mengozzi M, Cota M, Polentarutti N, Mantovani A, Lazzarin A, Sozzani S, Poli G:
Interleukin-6 induces monocyte chemotactic protein-1 in peripheral blood mononuclear cells and in the U937 cell line.
Blood
91:258, 1998[Abstract/Free Full Text]
20.
Bass DA, Parce JW, Dechatelet LR, Szejda P, Seeds MC, Thomas M:
Flow cytometric studies of oxidative product formation by neutrophils: A graded response to membrane stimulation.
J Immunol
130:1910, 1983[Abstract]
21.
Virca GD, Northemann W, Shiels BR, Widera G, Broome S:
Simplified northern blot hybrdization using 5% sodium dodecyl sulfate.
Biotechniques
8:370, 1990[Medline]
[Order article via Infotrieve]
22.
Brasier AR:
Nonisotopic assays for reporter gene activity, in
Ausubel FM,
Brent R,
Kingston RE,
Moore DD,
Seidman JG,
Smith JA,
Struhl K
(eds):
Current Protocols in Molecular Biology. New York, NY, Wiley, 1995, p 1:9.7.12.
23.
Han Y, Brasier AR:
Mechanism for biphasic Rel A:NF- B1 nuclear translocation in tumor necrosis factor -stimulated hepatocytes.
J Biol Chem
272:9823, 1997
24.
Jamaluddin M, Garofalo R, Ogra PL, Brasier AR:
Inducible translational regulation of the NF-IL6 transcription factor by respiratory syncytial virus infection in pulmonary epithelial cells.
J Virol
70:1554, 1996[Abstract]
25.
Baeuerle PA, Henkel T:
Function and activation of NF-kappa B in the immune system.
Ann Rev Immunol
12:141, 1994[Medline]
[Order article via Infotrieve]
26.
Jamaluddin M, Casola A, Garofalo RP, Han Y, Elliott T, Ogra PL, Brasier AR:
The major component of I B proteolysis occurs independently of the proteasome pathway in respiratory syncytial virus-infected pulmonary epithelial cells.
J Virol
72:4849, 1998[Abstract/Free Full Text]
27.
Schreck R, Rieber P, Baeuerle PA:
Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-kappa B transcription factor and HIV-1.
EMBO J
10:2247, 1991[Medline]
[Order article via Infotrieve]
28.
Israel N, Gougerot Pocidalo MA, Aillet F, Virelizier JL:
Redox status of cells influences constitutive or induced NF-kappa B translocation and HIV long terminal repeat activity in human T and monocytic cell lines.
J Immunol
149:3386, 1992[Abstract]
29.
Rice NR, Ernst MK:
In vivo control of NF- B activation by I B alpha.
EMBO J
12:4685, 1993[Medline]
[Order article via Infotrieve]
30.
Traenckner EB-M, Pahl HL, Henkel T, Schmidt KN, Wilk S, Baeuerle PA:
Phosphorylation of human I B- on serines 32 and 36 controls I B- proteolysis and NF- B activation in response to diverse stimuli.
EMBO J
14:2876, 1995[Medline]
[Order article via Infotrieve]
31.
Maniatis T:
Catalysis by a multiprotein IkappaB kinase complex.
Science
278:818, 1997[Free Full Text]
32.
DiDonato J, Mercurio F, Rosette C, Wu-Li J, Suyang H, Ghosh S, Karin M:
Mapping of the inducible I B phosphorylation sites that signal its ubiquitination and degradation.
Mol Cell Biol
16:1295, 1996[Abstract]
33.
Singh I, Pahan K, Khan M, Singh AK:
Cytokine-mediated induction of ceramide production is redox-sensitive. Implications to proinflammatory cytokine-mediated apoptosis in demyelinating diseases.
J Biol Chem
272:20354, 1998
34.
Mishra S:
A spin decay assay for tumor necrosis factor cytotoxicity.
Indian J Biochem Biophys
32:254, 1995[Medline]
[Order article via Infotrieve]
35.
Meier B, Radeke HH, Selle S, Younes M, Sies H, Resch K, Habermehl GG:
Human fibroblasts release reactive oxygen species in response to interleukin-1 or tumour necrosis factor-alpha.
