Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vlahopoulos, S.
Right arrow Articles by Brasier, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vlahopoulos, S.
Right arrow Articles by Brasier, A. R.
Related Collections
Right arrow Chemokines, Cytokines, and Interleukins
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 94 No. 6 (September 15), 1999: pp. 1878-1889

Nuclear Factor-kappa B-Dependent Induction of Interleukin-8 Gene Expression by Tumor Necrosis Factor &b.alpha;: Evidence for an Antioxidant Sensitive Activating Pathway Distinct From Nuclear Translocation

By Spiros Vlahopoulos, Istvan Boldogh, Antonella Casola, and Allan R. Brasier

From the Departments of Internal Medicine, Microbiology & Immunology, the Sealy Center for Molecular Sciences, and the Department of Pediatrics, University of Texas Medical Branch, Galveston, TX.


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Tumor necrosis factor alpha (TNFalpha ) is a pluripotent activator of inflammation by inducing a proinflammatory cytokine cascade. This phenomenon is mediated, in part, through inducible expression of the CXC chemokine, interleukin-8 (IL-8). In this study, we investigate the role of TNFalpha -inducible reactive oxygen species (ROS) in IL-8 expression by "monocyte-like" U937 histiocytic lymphoma cells. TNFalpha is a rapid activator of IL-8 gene expression by U937, producing a 50-fold induction of mRNA within 1 hour of treatment. In gene transfection assays, the effect of TNFalpha requires the presence of an inducible nuclear factor-kappa B (NF-kappa B) (Rel A) binding site in the IL-8 promoter. TNFalpha treatment induces a rapid translocation of the 65 kD transcriptional activator NF-kappa B subunit, Rel A, whose binding in the nucleus occurs before changes in intracellular ROS. Pretreatment (or up to 15 minutes posttreatment) relative to TNFalpha with the antioxidant dimethyl sulfoxide (DMSO) (2% [vol/vol]) blocks 80% of NF-kappa B-dependent transcription. Surprisingly, however, DMSO has no effect on inducible Rel A binding. Similar selective effects on NF-kappa B transcription are seen with the unrelated antioxidants, N-acetylcysteine (NAC) and vitamin C. These data indicate that TNFalpha induces a delayed ROS-dependent signalling pathway that is required for NF-kappa B transcriptional activation and is separable from that required for its nuclear translocation. Further definition of this pathway will yield new insights into inflammation initiated by TNFalpha signalling.
© 1999 by The American Society of Hematology.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

THE PLURIPOTENT CYTOKINE tumor necrosis factor alpha  (TNFalpha ) has been shown to be an endogenous mediator of inflammation and cellular immune responses.1 Binding to ubiquitously expressed receptors, TNFalpha is capable of eliciting a wide spectrum of physiologic and cellular responses to acute endotoxemia, acute respiratory distress syndrome, and infection with protozoal, bacterial, and viral pathogens. In circulating blood, monocytes are important target cells of TNFalpha action where it induces parallel cellular (enhanced cytotoxic capacity) and genetic programs (enhanced secretion of additional inflammatory mediators, including interleukin-1 [IL-1], IL-8, and platelet activating factor) that allow acquisition of a phagocytic phenotype. In fact, monocytic cells represent the major source of TNFalpha -inducible IL-8 secretion in human blood.2

The actions of TNFalpha are mediated by single transmembrane spanning receptors lacking intrinsic kinase activity (reviewed in Smith et al3). Circulating and binding as a trimeric peptide, TNFalpha induces receptor trimerization. Trimerization, an event required for receptor activation, results in protein recruitment to the intracellular (cytoplasmic) domain of the receptor.4 These signal transducing proteins, termed TNF receptor death domain protein (TRADD), and TRADD-associated factors (TRAFs) apparently control the activity of intracellular serine-threonine kinase cascades and protease activation.4 In addition, it has been appreciated that TNF receptor activation also results in the generation of putative second messenger molecules including ceramide, 1,2-diacylglycerol, arachidonic acid, and reactive oxygen species (ROS).

IL-8 is an important paracrine mediator of inflammation of the CXC chemokine family that amplifies inflammatory signals by demargination, activation, and chemotaxis of polymorphonuclear leukocytes.5,6 Encoded by a highly inducible gene, TNFalpha is a potent inducer of IL-8 secretion in a variety of cell types through a transcriptional mechanism primarily regulated by nuclear factor-kappa B (NF-kappa B).2,7-11 NF-kappa B is a heterodimeric protein composed of the transactivating subunit (Rel A) associated with the DNA binding subunit (NF-kappa B1) sequestered in a latent cytoplasmic form by association with Ikappa Balpha inhibitor. In response to cytokine stimulation, Rel A-Ikappa Balpha dissociates and Ikappa Balpha is proteolyzed, allowing the liberated cytoplasmic NF-kappa B to be translocated into the nucleus, where it binds to genomic targets and initiates transcription.12

ROS are ubiquitous highly diffusable and reactive molecules produced as a result of reduction of molecular oxygen, and include species such as hydrogen peroxide, superoxide anion, and hydroxyl radical.13 Recently, a role of ROS in cellular responses to growth factor signalling has been described for platelet-derived growth factor14 and basic fibroblast-derived growth factor.15 In these examples, hormone receptor-activated ROS were involved in proliferative and programmed cell death. The contribution of ROS as second messenger molecules in TNFalpha signalling is controversial. Although others have shown that extracellular oxidants (H2O2) and enzymatic oxidative stress-inducing systems are capable of activating IL-8 secretion,16 these systems may be artifactual because they may not reproduce hormone receptor-induced ROS production in magnitude, kinetics, or ROS concentrations in proper subcellular compartments.17

Here we investigate the role of ROS in mediating TNFalpha -inducible expression of IL-8 in the histiocytic lymphoma cell line U937. U937 cells share phenotypic (IgG receptor expression and inducible differentiation) and functional (inducible cytokine expression) features with normal monocytes.18,19 We show that TNFalpha is a potent and rapid inducer of IL-8 protein secretion and gene expression. This effect is, in part, through enhanced transcription mediated through a single inducible cis regulatory element that binds to the inducible NF-kappa B transcription factor. In parallel, TNFalpha induces ROS generation as measured by the specific fluorescent 2',7'dichlorofluescein oxidation assay.20 Pretreatment of U937 cells with the antioxidant dimethyl sulfoxide (DMSO) blocks inducible ROS generation and NF-kappa B transcriptional activity. Surprisingly, the effect of DMSO occurs without altering either NF-kappa B nuclear abundance or DNA-binding activity. The unrelated antioxidants, vitamin C and N-acetylcysteine (NAC), also selectively inhibit NF-kappa B transcriptional activity without detectable effects on NF-kappa B binding. These data indicate that an antioxidant pathway is required for NF-kappa B transcriptional activity that is separate and independent of signals coupled to NF-kappa B nuclear translocation.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Materials.   Recombinant human TNFalpha was obtained from Calbiochem (San Diego, CA). DMSO, NAC, vitamin C, and vitamin E were purchased from Sigma (St Louis, MO). N-[2-hydroxyethyl]piperazine-N'-[2-ethanesulfonic acid] (HEPES), sodium lauryl sulfate (SDS), sodium chloride, sodium citrate, and ethylenediaminetetraacetic Acid (EDTA) were from Fischer Scientific (Pittsburgh, PA). Dichlorofluorescein diacetate (DCF-DA) was obtained from Molecular Probes (Eugene, OR).

Cell culture and treatment.   U937 human histiocytoma lymphoma cells were obtained from the American Type Culture Collection (ATCC; Rockville, MD) and grown as a suspension in RPMI medium containing 10% (vol/vol) fetal bovine serum, 10 mmol/L glutamine, 100 IU/mL penicillin, and 100 µg/mL streptomycin (GIBCO, Gaithersburg, MD) in an atmosphere of 5% CO2, at 37°C. TNFalpha was added to the medium at a final concentration of 20 ng/mL, unless otherwise stated. For antioxidant treatments, cells were pretreated either with indicated concentrations of DMSO (1 hour before TNFalpha , unless otherwise indicated), or NAC (7.5 mmol/L, 2 hours before TNFalpha ), or with vitamin C (4 mmol/L, 2 hours before TNFalpha ).

Assesment of intracellular ROS generation.   U937 cells were preloaded with 5 µmol/L DCF-DA in fully supplied culture medium containing 20 mmol/L HEPES, pH 7.4 for 20 minutes at 37°C. The cells were washed by centrifugation at 200g and resuspended in serum-containing fresh medium buffered in 20 mmol/L HEPES pH 7.4. After stimulation with TNFalpha , the cells were placed in a Becton Dickinson FACScan flow cytometer (excitation 485 nm; emission 530 nm; Becton Dickinson, Franklin Lakes, NJ) to quantitate oxidation into fluorescent DCF (an indicator of the intracellular ROS production20). A minimum of 10,000 cells was analyzed and the results expressed as fluorescence mean ± standard deviation (SD) of n = 3 independent experiments.

IL-8 enzyme-linked immunosorbent assay (ELISA).   Immunoreactive IL-8 was quantitated in cell culture supernatants by a double-antibody ELISA kit using recombinant IL-8 as a standard (R&D Systems, Minneapolis, MN) following the manufacturer's protocol. This assay has a sensitivity of detection of 200 pg/mL.

Northern blot analysis.   Total RNA was extracted from control, TNFalpha -treated, or antioxidant plus TNFalpha -treated cells by the RNAzol kit (Teltest, Friendswood, TX) and RNA abundance quantitated spectrophotometrically. Twenty micrograms of RNA was fractionated on a 1.2% agarose-formaldehyde gel and transferred to nylon-reinforced nitrocellulose membrane (MSI, Westboro, MA). The RNA was then hybridized using polymerase chain reaction (PCR)-generated body-labeled cDNA probe for IL-8,7 followed by an 18S rRNA-cDNA probe using previously reported conditions.21 Blots were washed in 5% SDS, 1 × sodium chloride sodium citrate (SSC) buffer at 50°C 3 times, 15 minutes each, and quantitated by exposure to a Molecular Dynamics (Sunnyvale, CA) Phosphorimager cassette. After quantitation, the blots were exposed to a Kodak XAR5 film (Rochester, NY).

Plasmid construction and transient transfections.   5' deletion constructs of the human IL-8 (hIL-8) promoter2` were produced using the PCR with -1498/+44 hIL-8/Luc reporter plasmid8 as a template and a downstream oligonucleotide hybridizing +86 to +557 of the luciferase (LUC) cDNA.22 Upstream primers were used to produce 5' deletions at nucleotide -162, -132, -99, and -54 by incorporating a unique Bam H1 restriction site immediately upstream. The PCR products were restricted with Bam H1 and Hind III, gel purified, and subcloned into the poLUC reporter vector.22 Site-directed mutagenesis of the NF-kappa B site in the context of -162/+44 hIL-8 were introduced using the technique of PCR "SOEING"8 with the mutagenic primers (mutations underlined): 5'-TTCATTATGTCAGA<OVL>TT</OVL>AAATT<OVL>AAA</OVL>CGATTT-3' and 5'-TTGCAAATCG<OVL>TTT</OVL>AATTT<OVL>AA</OVL>TCTGACAATA-3'. For the NF-IL-6 binding site-mutation, the primers 5'-GCCATCAG<OVL>C</OVL>T<OVL>A</OVL>C<OVL>G</OVL>A<OVL>G</OVL>TCGTGGAATTTCCTCTGA-3' and 5'-GAAATTCCACGA<OVL>C</OVL>T<OVL>C</OVL>G<OVL>T</OVL>A<OVL>G</OVL>CTGATGGCCCATCC-3' were used. For the activator protein (AP)-1 binding site mutation, the primers 5'-GAGTGTGAT<OVL>AT</OVL>CTCAGGTTTGCCCTGA-3' and 5'-CAAACCTGAG<OVL>AT</OVL>ATCACACTTCCTA-3' were used. Multimeric binding sites were constructed by ligation of 3 copies of the NF-kappa B 5'-GATCCATCAGCTACGAGTCGTGGAATTTCCTCTA-3', AP-1 5'-GATCCGAGTGTGATGACTCAGGTTTGCCCTTTA-3' and NF-IL-6 5'-GATCCATCAGTTGCAAATCGTTTAATTTCCTCTA-3' DNA sequences (having previously annealed them to complementary overlapping oligonucleotides) upstream of the -54 hIL-8/LUC promoter. Plasmids for use in transfection were purified by ion exchange (Qiagen, Chatsworth, CA) and sequenced to verify authenticity.

Transient transfections were performed in 107 logarithmically growing U937 cells using a mixture of 60 µg diethylaminoethyl-dextran with 45 µg of hIL-8/LUC reporter and 9 µg of SV40/alkaline phosphatase-internal control plasmid. After 20 minutes at room temperature, the cells were centrifuged (at 300xg), resuspended in fresh culture medium, and distributed into 9 60-mm plates, and returned to the incubator. Cells were treated 16 hours after transfection. Six hours after treatment, cells were harvested, cytoplasmic lysates prepared, and luciferase activity measured.8 As an internal control for transfection efficiency, alkaline phosphatase activity was measured in 50 µg cell lysate by the dephosphorylation of alkaline phosphatase substrate (Sigma) in DEA buffer (1 mol/L Diethanolamine, pH 9.85, 0.28 mol/L NaCl, 0.5 mol/L MgCl2). Fold induction of reporter activity (by treatment with TNFalpha ) was calculated by division of the mean normalized luciferase activity from 3 treated cultures, by the mean normalized luciferase activity from 3 untreated cultures.

Electrophoretic mobility shift assays (EMSAs) and microaffinity purification.   Sucrose-cushion purified nuclear extracts (NE) of U937 cells were prepared using hypotonic/nonionic detergent lysis as described previously.7,23 After extraction, nuclear protein was normalized by protein assay and used to bind to duplex oligonucleotides corresponding to -96 to -69 bp of hIL-8 promoter shown below (underlines indicate site mutations that disrupt NF-kappa B binding).NF-kappa B: GATCCATCAGTTGCAAATCGTGGAATTTCCTCTA GTAGTCAACGTTTAGCACCTTAAAGGAGATCTAG
NF-kappa B mut:
  GATCCATCAGTTGCAAATCGT<OVL>TT</OVL>AATTT<OVL>AA</OVL>TCTA    GTAGTCAACGTTTAGCA<OVL>AA</OVL>TTAAA<OVL>TT</OVL>AGATCTAG

EMSAs included 10 µg of nuclear protein, 1.5 µg of polydeoxyadenylic-thymidylic acid (dA/dT), and 30,000 cpm alpha 32P-labeled double-stranded IL-8 probe. For competition 50-fold molar excess of unlabeled competitor was included in the initial binding reaction. Antibody interference assays were as described for the supershift.8

Microaffinity purification of proteins binding to NF-kappa B wild-type (WT) was performed using a 2-step biotinylated DNA-streptavidin capture assay.7 In this assay, duplex NF-kappa B WT oligonucleotides were chemically synthesized containing 5' biotin (Bt) on a flexible linker (Genosys, The Woodlands, TX). Identical amounts of nuclear protein from control and hormone-stimulated extracts were incubated with 50 pmoles Bt-NF-kappa B WT DNA in the presence of 8 µg poly dA/dT (as nonspecific competitor) in 800 µL (final volume) of binding buffer (8% [vol/vol] glycerol, 5 mmol/L MgCl2, 1 mmol/L dithiothreitol [DTT], 60 mmol/L KCl, 1 mmol/L EDTA, 12 mmol/L HEPES, pH 7.8) at 4°C for 1 hour. A total of 100 µL of a 50% slurry of prewashed streptavidin-agarose beads was then added to the sample and incubated at 4°C for an additional 20 minutes with shaking. Pellets were washed twice with 500 µL binding buffer and then resuspended in 100 µL 1X sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) buffer for analysis by Western immunoblot.

Western immunoblot.   Proteins were fractionated by SDS-PAGE and transferred onto polyvinylene difluoride membranes as described.23,24 Affinity-purified rabbit polyclonal antibodies to Rel A and Ikappa Balpha were obtained commercially (Santa Cruz Biotechnology, Santa Cruz, CA). Mouse monoclonal antibody to beta -Actin was from Sigma. Secondary detection was using horseradish peroxidase-coupled donkey antirabbit or goat antimouse antibody in the ECL enhanced chemiluminescence assay (Amersham Life Sciences Arlington Heights, IL) as described.8,23

Statistical analysis.   Data from experiments involving multiple samples subject to each treatment were analyzed by the Student Newman Keuls t-test for multiple pairwise comparisons.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Induction of the IL-8 gene expression by TNFalpha .   The mechanism for TNFalpha -induced IL-8 expression was studied in U937 histiocytic lymphoma cells. First, U937 cells were stimulated by maximal doses of TNFalpha and changes in IL-8 mRNA detected by Northern blot assay at various times of stimulation (Fig 1A). TNFalpha induced the rapid appearance of a 1.8-kb transcript, detectable at 10-fold (relative to control) with 30 minutes and peaked at a approx 50-fold induction between 60 to 180 minutes. At later times, IL-8 expression began to fall, indicating the effect of TNFalpha was rapid, but transient (not shown). The dose-response relationship of IL-8 mRNA was next investigated. At TNFalpha concentrations between 0.0064 ng/mL to 0.8 ng/mL, IL-8 gene expression was strongly induced in a dose-dependent manner (Fig 1B). Further increasing the dose of TNFalpha produced a flat dose-response curve (not shown), indicating receptor saturation. To determine whether IL-8 was secreted in parallel to the changes in IL-8 gene expression, IL-8 protein was assayed in U937 cell culture supernatants (Fig 1C). Although a 3-fold increase in IL-8 could be detected after 2 hours of TNFalpha , significant secretion of the protein was maximal at 16 hours. The delay relative to mRNA accumulation presumably reflects the time required for mRNA translation and protein secretion.