Biochem J
263:539, 1989[Medline]
[Order article via Infotrieve]
36.
Bowie AG, Moynagh PN, O'Neill LAJ:
Lipid peroxidation is involved in the activation of NF- B by tumor necrosis factor but not interleukin-1 in the human endothelial cell line ECV304.
J Biol Chem
272:25941, 1997[Abstract/Free Full Text]
37.
Sen CK, Packer L:
Antioxidant and redox regulation of gene transcription.
FASEB
10:709, 1996[Abstract]
38.
Schmid RM, Liptay S, Betts JC, Nabel GJ:
Structural and functional analysis of NF- B.
J Biol Chem
269:32162, 1994[Abstract/Free Full Text]
39.
Kelly KA, Hill MR, Youkhana K, Wanker F, Gimble JM:
Dimethyl sulfoxide modulates NF-kappaB and cytokine activation in lipopolysaccharide-treated murine macrophages.
Infect Immun
62:3122, 1994[Abstract/Free Full Text]
40.
Sakurada S, Kato T, Okamoto T:
Induction of cytokines and ICAM-1 by proinflammatory cytokines in primary rheumatoid synovial fibroblasts and inhibition by N-acetyl-L-cysteine and aspirin.
Int Immunol
8:1483, 1996[Abstract/Free Full Text]
41.
Bonizzi G, Dejardin E, Piret B, Piette J, Merville MP, Bours V:
Interleukin-1 induces nuclear factor B in epithelial cells independently of the production of reactive oxygen intermediates.
Eur J Biochem
242:544, 1996[Medline]
[Order article via Infotrieve]
42.
Bergmann M, Hart L, Lindsay M, Barnes PJ, Newton R:
I B degradation and nuclear factor- B DNA binding are insufficient for IL-1 and tumor necrosis factor- -induced B-dependent transcription.
J Biol Chem
273:6607, 1998[Abstract/Free Full Text]
43.
Essani NA, Fisher MA, Jaeschke H:
Inhibition of NF-kappa B activation by dimethyl sulfoxide correlates with suppression of TNF-alpha formation, reduced ICAM-1 gene transcription, and protection against endotoxin-induced liver injury.
Shock
7:90, 1997[Medline]
[Order article via Infotrieve]
44.
Naumann M, Scheidereit C:
Activation of NF- B in vivo is regulated by multiple phosphorylations.
EMBO J
13:4597, 1994[Medline]
[Order article via Infotrieve]
45.
Zhong H, SuYang H, Erdjument-Bromage H, Tempst P, Ghosh S:
The transcriptional activity of NF- B is regulated by the I B-associated PKAc subunit through a cyclic AMP-independent mechanism.
Cell
89:413, 1997[Medline]
[Order article via Infotrieve]
46.
Schmitz ML, dos Santos Silva MA, Baeuerle PA:
Transactivation domain 2 (tA2) of p65 NF- B. Similarity to TA1 and phorbol ester-stimulated activity and phosphorylation in intact cells.
J Biol Chem
270:15576, 1995[Abstract/Free Full Text]
47.
Legrand-Poels S, Maniglia S, Boelaert JR, Piette J:
Activation of the transcription factor NF- B in lipopolysaccharide-stimulated U937 cells.
Biochem Pharmacol
53:339, 1997[Medline]
[Order article via Infotrieve]
48.
Spapen H, Zhang H, Demanet C, Vleminckx W, Vincent JL, Huyghens L:
Does N-acetyl-L-cysteine influence cytokine response during early human septic shock?
Chest
113:1616, 1998[Abstract/Free Full Text]
49.
Konstan MW:
Treatment of airway inflammation in cystic fibrosis.