View larger version (64K):
[in this window]
[in a new window]
 
Fig 1. TNFalpha inducible IL-8 expression in the U937 monocytic cell line. (A) TNFalpha rapidly induces IL-8 mRNA abundance. U937 cells were untreated (control) or stimulated with 20 ng/mL TNFalpha for the indicated times (in minutes, at top). Total RNA was extracted and analyzed by Northern analysis by hybridization with a hIL-8 cDNA probe (top) and an 18S cDNA probe (bottom) as an internal control. Shown is a representative Northern blot. Relative to control, IL-8 increases 10-fold (30 minutes), 37-fold (45 minutes), and 56-fold (60 minutes). This experiment was reproduced 2 times with similar results. (B) TNFalpha induces a dose-dependent increase in IL-8 mRNA abundance. Cells unstimulated/stimulated with the indicated doses (in ng/mL) TNFalpha for 1 hour were lysed and the total RNA subject to Northern analysis by hybridization with a hIL-8 cDNA probe (top) and an 18S cDNA probe (bottom) as an internal control. Relative to control, 0.0064 ng/mL TNFalpha increased normalized IL-8 signal by 2-fold, 0.032 ng/mL TNFalpha increased IL-8 signal by 7-fold, 0.16 ng/mL TNFalpha increased IL-8 signal by 21-fold; 0.8 ng/mL increased IL-8 signal by 38-fold. This experiment was reproduced 2 times with similar results. (C) TNFalpha induces a time-dependent increase in IL-8 protein secretion. Duplicate cultures were untreated (control) or stimulated with 20 ng/mL TNFalpha . At indicated times, cell culture supernatants were harvested and immunoreactive IL-8 determined by ELISA. Shown is the mean ± SD of n = 2 independent experiments. TNFalpha increases IL-8 secretion by 2.4-fold at 2 hours and 10-fold by 16 hours. Basal secretion is 500 pg/mL and unchanged any time of this experiment (P < .0001 for unstimulated v stimulated).

To test whether transcription was a component of IL-8 gene induction by TNFalpha , the reporter gene luciferase under the control of various lengths of IL-8 promoter7 was transfected into U937 cells. TNFalpha stimulation resulted in a strong induction of the native -1498 nucleotide (nt) IL-8 promoter-mediated luciferase activity (Fig 2A). 5' deletion from -1498 to -162 nt resulted in no significant change in either basal or inducible luciferase activity. However, deletion from-162 to -99 nt reduced the basal and fold induction by approximately 2-fold (47-fold became 19-fold). Stimulation of -54 hIL-8/LUC showed it to be completely inert to TNFalpha . These data indicate that TNFalpha induction of the IL-8 promoter requires 2 domains, the first between -162 to -99 and the second between -99 to -54 for full inducibility.




View larger version (56K):
[in this window]
[in a new window]
 
Fig 2. Identification of TNFalpha -inducible IL-8 cis elements in U937 cells. (A) 5'-deletions of the human IL-8 promoter/Luciferase reporter (hIL-8/LUC) were transfected into U937 cells. Sixteen hours later, cells were stimulated with 20 ng/mL TNFalpha for 6 hours before luciferase assay. Shown is the normalized Luciferase activity from a representative transfection plotted on a semilogarithmic graph. Above the TNFalpha -stimulated bar is the fold activation of the Luciferase activity by TNFalpha (fold: activity of stimulated divided by activity of unstimulated). (B) Site mutations of NF-kappa B, NF-IL6, and AP-1 sites in the context of the -162hIL-8/LUC were analyzed for their inducibility by TNFalpha . Shown is the normalized Luciferase activity in a representative transfection (mean ± SD, P < .0001 for all comparisons of unstimulated v stimulated, except triangle NF-kappa B). (C) Multimers of NF-kappa B, NF-IL6, and AP-1 sites ligated upstream of an inert hIL-8 TATA box were analyzed for their inducibility by TNFalpha . As a positive control, the AP-1 multimer was treated for 6 hours with 1 µmol/L phorbol myristyl acetate (PMA). Shown is the normalized Luciferase activity from a representative transfection. TNFalpha stimulated the NF-kappa B multimer, and PMA stimulated the AP-1 multimer (P < .0001 for comparisons of unstimulated v stimulated).

The IL-8 gene promoter contains 3 binding sites for known transcription factors: (1) AP-1, a protein binding between -127 and -119 nt; (2) NF-IL6, a protein that binds between -94 and -81 nt; and (3) NF-kappa B, a protein that binds between -80 and -70 nt.10 We next tested the individual role for each of these sites by producing site-directed mutations in the context of the -162 hIL-8 promoter. As shown in Fig 2B, mutation of the NF-kappa B site completely abolished TNFalpha -inducible transcription. Mutation of the AP-1 site reduced induction by approx 2-fold (from 45-fold to 20-fold), whereas mutation of the NF-IL6 site was silent. These data indicate that although the AP-1 site participates in basal and TNFalpha -inducible activity of the IL-8 promoter, only the NF-kappa B site is absolutely required. To determine whether these sites are independently TNFalpha -inducible, reporter genes containing multimers of either the AP-1, NF-kappa B, or NF-IL6 elements ligated upstream of an inert TATA box were transfected into U937 and stimulated with TNFalpha (Fig 2C). The NF-kappa B multimer was 32-fold inducible by TNF, whereas other sites were not significantly TNF-inducible. Although the AP-1 site was not TNFalpha -inducible, it was strongly induced by the diacylglycerol agonist, phorbol 12-myristate 13-acetate. We conclude that the NF-kappa B site is the only TNFalpha -inducible promoter element in the IL-8 promoter, whose presence is both necessary and sufficient for the TNFalpha transcription.

TNFalpha induces NF-kappa B binding and Ikappa Balpha proteolysis.   One mechanism for NF-kappa B activation is enhanced nuclear DNA binding of the Rel A transactivator subunit. To verify this mechanism, sucrose cushion-purified nuclear extracts from TNFalpha -stimulated U937 cells were assayed for NF-kappa B binding in EMSA (Fig 3A). In control extracts, a constitutive binding activity (C3) was observed. Within 5 minutes stimulation, 2 additional closely comigrating complexes (C1 and C2) were induced to bind that apparently peaked at 30 minutes. Sequence specificity of C1, 2, and 3 complexes is seen by ability of 50-fold molar excess of unlabeled wild-type, but not site mutation, of the NF-kappa B contact points23 to compete for their binding (Fig 3A). Inducible complexes C1 and C2 contain the Rel A transactivating subunit as indicated by ability of Rel A antibody, but not preimmune sera, to selectively attenuate their binding (Fig 3B).




View larger version (148K):
[in this window]
[in a new window]
 
Fig 3. TNFalpha induces NF-kappa B binding and Ikappa Balpha proteolysis. (A) TNFalpha rapidly induces nuclear NF-kappa B Rel A DNA binding. U937 cells unstimulated or stimulated with 20 ng/mL TNFalpha for the indicated times (at top). Cells were lysed, the nuclei were isolated, and subjected to EMSA analysis with a radiolabeled IL-8 NF-kappa B site. The bound complexes (C1-C3) are indicated. Unlabeled duplex wild-type (wt) or mutant NF-kappa B (triangle kappa ) competitors were included where indicated. (B) Antibody interference. EMSA of TNF-stimulated nuclear extract was prepared. Either normal rabbit serum (NRS), anti-p50, or anti-Rel A antibodies were preincubated for 1 hour before the assay as indicated. Asterix is a faint supershifted band. C1 and C2 are completely attenuated by the Rel A antibody. Bottom: lighter exposure. C3, C2, and C1 are attenuated by the p50 antibody. (C) TNFalpha induces time-dependent proteolysis of the Ikappa Balpha protein. Cells unstimulated/stimulated with 20 ng/mL TNFalpha for the indicated times (top) were lysed and the cytosols were prepared. Top panel, Western immunoblot with anti-Ikappa Balpha antibody; bottom panel, Western immunoblot with an anti-beta -actin antibody (internal control).

We and others have shown that Rel A is tethered in the cytoplasm by association with Ikappa Balpha inhibitor, which must be degraded to release Rel A into the nucleus.23,25,26 Western immunoblot of cytoplasmic extracts from control and treated U937 cells was performed to determine changes in steady state Ikappa Balpha protein (Fig 3C). TNFalpha induced a rapid proteolysis of Ikappa Balpha at 5 minutes, followed by its reappearance (due to resynthesis) at 60 minutes. This data indicates NF-kappa B is activated by TNFalpha in a conventional pathway requiring Ikappa Balpha proteolysis.

TNFalpha induces ROS formation.   The precise role of ROS in TNFalpha signaling is controversial.17 Because extracellular oxidants can activate NF-kappa B binding in some cell lines and high concentrations of antioxidants block TNFalpha -induced NF-kappa B activation, NF-kappa B is considered to be an ROS-responsive transcription factor.17,25,27,28 It is, however, unclear whether these pharmacological studies are relevant to hormone-induced cell signaling. To determine whether TNFalpha -induced ROS in U937, we monitored ROS formation by oxidation of DCF, a standard indicator of intracellular oxidation.20 TNFalpha stimulation induced a highly reproducible and significant change in DCF fluorescence, first detectable between 5 and 8 minutes (Fig 4). The plateau in ROS formation was transient, peaking at 2-fold increase in mean fluorescence intensity at 15 minutes, and declined thereafter, even in the continuous presence of hormone. Various concentrations of antioxidants were used in preliminary studies to identify the smallest concentrations that could suppress TNFalpha -induced DCF fluorescence (not shown). We found that 2% (vol/vol) DMSO, 4 mmol/L vitamin C, and 7.5 mmol/L NAC were sufficient to significantly block the inducible ROS formation in U937 cells (Fig 4).


View larger version (21K):
[in this window]
[in a new window]
 
Fig 4. TNFalpha induces intracellular oxidation in U937. DCF-DA-loaded cell cultures were left untreated or stimulated with 20 ng/mL TNFalpha in the absense or presence of pretreatment with antioxidant (2% [vol/vol] DMSO, 7.5 mmol/L NAC, or 4 mmol/L vitamin C; determined to be effective concentrations in preliminary experiments). Mean fluorescence intensity, each point representing 104 cells, is plotted as a function of time. The error bars represent SD from 3 independent experiments. Statistical analysis of the TNFalpha -only stimulated cells (at 12, 15, and 18 minutes) versus unstimulated or versus TNFalpha plus antioxidant, yields P < .0001.

Antioxidants block IL-8 gene expression.   Identification of the minimum effective dose of antioxidants enabled us to test whether TNFalpha stimulation of IL-8 gene expression is mediated by ROS. To determine whether antioxidants interfere with TNFalpha -induced IL-8 expression, IL-8 protein secretion from DMSO-pretreated cells was measured by ELISA. The presence of 2% DMSO significantly interfered with over 90% of inducible IL-8 secretion without affecting cell viability or cell number (Fig 5A).




View larger version (52K):
[in this window]
[in a new window]
 
Fig 5. TNFalpha stimulation of IL-8 is dependent on intracellular oxidation. (A) Inducible IL-8 protein secretion is sensitive to DMSO. Triplicate cultures of U937 cultures were untreated (control) or stimulated with 20 ng/mL TNFalpha in the absence or presence of 2% (vol/vol) DMSO. At indicated times, cell culture supernatants were harvested and immunoreactive IL-8 determined by ELISA. Shown is the mean ± SD of n = 3 independent experiments (for both time points shown, P < .0001 for nonpretreated v pretreated with 2% (vol/vol) DMSO). (B) DMSO causes a dose-dependent inhibition of TNFalpha -inducible IL-8 mRNA. Cells were unstimulated/stimulated with 20 ng/mL TNFalpha (1 hour) in the absense/presence of DMSO of indicated concentrations (vol/vol). Cells were lysed and the total RNA subject to Northern analysis by hybridization with a hIL-8 cDNA probe (top) and an 18S cDNA probe (bottom) as an internal control. (C) DMSO causes a dose-dependent inhibition of TNFalpha -inducible IL-8 promoter activity. Triplicate cell cultures were transfected with the -162 IL-8/LUC reporter plasmid and an SV40/alkaline phosphatase plasmid as an internal control. Cells were unstimulated/stimulated with 20 ng/mL TNFalpha in the absence or presence of indicated concentrations of DMSO (in % [vol/vol]). Fold-induction of the Luciferase activity of stimulated (calculated from unstimulated) cells is shown (P < .0001 for stimulated v pretreated with 2% (vol/vol) DMSO before stimulation.

Northern blot analysis to assay changes in endogenous IL-8 expression was next performed in U937 cells stimulated in the presence of increasing concentrations of DMSO. Compared with TNFalpha alone, treatment with 0.4% DMSO inhibited IL-8 mRNA induction by 35% and treatment with 2% DMSO inhibited IL-8 induction by 85% (Fig 5B). This apparently was not a nonspecific effect because steady state levels of 18S RNA and total cell number were unchanged (not shown).

To determine whether the antioxidant effect influenced IL-8 gene expression at the transcriptional level, the same experiment was conducted in U937 cells transiently transfected with the -162 hIL-8/LUC reporter gene. A similar inhibition was seen; treatment with 0.4% DMSO inhibited TNFalpha -inducible IL-8 induction by 40%, and treatment with 2% DMSO inhibited IL-8 induction by 90% (Fig 5C). These data indicate the antioxidant effect occurs by interference of TNFalpha -inducible transcription.

Identification of antioxidant sensitive site on the IL-8 promoter.   The effect of DMSO on transcription could be through interference of the AP-1 or NF-kappa B activities. Transient transfections of hIL-8/LUC 5' deletions were next tested to localize the DMSO effect. All of the 5' deletions that were TNFalpha inducible, including the -99 hIL-8/LUC (that contains only the NF-kappa B site), were potently inhibited by DMSO (over 90%) and therefore antioxidant sensitive (Fig 6A). Site mutations of NF-kappa B, AP-1, and NF-IL6 were similarly tested (Fig 6B). All mutations containing the NF-kappa B site were inhibited more than 80%, while mutation at the NF-kappa B site abolished both inducibility by TNFalpha and sensitivity to DMSO. Finally, multimers of each element were tested (Fig 6C). No significant inhibition of reporter gene activity driven by NF-IL6 or AP-1 was seen; only the NF-kappa B site was inhibited by treatment with 2% DMSO (90% inhibition). Taken together, these data indicate antioxidant effect is predominantly mediated by interference with NF-kappa B transcriptional activity.




View larger version (41K):
[in this window]
[in a new window]
 
Fig 6. Antioxidant effect maps to the NF-kappa B element. (A) Serial 5' deletions of the IL-8 promoter analyzed for their DMSO-sensitivity. Triplicate cell cultures were transfected with the indicated IL-8/LUC reporter plasmids and an SV40/alkaline phosphatase plasmid as an internal control. Cells were unstimulated/stimulated with 20 ng/mL TNFalpha in the absence or presence of 2% (vol/vol) DMSO. Fold-induction of the Luciferase activity of stimulated cells is shown (P < .0001 for -99, -162, -1498: nonpretreated v pretreated with 2% (vol/vol) DMSO). (B) DMSO-sensitivity of IL-8 promoter point mutations. Triplicate cell cultures were transfected with the indicated IL-8/LUC reporter plasmids and an SV40/alkaline phosphatase plasmid as an internal control. Cells were unstimulated/stimulated with 20 ng/mL TNFalpha in the absence/presence of 2% (vol/vol) DMSO. Fold-induction of the Luciferase activity of stimulated cells is shown (P < .0001 for nonpretreated v DMSO-pretreated, except triangle NF-kappa B). (C) DMSO effects on IL-8 multimers. Multimers of NF-kappa B, NF-IL6, and AP-1 sites ligated upstream of an inert hIL-8 TATA box were analyzed for their DMSO sensitivity. Triplicate cell cultures were transfected with the indicated IL-8/LUC reporter plasmids and a SV40/alkaline phosphatase plasmid as an internal control. Cells were untreated or stimulated with 20 ng/mL TNFalpha in the absence or presence of 2% (vol/vol) DMSO. Fold-induction of stimulated Luciferase activity is shown (for NF-kappa B multimer nonpretreated v DMSO-pretreated, P < .0001).

We tested whether TNFalpha -inducible proteolysis of Ikappa Balpha is affected by antioxidant concentrations effective in our experiments. Western immunoblots were performed to measure changes in Ikappa Balpha abundance in DMSO-pretreated cells at various doses of TNFalpha (Fig 7A). Surprisingly, Ikappa Balpha was rapidly proteolyzed equivalently in the DMSO-pretreated cells. This indicated that DMSO effect was apparently not mediated by influencing NF-kappa B translocation. To further show this, sucrose cushion-purified nuclear extracts were assayed for steady state changes in Rel A by Western immunoblot assay (Fig 7B). Untreated nuclei contain very low levels of Rel A, whereas nuclear Rel A abundance is strongly induced after TNFalpha -treatment; these data indicate pretreatment with 2% DMSO does not change nuclear Rel A abundance.