Curr Opin Pulmon Med
2:452, 1996[Medline]
[Order article via Infotrieve]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Jamaluddin, B. Tian, I. Boldogh, R. P. Garofalo, and A. R. Brasier
Respiratory Syncytial Virus Infection Induces a Reactive Oxygen Species-MSK1-Phospho-Ser-276 RelA Pathway Required for Cytokine Expression
J. Virol.,
October 15, 2009;
83(20):
10605 - 10615.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Cloutier, C. Guindi, P. Larivee, C. M. Dubois, A. Amrani, and P. P. McDonald
Inflammatory Cytokine Production by Human Neutrophils Involves C/EBP Transcription Factors
J. Immunol.,
January 1, 2009;
182(1):
563 - 571.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Jung, H. Kim, S. H. Min, S. G. Rhee, and W. Jeong
Dynein Light Chain LC8 Negatively Regulates NF-{kappa}B through the Redox-dependent Interaction with I{kappa}B{alpha}
J. Biol. Chem.,
August 29, 2008;
283(35):
23863 - 23871.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Thompson, S. McMahon, Y. Bosse, C. M. Dubois, J. Stankova, and M. Rola-Pleszczynski
Leukotriene D4 Up-Regulates Furin Expression through CysLT1 Receptor Signaling
Am. J. Respir. Cell Mol. Biol.,
August 1, 2008;
39(2):
227 - 234.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. E. Nowak, B. Tian, M. Jamaluddin, I. Boldogh, L. A. Vergara, S. Choudhary, and A. R. Brasier
RelA Ser276 Phosphorylation Is Required for Activation of a Subset of NF-{kappa}B-Dependent Genes by Recruiting Cyclin-Dependent Kinase 9/Cyclin T1 Complexes
Mol. Cell. Biol.,
June 1, 2008;
28(11):
3623 - 3638.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Thompson, A. Cloutier, Y. Bosse, C. Poisson, P. Larivee, P. P. McDonald, J. Stankova, and M. Rola-Pleszczynski
Signaling by the Cysteinyl-Leukotriene Receptor 2: INVOLVEMENT IN CHEMOKINE GENE TRANSCRIPTION
J. Biol. Chem.,
January 25, 2008;
283(4):
1974 - 1984.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. S. Gray and J. J. Pestka
Transcriptional Regulation of Deoxynivalenol-Induced IL-8 Expression in Human Monocytes
Toxicol. Sci.,
October 1, 2007;
99(2):
502 - 511.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Wagoner, M. Austin, J. Green, T. Imaizumi, A. Casola, A. Brasier, K. S. A. Khabar, T. Wakita, M. Gale Jr., and S. J. Polyak
Regulation of CXCL-8 (Interleukin-8) Induction by Double-Stranded RNA Signaling Pathways during Hepatitis C Virus Infection
J. Virol.,
January 1, 2007;
81(1):
309 - 318.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Thompson, A. Cloutier, Y. Bosse, M. Thivierge, C. L. Gouill, P. Larivee, P. P. McDonald, J. Stankova, and M. Rola-Pleszczynski
CysLT1 Receptor Engagement Induces Activator Protein-1- and NF-{kappa}B-Dependent IL-8 Expression
Am. J. Respir. Cell Mol. Biol.,
December 1, 2006;
35(6):
697 - 704.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Jamaluddin, S. Choudhary, S. Wang, A. Casola, R. Huda, R. P. Garofalo, S. Ray, and A. R. Brasier
Respiratory Syncytial Virus-Inducible BCL-3 Expression Antagonizes the STAT/IRF and NF-{kappa}B Signaling Pathways by Inducing Histone Deacetylase 1 Recruitment to the Interleukin-8 Promoter
J. Virol.,
December 15, 2005;
79(24):
15302 - 15313.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Xing and D. G. Remick
Mechanisms of Dimethyl Sulfoxide Augmentation of IL-1{beta} Production
J. Immunol.,
May 15, 2005;
174(10):
6195 - 6202.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Tian, D. E. Nowak, M. Jamaluddin, S. Wang, and A. R. Brasier
Identification of Direct Genomic Targets Downstream of the Nuclear Factor-{kappa}B Transcription Factor Mediating Tumor Necrosis Factor Signaling
J. Biol. Chem.,
April 29, 2005;
280(17):
17435 - 17448.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Page, V. S. Hughes, K. K. Odoms, K. E. Dunsmore, and M. B. Hershenson
German Cockroach Proteases Regulate Interleukin-8 Expression via Nuclear Factor for Interleukin-6 in Human Bronchial Epithelial Cells
Am. J. Respir. Cell Mol. Biol.,