View larger version (91K):
[in this window]
[in a new window]
 
Fig 7. DMSO effect is independent of NF-kappa B binding and translocation. (A) Two percent (vol/vol) DMSO pretreatment has no effect on Ikappa Balpha proteolysis. Cells were stimulated with the indicated concentrations of TNFalpha , in the absence or presence of 1 hour pretreatment with 2% (vol/vol) DMSO. Top panel, Western immunoblot with anti-Ikappa Balpha antibody; bottom panel, Western immunoblot with an anti-beta -actin antibody (internal control). (B) Two percent (vol/vol) DMSO pretreatment has no effect on Rel A nuclear translocation. Cells were stimulated with 20 ng/mL TNFalpha , in the absence or presence of 1 hour pretreatment with 2% (vol/vol) DMSO. Nuclei were purified over sucrose cushion and tested by Western immunoblot with anti-Rel A antibody. Sixty-five kD Rel A is strongly induced by TNFalpha in the absence or presence of DMSO. A nonspecific band serves here as an internal control for protein loading (control). (C) Effect of TNFalpha on NF-kappa B binding in the presence of DMSO. Cells were stimulated with increasing concentrations of TNFalpha (indicated at top), in the absence or presence of 1 hour pretreatment with 2% (vol/vol) DMSO. Shown is EMSA analysis of nuclear extracts for binding to radiolabeled NF-kappa B. C1/C2 binding increases proportionally with TNFalpha dose. 0.032 ng/mL TNFalpha yields a 7-fold weaker signal than 20 ng/mL (360,351 v 2,645,248 arbitrary units [a.u.]). In contrast, 2% (vol/vol) DMSO pretreatment does not reduce NF-kappa B binding (2,691,962 a.u.). For nuclear extracts, stimulated with 20 ng/mL TNFalpha , various concentrations of protein were used to determine assay linearity with protein input (compare lanes 7, 6, and 4).  (D) DMSO inhibits IL-8 promoter induction independently of TNFalpha -induced changes in NF-kappa B Rel A DNA binding. Luciferase induction of the IL-8 promoter by the indicated amounts of TNFalpha . Triplicate cell cultures were transfected with the -162 IL-8/LUC reporter plasmid and an SV40/alkaline phosphatase plasmid as an internal control. Cells were unstimulated/stimulated with the indicated doses (in ng/mL) TNFalpha . The fold-induction of Luciferase activity of stimulated cells is shown (P < .005 for all pairwise comparisons). 0.032 ng/mL TNFalpha activates the NF-kappa B-dependent promoter 7-fold weaker than 20 ng/mL. Two percent (vol/vol) DMSO pretreatment reduces TNFalpha -inducible promoter activity by 8-fold. (E) Abundance of TNFalpha -inducible NF-kappa B Rel A binding is not changed by pretreatment with promoter-inhibitory doses of DMSO. Cells unstimulated/stimulated with 20 ng/mL TNFalpha for 15 minutes in the absence or presence of 2% (vol/vol) DMSO. After treatment, nuclear extracts were analyzed for NF-kappa B binding by microaffinity isolation. Shown is the Western immunoblot with rabbit antihuman Rel A polyclonal antibody (NS, nonspecific).

Activation of NF-kappa B DNA binding activity has been reported to be antioxidant-sensitive in some cell systems.17,25,27,28 To determine whether DMSO treatment interfered with Rel A binding, sucrose cushion purified nuclear extracts were analyzed by EMSA (Fig 7C). Under EMSA conditions shown, a linear relationship was observed between TNFalpha dose (up to 20 ng/mL) and C1/C2 binding (cf, lanes 1 to 4). Also, a linear relationship of C1/C2 binding was observed as a function of input nuclear proteins (cf, lanes 7, 6, and 4). However, pretreatment with DMSO had no detectable influence on the magnitude of inducible NF-kappa B DNA binding.

These data indicate that DMSO influenced NF-kappa B-dependent transcription without influencing its DNA binding. To verify this surprising result, transfection studies were conducted to determine the transcriptional dose-response relationship (as for the DNA binding experiment in Fig 7C). As shown in Fig 7D, 2% DMSO inhibited the transcriptional induction of IL-8 by 90%, to a level produced by 0.032 ng/mL TNFalpha . However, the amount of NF-kappa B binding activity in the presence of 2% DMSO is not reduced accordingly (cf, Fig 7C), indicating the transcriptional inhibition is mechanistically separate from inhibition of DNA binding. To further exclude the potential possibility that DMSO interfered with selective recruitment of Rel A transactivator on the NF-kappa B site that might not be detected in EMSA, we performed a 2-step microaffinity isolation/Western immunoblot. In this assay, biotinylated NF-kappa B binding site is used to pull down NF-kappa B proteins that are subsequently detected by Western. We have previously shown that this assay detects NF-kappa B members in a sequence-specific fashion.7 As shown in Fig 7E, TNFalpha strongly induces 65-kD Rel A binding; the abundance of Rel A is not influenced by pretreatment with 2% DMSO. These data indicate the antioxidant DMSO selectively blocks TNFalpha -inducible NF-kappa B transcription without affecting Ikappa Balpha proteolysis, Rel A translocation, or NF-kappa B binding activity.

Antioxidant inhibition of IL-8 expression occurs after Ikappa Balpha proteolysis.   After TNFalpha treatment, Ikappa Balpha proteolysis was complete within 5 minutes (Fig 3C), whereas ROS production was delayed 8 to 15 minutes (Fig 4). This suggests that temporally, the requirement for ROS production in NF-kappa B-activated IL-8 transcription may be after NF-kappa B translocates. If so, posttreatment with DMSO (relative to TNF stimulation) would still interfere with IL-8 gene expression. U937 cells were pre or posttreated with 2% DMSO relative to a 1-hour stimulation with TNFalpha . IL-8 gene expression was quantitated by Northern blot (Fig 8A). We found that delaying DMSO treatment up to 15 minutes after TNFalpha stimulation produced a similar, significant inhibition of IL-8 mRNA induction. Again, the DMSO effect was independent of Ikappa Balpha proteolysis (Fig 8B) or changes in NF-kappa B DNA binding (Fig 8C). These data strongly argue that the antioxidant sensitive pathway is separate and distinct from NF-kappa B translocation.




View larger version (93K):
[in this window]
[in a new window]
 
Fig 8. Antioxidant effect at times subsequent to Ikappa Balpha proteolysis. (A) Effect of posttreatment on TNFalpha -inducible IL-8 mRNA accumulation. Cells were unstimulated or stimulated with 20 ng/mL TNFalpha in the absence or presence of 2% (vol/vol) DMSO. DMSO was administered at the indicated times (before [-] or after [+] TNFalpha administration). (B) Posttreatment with 2% (vol/vol) DMSO has no effect on Ikappa Balpha proteolysis. Cells were unstimulated or stimulated with 20 ng/mL TNFalpha in the absence or presence of 2% (vol/vol) DMSO. DMSO was administered at the indicated times (preceding [-] or succeeding [+] TNFalpha administration). Top panel, Western immunoblot with anti-Ikappa Balpha antibody; bottom panel, Western immunoblot with an anti-beta -actin antibody (internal control). (C) Pre or posttreatment with 2% (vol/vol) DMSO has no effect on Rel A DNA binding in EMSA. Cells were unstimulated/stimulated with 20 ng/mL TNFalpha in the absence or presence of 2% (vol/vol) DMSO. DMSO was administered at the indicated times (before [-] or after [+] TNFalpha administration). Nuclei were isolated and subjected to EMSA analysis with a radiolabeled NF-kappa B site. Only bound complexes are shown.

Antioxidants NAC and vitamin C also selectively affect NF-kappa B transcription.   To exclude nonspecific effects of DMSO, other chemically unrelated antioxidants NAC and vitamin C were tested for ability to interfere with TNFalpha -inducible NF-kappa B transcriptional activity. Transient transfection assays using the NF-kappa B multimer /LUC reporter indicated that doses of antioxidants at concentrations that block ROS formation (7.5 mmol/L NAC, 4 mmol/L vitamin C, see Fig 4) similarly significantly block NF-kappa B-dependent transcription (60% by NAC, 85% by vitamin C). These antioxidant effects are independent from changes in NF-kappa B binding as measured in EMSA (not shown). Taken together, these data indicate the requirement of an ROS-dependent activation pathway of NF-kappa B that is distinct from the nuclear translocation pathway responsible for inducible DNA-binding.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In a variety of pathophysiological states initiated by infectious or inflammatory agents, TNFalpha secretion is responsible for activating the cytokine cascade required for appropriate cellular responses in the target tissue. An important cellular target of TNFalpha is the circulating monocyte, wherein TNFalpha induces a program of phenotypic changes required for phagocytosis and by inducing the secretion of other inflammatory mediators, allowing for the recruitment of neutrophils into the target tissue. Specifically, production of IL-8 allows for the activation, demargination, and chemotaxis of neutrophils into the inflamed tissue. This study provides additional mechanistic information to the observations of others where TNFalpha has been shown to induce IL-8 secretion in whole blood, the majority of which is derived from monocytes.2

We observe here that TNFalpha activates IL-8 expression through the participation of 2 regulatory factors. Although both AP-1 and NF-kappa B are required for maximal IL-8 gene expression, only NF-kappa B is truly TNFalpha inducible. In unstimulated cells, NF-kappa B is maintained in an inactive state in the cytoplasm through association with the Ikappa B inhibitors. Dissociation of Rel A from Ikappa B is a prerequisite for Rel A cytoplasmic-to-nuclear translocation.29,30 This is accomplished through a 2-step mechanism, where first the Ikappa Balpha inhibitor is phosphorylated at serine residues 32 and 36 by the ubiquitous Ikappa B kinase, IKK,31 and second the phospho-Ikappa Balpha is polyubiquitinated and proteolyzed through the 26S proteasome.32 Our data shows that Ikappa Balpha proteolysis is a consequence of TNFalpha stimulation in U937 cells and occurs coincidentally with Rel A translocation. The Rel A NF-kappa B subunit is the major TNFalpha -inducible transactivator of the IL-8 promoter in a variety of cell types, including epithelial,7 fibrosarcoma,10 and histiocytic cells (this study). Consistent with these findings, in U937 cells, our antibody interference assays indicate that Rel A is largely responsible for the strongly inducible C1 and C2 complexes (Fig 3A), and microaffinity isolation/Western immunoblot assays indicate Rel A binding is strongly induced after TNFalpha treatment (Fig 7E).

Although Rel A translocation has been thought to be necessary and sufficient for transcriptional activation of IL-8, our observations show that pretreatment with antioxidants dissociates the 2 processes (of translocation and transcriptional activation). Our conclusions are based on the lack of antioxidant effect on inducible changes in steady state Rel A abundance in the nuclear compartment (by Western blot) and the measurement of Rel A binding in microaffinity capture and EMSA assays (Fig 7). It is important to highlight that changes in Rel A binding detected by EMSA correlate linearly with NF-kappa B transcription over the TNFalpha dose-response curve (Fig 7). In this experiment, 0.032 ng/mL TNFalpha activates the NF-kappa B-dependent promoter 7-fold weaker than 20 ng/mL and yields a corresponding 7-fold weaker signal in EMSA analysis. In sharp contrast, 2% (vol/vol)-DMSO pretreatment reduces TNFalpha -inducible promoter activity by 8-fold; this would be expected to reduce NF-kappa B binding by a similar extent (7-fold to 8-fold). However, because no such reduction in NF-kappa B is observed, we interpret the antioxidant effect is clearly independent of changes in Rel A DNA binding activity.

Our study indicates that ROS production is a necessary prerequisite for IL-8 production by TNFalpha through a requirement for the transcriptional function of NF-kappa B. TNFalpha induces ROS production in numerous independent assays, including depletion of antioxidant pools,33 elicitation of Electron Paramagnetic Resonance-detectable 2,2,6,6,-tetramethyl-1-piperidine-n-oxyl decay,34 by 5',5'-dimethylpyrroline-N-oxide spin trapping,35 thiobarbituric acid-detectable lipid peroxidation,36 and DCF oxidation (this study). Importantly, our data indicates that TNFalpha induces Ikappa Balpha proteolysis and ROS production in U937 cells with discrete kinetics. In these cells, Ikappa Balpha proteolysis, Rel A translocation, and NF-kappa B binding occur unmeasurably rapidly (within 5 minutes); however, the kinetics of ROS production are delayed, being first detectable at 8 minutes, with a peak 15 minutes after stimulation. Although this apparent delay may be the consequence of the kinetics of DCF oxidation, this explanation is unlikely for 2 reasons. First, DCF oxidation indicates within seconds an immediate and steep increase in oxidant levels in response to H202-treatment (data not shown and Bass et al20), which shows that the oxidation lag in response to TNFalpha is not a detection artifact. Second, addition of antioxidant (up to) 15 minutes after TNFalpha administration still blocks inducible IL-8 transcription (Fig 8). These observations strongly argue that the ROS transcriptional activation pathway is distinct (temporally and mechanistically) from that involved in NF-kappa B translocation.

Although it is widely appreciated that the transcription factor, NF-kappa B, is activated by pharmacologic doses of oxidants,37 the administration of extracellular oxidants may not faithfully reproduce the kinetics, magnitude, or subcellular compartmentalization of ROS produced as a consequence of hormone receptor activation. For example, addition of extracellular H202 to Jurkat T cells, HeLa cervical carcinoma, L6 skeletal muscle, and other cells is sufficient to induce NF-kappa B translocation.17,37 However, the degree of intracellular oxidation required for NF-kappa B translocation by extracellular H202 is at least an order of magnitude more than that produced by TNFalpha (data not shown; Schmid et al38); these results, therefore, are of uncertain relevance to hormone-induced signaling.

Conversely, other studies have shown that antioxidants inhibit inducible NF-kappa B binding. In murine macrophage cells, 1% DMSO inhibits lipopolysaccharide (LPS)-induced NF-kappa B translocation.39 In another study, almost complete inhibition of TNFalpha -induced Rel A translocation was produced with 10 mmol/L NAC in synovial fibroblasts.40 Previously reported studies of antioxidant inhibition of stimulus-dependent NF-kappa B translocation have been conducted using 20 mmol/L NAC (or higher) and 100 µmol/L pyrrolidine dithiocarbamate.17,25,27 In these studies, antioxidant pretreatment dramatically decreased PMA-, TNFalpha -or H2O2-induced NF-kappa B binding in several cell types, including Jurkat T cells, Ltk-mouse fibroblasts, 70Z/3 mouse pre B cells. The antioxidant effect on NF-kappa B translocation, therefore, appears to be cell-type-dependent and stimulus-dependent.

As a specific example, NAC concentrations that inhibited TNFalpha -induced NF-kappa B binding in Jurkat T cells fail to inhibit it in endothelial cells.36 Also, although IL-1beta caused ROS formation and antioxidant-sensitive NF-kappa B translocation in 70Z/3 lymphoid cells, in ovarian carcinoma (OVCAR-3) epithelial cells, IL-1beta failed to cause detectable ROS formation and activates NF-kappa B translocation in antioxidant-insensitive manner.41 These studies indicate the existence of ROS-dependent pathway(s) for NF-kappa B translocation are found in a cell-type restricted manner. Our observations indicate the presence of an antioxidant-sensitive signalling pathway in U937 cells; this pathway is sensitive to low doses of antioxidants that inhibit inducible, but not constitutive, ROS production and functions at a level independently of NF-kappa B translocation.

Along with this study, several lines of evidence are consistent with the existence of an independent NF-kappa B activating pathway. For example, translocation of NF-kappa B has been shown insufficient for IL-1beta or TNFalpha -induced NF-kappa B-dependent transcription in airway epithelial cells.42 In that study, NF-kappa B-dependent transcription, but not translocation, was blocked by pretreatment with protein kinase inhibitors of the p38 and MAP kinases. However, the relationship of the MAP kinase cascade to ROS production was unexplored and will require further investigation. In another study, DMSO interfered with LPS-induced liver cytokine expression through a mechanism that could not be readily explained by the slight attenuation DMSO caused on NF-kappa B translocation.43 We speculate that the ROS signalling pathway could affect posttranslational modification of Rel A, the recruitment of coactivators to the IL-8 promoter, or the assembly of an NF-kappa B driven preinitiation complex.7 One inducible event that is clearly distinct from the nuclear translocation and DNA binding of Rel A is the phosphorylation of Rel A in response to TNFalpha ,44 LPS,45 and PMA.46 Intriguingly, LPS-induced phosphorylation of Rel A was completely blocked by an antioxidant.45 Further definition of this pathway will be required experimentally.

In U937, ROS may be important general second messenger signals for cytokine production. Treatment with the potent NF-kappa B activating agent, LPS, also increases intracellular ROS production.47 At low concentrations, the antioxidants pyrrolidine dithiocarbonate (PDTC) and NAC completely blocked LPS-inducible ROS formation, without significant inhibition of NF-kappa B binding (less than 20%).47 The oxidant pathway may be mediating transcriptional activation in several receptor-mediated pathways that activate NF-kappa B. It will be interesting to compare the requirement of other NF-kappa B activating cytokines on ROS signalling.

Antioxidants have been shown effective in reducing IL-8 secretion and the severity of septic shock48 and airway inflammation49 in humans. Identification of the component of signal transduction that is sensitive to antioxidants will open the door to more selective treatment of inflammatory disorders without occurrence of side effects that would arise from the complete deactivation of the TNFalpha signaling cascade.


    ACKNOWLEDGMENT

The authors thank D. Wang for the gift of 18S plasmid and the current and previous members of the Brasier Lab for valuable suggestions and ideas.


    FOOTNOTES

Submitted February 4, 1999; accepted May 12, 1999.