March 1, 2005;
32(3):
225 - 231.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Lekstrom-Himes, D. B. Kuhns, W. G. Alvord, and J. I. Gallin
Inhibition of Human Neutrophil IL-8 Production by Hydrogen Peroxide and Dysregulation in Chronic Granulomatous Disease
J. Immunol.,
January 1, 2005;
174(1):
411 - 417.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. A. Ryan, M. F. Smith Jr., M. K. Sanders, and P. B. Ernst
Reactive Oxygen and Nitrogen Species Differentially Regulate Toll-Like Receptor 4-Mediated Activation of NF-{kappa}B and Interleukin-8 Expression
Infect. Immun.,
April 1, 2004;
72(4):
2123 - 2130.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. T. D'Angio, M. B. LoMonaco, C. J. Johnston, C. K. Reed, and J. N. Finkelstein
Differential roles for NF-{kappa}B in endotoxin and oxygen induction of interleukin-8 in the macrophage
Am J Physiol Lung Cell Mol Physiol,
January 1, 2004;
286(1):
L30 - L36.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Baraldo, D. S. Faffe, P. E. Moore, T. Whitehead, M. McKenna, E. S. Silverman, R. A. Panettieri Jr., and S. A. Shore
Interleukin-9 influences chemokine release in airway smooth muscle: role of ERK
Am J Physiol Lung Cell Mol Physiol,
June 1, 2003;
284(6):
L1093 - L1102.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Tian and A. R. Brasier
Identification of a Nuclear Factor Kappa B-dependent Gene Network
Recent Prog. Horm. Res.,
January 1, 2003;
58(1):
95 - 130.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Li, S. Kartha, S. Iasvovskaia, A. Tan, R. K. Bhat, J. M. Manaligod, K. Page, A. R. Brasier, and M. B. Hershenson
Regulation of human airway epithelial cell IL-8 expression by MAP kinases
Am J Physiol Lung Cell Mol Physiol,
October 1, 2002;
283(4):
L690 - L699.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Zoll, W. J. G. Melchers, J. M. D. Galama, and F. J. M. van Kuppeveld
The Mengovirus Leader Protein Suppresses Alpha/Beta Interferon Production by Inhibition of the Iron/Ferritin-Mediated Activation of NF-{kappa}B
J. Virol.,
August 28, 2002;
76(19):
9664 - 9672.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Hellmuth, C. Wetzler, M. Nold, J.-H. Chang, S. Frank, J. Pfeilschifter, and H. Muhl
Expression of interleukin-8, heme oxygenase-1 and vascular endothelial growth factor in DLD-1 colon carcinoma cells exposed to pyrrolidine dithiocarbamate
Carcinogenesis,
August 1, 2002;
23(8):
1273 - 1279.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Pentikainen, L. Suomalainen, K. Erkkila, E. Martelin, M. Parvinen, M. O. Pentikainen, and L. Dunkel
Nuclear Factor-{kappa}B Activation in Human Testicular Apoptosis
Am. J. Pathol.,
January 1, 2002;
160(1):
205 - 218.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zhang, B. A. Luxon, A. Casola, R. P. Garofalo, M. Jamaluddin, and A. R. Brasier
Expression of Respiratory Syncytial Virus-Induced Chemokine Gene Networks in Lower Airway Epithelial Cells Revealed by cDNA Microarrays
J. Virol.,
October 1, 2001;
75(19):
9044 - 9058.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Jamaluddin, S. Wang, R. P. Garofalo, T. Elliott, A. Casola, S. Baron, and A. R. Brasier
IFN-{beta} mediates coordinate expression of antigen-processing genes in RSV-infected pulmonary epithelial cells
Am J Physiol Lung Cell Mol Physiol,
February 1, 2001;
280(2):
L248 - L257.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Ryu, H. Pyo, I. Jou, and E. Joe
Thrombin Induces NO Release from Cultured Rat Microglia via Protein Kinase C, Mitogen-activated Protein Kinase, and NF-kappa B
J. Biol. Chem.,
September 22, 2000;
275(39):
29955 - 29959.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. H. Boulares, A. J. Zoltoski, A. Yakovlev, M. Xu, and M. E. Smulson
Roles of DNA Fragmentation Factor and Poly(ADP-ribose) Polymerase in an Amplification Phase of Tumor Necrosis Factor-induced Apoptosis
J. Biol. Chem.,
October 5, 2001;
276(41):
38185 - 38192.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|