Supported in part by Grant No. 1 R01 55630 from the National Heart, Lung and Blood Institute (to A.R.B.), Grant No. 1 R01 AI40218 from the National Institute of Allergy and Infectious Diseases (to A.R.B.), and Grant No. ES06676 from the National Institute of Environmental Health Sciences (to R.S. Lloyd). A.R.B. is an Established Investigator of the American Heart Association.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

Address reprint requests to Allan R. Brasier, MD, M.R.B. 8.138, University of Texas Medical Branch, 301 University Blvd, Galveston, TX 77555-1060; e-mail: arbrasie{at}utmb.edu.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Beutler B: TNF, immunity and inflammatory disease: Lessons of the past decade. J Invest Med 43:227, 1995[Medline] [Order article via Infotrieve]

2. Fujishima S, Hoffman AR, Vu T, Kim KJ, Zheng H, Daniel D, Kim Y, Wallace EF, Larrick JW, Raffin TA: Regulation of neutrophil interleukin-8 gene expression and protein secretion by LPS, TNF-alpha, and IL-1 beta. J Cell Physiol 154:478, 1993[Medline] [Order article via Infotrieve]

3. Smith CA, Farrah T, Goodwin RG: The TNF receptor superfamily of cellular and viral proteins: Activation, costimulation, and death. Cell 76:959, 1994[Medline] [Order article via Infotrieve]

4. Tartaglia LA, Rothe M, Hu YF, Goeddel DV: Tumor necrosis factor's cytotoxic activity is signaled by the p55 TNF receptor. Cell 73:213, 1993[Medline] [Order article via Infotrieve]

5. Miyamoto K, Matsukawa A, Ohkawara S, Takagi K, Yoshinaga M: IL-8 is involved in homologous TNF alpha-, but not in IL-1 beta-induced neutrophil infiltration in rabbits. Inflamm Res 46:472, 1997[Medline] [Order article via Infotrieve]

6. Harada A, Sekido N, Akahoshi T, Wada T, Mukaida N, Matsushima K: Essential involvement of interleukin-8 (IL-8) in acute inflammation. J Leukoc Biol 56:559, 1994[Abstract]

7. Brasier AR, Jamaluddin M, Casola A, Duan W, Shen Q, Garofalo R: A promoter recruitment mechanism for TNFalpha -induced IL-8 transcription in type II pulmonary epithelial cells: Dependence on nuclear abundance of Rel A, NF-kappa B1 and c-Rel transcription factors. J Biol Chem 273:3551, 1998[Abstract/Free Full Text]

8. Garofalo R, Sabry M, Jamaluddin M, Yu RK, Casola A, Ogra PL, Brasier AR: Transcriptional activation of the interleukin-8 gene by RSV infection in alveolar epithelial cells: Nuclear translocation of the Rel A transcription factor as a mechanism producing airway mucosal inflammation. J Virol 70:8773, 1996[Abstract]

9. Kunsch C, Rosen CA: NF-kappa B subunit-specific regulation of the interleukin-8 promoter. Mol Cell Biol 13:6137, 1993[Abstract/Free Full Text]

10. Okamoto S, Mukaida N, Yasumoto K, Horiguchi H, Matsushima K: Molecular mechanism of interleukin-8 gene expression, in Lindley IJD (ed): The Chemokines. New York, NY, Plenum, 1993.

11. Matsushima K, Morishita K, Yoshimura T, Lavu S, Kobayashi Y, Lew W, Appella E, Kung HF, Leonard EJ, Oppenheim JJ: Molecular cloning of a human monocyte-derived neutrophil chemotactic factor (MDNCF) and the induction of MDNCF mRNA by interleukin 1 and tumor necrosis factor. J Exp Med 167:1883, 1988[Abstract/Free Full Text]

12. Siebenlist U, Franzoso G, Brown K: Structure, regulation and function of NF-kappa B. Annu Rev Cell Biol 10:405, 1994

13. Khan AU, Wilson T: Reactive oxygen species as cellular messengers. Chem Biol 2:437, 1995[Medline] [Order article via Infotrieve]

14. Sundaresan M, Yu Z-X, Ferrans V, Irani K, Finkel T: Requirement for generation of H202 for platelet-derived growth factor signal transduction. Science 270:296, 1995[Abstract/Free Full Text]

15. Lo YY, Cruz TF: Involvement of reactive oxygen species in cytokine and growth factor induction of c-fos expression in chondrocytes. J Biol Chem 270:11727, 1995[Abstract/Free Full Text]

16. DeForge LE, Preston AM, Takeuchi E, Kenney J, Boxer LA, Remick DG: Regulation of interleukin 8 gene expression by oxidant stress. J Biol Chem 268:25568, 1993[Abstract/Free Full Text]

17. Ginn-Pease ME, Whisler RL: Redox signals and NF-kappa B activation in T cells. Free Rad Biol Med 25:346, 1998[Medline] [Order article via Infotrieve]

18. Anderson CL: Isolation of the receptor for IgG from a human monocyte cell line (U937) and from human peripheral blood monocytes. J Exp Med 156:1794, 1982[Abstract/Free Full Text]

19. Biswas P, Delfanti F, Bernasconi S, Mengozzi M, Cota M, Polentarutti N, Mantovani A, Lazzarin A, Sozzani S, Poli G: Interleukin-6 induces monocyte chemotactic protein-1 in peripheral blood mononuclear cells and in the U937 cell line. Blood 91:258, 1998[Abstract/Free Full Text]

20. Bass DA, Parce JW, Dechatelet LR, Szejda P, Seeds MC, Thomas M: Flow cytometric studies of oxidative product formation by neutrophils: A graded response to membrane stimulation. J Immunol 130:1910, 1983[Abstract]

21. Virca GD, Northemann W, Shiels BR, Widera G, Broome S: Simplified northern blot hybrdization using 5% sodium dodecyl sulfate. Biotechniques 8:370, 1990[Medline] [Order article via Infotrieve]

22. Brasier AR: Nonisotopic assays for reporter gene activity, in Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (eds): Current Protocols in Molecular Biology. New York, NY, Wiley, 1995, p 1:9.7.12.

23. Han Y, Brasier AR: Mechanism for biphasic Rel A:NF-kappa B1 nuclear translocation in tumor necrosis factor alpha -stimulated hepatocytes. J Biol Chem 272:9823, 1997

24. Jamaluddin M, Garofalo R, Ogra PL, Brasier AR: Inducible translational regulation of the NF-IL6 transcription factor by respiratory syncytial virus infection in pulmonary epithelial cells. J Virol 70:1554, 1996[Abstract]

25. Baeuerle PA, Henkel T: Function and activation of NF-kappa B in the immune system. Ann Rev Immunol 12:141, 1994[Medline] [Order article via Infotrieve]

26. Jamaluddin M, Casola A, Garofalo RP, Han Y, Elliott T, Ogra PL, Brasier AR: The major component of Ikappa Balpha proteolysis occurs independently of the proteasome pathway in respiratory syncytial virus-infected pulmonary epithelial cells. J Virol 72:4849, 1998[Abstract/Free Full Text]

27. Schreck R, Rieber P, Baeuerle PA: Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-kappa B transcription factor and HIV-1. EMBO J 10:2247, 1991[Medline] [Order article via Infotrieve]

28. Israel N, Gougerot Pocidalo MA, Aillet F, Virelizier JL: Redox status of cells influences constitutive or induced NF-kappa B translocation and HIV long terminal repeat activity in human T and monocytic cell lines. J Immunol 149:3386, 1992[Abstract]

29. Rice NR, Ernst MK: In vivo control of NF-kappa B activation by Ikappa B alpha. EMBO J 12:4685, 1993[Medline] [Order article via Infotrieve]

30. Traenckner EB-M, Pahl HL, Henkel T, Schmidt KN, Wilk S, Baeuerle PA: Phosphorylation of human Ikappa B-alpha on serines 32 and 36 controls Ikappa B-alpha proteolysis and NF-kappa B activation in response to diverse stimuli. EMBO J 14:2876, 1995[Medline] [Order article via Infotrieve]

31. Maniatis T: Catalysis by a multiprotein IkappaB kinase complex. Science 278:818, 1997[Free Full Text]

32. DiDonato J, Mercurio F, Rosette C, Wu-Li J, Suyang H, Ghosh S, Karin M: Mapping of the inducible Ikappa B phosphorylation sites that signal its ubiquitination and degradation. Mol Cell Biol 16:1295, 1996[Abstract]

33. Singh I, Pahan K, Khan M, Singh AK: Cytokine-mediated induction of ceramide production is redox-sensitive. Implications to proinflammatory cytokine-mediated apoptosis in demyelinating diseases. J Biol Chem 272:20354, 1998

34. Mishra S: A spin decay assay for tumor necrosis factor cytotoxicity. Indian J Biochem Biophys 32:254, 1995[Medline] [Order article via Infotrieve]

35. Meier B, Radeke HH, Selle S, Younes M, Sies H, Resch K, Habermehl GG: Human fibroblasts release reactive oxygen species in response to interleukin-1 or tumour necrosis factor-alpha. Biochem J 263:539, 1989[Medline] [Order article via Infotrieve]

36. Bowie AG, Moynagh PN, O'Neill LAJ: Lipid peroxidation is involved in the activation of NF-kappa B by tumor necrosis factor but not interleukin-1 in the human endothelial cell line ECV304. J Biol Chem 272:25941, 1997[Abstract/Free Full Text]

37. Sen CK, Packer L: Antioxidant and redox regulation of gene transcription. FASEB 10:709, 1996[Abstract]

38. Schmid RM, Liptay S, Betts JC, Nabel GJ: Structural and functional analysis of NF-kappa B. J Biol Chem 269:32162, 1994[Abstract/Free Full Text]

39. Kelly KA, Hill MR, Youkhana K, Wanker F, Gimble JM: Dimethyl sulfoxide modulates NF-kappaB and cytokine activation in lipopolysaccharide-treated murine macrophages. Infect Immun 62:3122, 1994[Abstract/Free Full Text]

40. Sakurada S, Kato T, Okamoto T: Induction of cytokines and ICAM-1 by proinflammatory cytokines in primary rheumatoid synovial fibroblasts and inhibition by N-acetyl-L-cysteine and aspirin. Int Immunol 8:1483, 1996[Abstract/Free Full Text]

41. Bonizzi G, Dejardin E, Piret B, Piette J, Merville MP, Bours V: Interleukin-1beta induces nuclear factor kappa B in epithelial cells independently of the production of reactive oxygen intermediates. Eur J Biochem 242:544, 1996[Medline] [Order article via Infotrieve]

42. Bergmann M, Hart L, Lindsay M, Barnes PJ, Newton R: Ikappa Balpha degradation and nuclear factor-kappa B DNA binding are insufficient for IL-1beta and tumor necrosis factor-alpha -induced kappa B-dependent transcription. J Biol Chem 273:6607, 1998[Abstract/Free Full Text]

43. Essani NA, Fisher MA, Jaeschke H: Inhibition of NF-kappa B activation by dimethyl sulfoxide correlates with suppression of TNF-alpha formation, reduced ICAM-1 gene transcription, and protection against endotoxin-induced liver injury. Shock 7:90, 1997[Medline] [Order article via Infotrieve]

44. Naumann M, Scheidereit C: Activation of NF-kappa B in vivo is regulated by multiple phosphorylations. EMBO J 13:4597, 1994[Medline] [Order article via Infotrieve]

45. Zhong H, SuYang H, Erdjument-Bromage H, Tempst P, Ghosh S: The transcriptional activity of NF-kappa B is regulated by the Ikappa B-associated PKAc subunit through a cyclic AMP-independent mechanism. Cell 89:413, 1997[Medline] [Order article via Infotrieve]

46. Schmitz ML, dos Santos Silva MA, Baeuerle PA: Transactivation domain 2 (tA2) of p65 NF-kappa B. Similarity to TA1 and phorbol ester-stimulated activity and phosphorylation in intact cells. J Biol Chem 270:15576, 1995[Abstract/Free Full Text]

47. Legrand-Poels S, Maniglia S, Boelaert JR, Piette J: Activation of the transcription factor NF-kappa B in lipopolysaccharide-stimulated U937 cells. Biochem Pharmacol 53:339, 1997[Medline] [Order article via Infotrieve]

48. Spapen H, Zhang H, Demanet C, Vleminckx W, Vincent JL, Huyghens L: Does N-acetyl-L-cysteine influence cytokine response during early human septic shock? Chest 113:1616, 1998[Abstract/Free Full Text]

49. Konstan MW: Treatment of airway inflammation in cystic fibrosis. Curr Opin Pulmon Med 2:452, 1996[Medline] [Order article via Infotrieve]


© 1999 by The American Society of Hematology.
 
0006-4971/99/9406-0003$3.00/0

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
A. Cloutier, C. Guindi, P. Larivee, C. M. Dubois, A. Amrani, and P. P. McDonald
Inflammatory Cytokine Production by Human Neutrophils Involves C/EBP Transcription Factors
J. Immunol., January 1, 2009; 182(1): 563 - 571.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Jung, H. Kim, S. H. Min, S. G. Rhee, and W. Jeong
Dynein Light Chain LC8 Negatively Regulates NF-{kappa}B through the Redox-dependent Interaction with I{kappa}B{alpha}
J. Biol. Chem., August 29, 2008; 283(35): 23863 - 23871.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
C. Thompson, S. McMahon, Y. Bosse, C. M. Dubois, J. Stankova, and M. Rola-Pleszczynski
Leukotriene D4 Up-Regulates Furin Expression through CysLT1 Receptor Signaling
Am. J. Respir. Cell Mol. Biol., August 1, 2008; 39(2): 227 - 234.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. E. Nowak, B. Tian, M. Jamaluddin, I. Boldogh, L. A. Vergara, S. Choudhary, and A. R. Brasier
RelA Ser276 Phosphorylation Is Required for Activation of a Subset of NF-{kappa}B-Dependent Genes by Recruiting Cyclin-Dependent Kinase 9/Cyclin T1 Complexes
Mol. Cell. Biol., June 1, 2008; 28(11): 3623 - 3638.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Thompson, A. Cloutier, Y. Bosse, C. Poisson, P. Larivee, P. P. McDonald, J. Stankova, and M. Rola-Pleszczynski
Signaling by the Cysteinyl-Leukotriene Receptor 2: INVOLVEMENT IN CHEMOKINE GENE TRANSCRIPTION
J. Biol. Chem., January 25, 2008; 283(4): 1974 - 1984.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
J. S. Gray and J. J. Pestka
Transcriptional Regulation of Deoxynivalenol-Induced IL-8 Expression in Human Monocytes
Toxicol. Sci., October 1, 2007; 99(2): 502 - 511.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. Wagoner, M. Austin, J. Green, T. Imaizumi, A. Casola, A. Brasier, K. S. A. Khabar, T. Wakita, M. Gale Jr., and S. J. Polyak
Regulation of CXCL-8 (Interleukin-8) Induction by Double-Stranded RNA Signaling Pathways during Hepatitis C Virus Infection
J. Virol., January 1, 2007; 81(1): 309 - 318.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
C. Thompson, A. Cloutier, Y. Bosse, M. Thivierge, C. L. Gouill, P. Larivee, P. P. McDonald, J. Stankova, and M. Rola-Pleszczynski
CysLT1 Receptor Engagement Induces Activator Protein-1- and NF-{kappa}B-Dependent IL-8 Expression
Am. J. Respir. Cell Mol. Biol., December 1, 2006; 35(6): 697 - 704.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Jamaluddin, S. Choudhary, S. Wang, A. Casola, R. Huda, R. P. Garofalo, S. Ray, and A. R. Brasier
Respiratory Syncytial Virus-Inducible BCL-3 Expression Antagonizes the STAT/IRF and NF-{kappa}B Signaling Pathways by Inducing Histone Deacetylase 1 Recruitment to the Interleukin-8 Promoter
J. Virol., December 15, 2005; 79(24): 15302 - 15313.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Xing and D. G. Remick
Mechanisms of Dimethyl Sulfoxide Augmentation of IL-1{beta} Production
J. Immunol., May 15, 2005; 174(10): 6195 - 6202.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Tian, D. E. Nowak, M. Jamaluddin, S. Wang, and A. R. Brasier
Identification of Direct Genomic Targets Downstream of the Nuclear Factor-{kappa}B Transcription Factor Mediating Tumor Necrosis Factor Signaling
J. Biol. Chem., April 29, 2005; 280(17): 17435 - 17448.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
K. Page, V. S. Hughes, K. K. Odoms, K. E. Dunsmore, and M. B. Hershenson
German Cockroach Proteases Regulate Interleukin-8 Expression via Nuclear Factor for Interleukin-6 in Human Bronchial Epithelial Cells
Am. J. Respir. Cell Mol. Biol., March 1, 2005; 32(3): 225 - 231.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. A. Lekstrom-Himes, D. B. Kuhns, W. G. Alvord, and J. I. Gallin
Inhibition of Human Neutrophil IL-8 Production by Hydrogen Peroxide and Dysregulation in Chronic Granulomatous Disease
J. Immunol., January 1, 2005; 174(1): 411 - 417.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
K. A. Ryan, M. F. Smith Jr., M. K. Sanders, and P. B. Ernst
Reactive Oxygen and Nitrogen Species Differentially Regulate Toll-Like Receptor 4-Mediated Activation of NF-{kappa}B and Interleukin-8 Expression
Infect. Immun., April 1, 2004; 72(4): 2123 - 2130.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
C. T. D'Angio, M. B. LoMonaco, C. J. Johnston, C. K. Reed, and J. N. Finkelstein
Differential roles for NF-{kappa}B in endotoxin and oxygen induction of interleukin-8 in the macrophage
Am J Physiol Lung Cell Mol Physiol, January 1, 2004; 286(1): L30 - L36.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Baraldo, D. S. Faffe, P. E. Moore, T. Whitehead, M. McKenna, E. S. Silverman, R. A. Panettieri Jr., and S. A. Shore
Interleukin-9 influences chemokine release in airway smooth muscle: role of ERK
Am J Physiol Lung Cell Mol Physiol, June 1, 2003; 284(6): L1093 - L1102.
[Abstract] [Full Text] [PDF]


Home page
Recent Prog Horm ResHome page
B. Tian and A. R. Brasier
Identification of a Nuclear Factor Kappa B-dependent Gene Network
Recent Prog. Horm. Res., January 1, 2003; 58(1): 95 - 130.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. Li, S. Kartha, S. Iasvovskaia, A. Tan, R. K. Bhat, J. M. Manaligod, K. Page, A. R. Brasier, and M. B. Hershenson
Regulation of human airway epithelial cell IL-8 expression by MAP kinases
Am J Physiol Lung Cell Mol Physiol, October 1, 2002; 283(4): L690 - L699.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. Zoll, W. J. G. Melchers, J. M. D. Galama, and F. J. M. van Kuppeveld
The Mengovirus Leader Protein Suppresses Alpha/Beta Interferon Production by Inhibition of the Iron/Ferritin-Mediated Activation of NF-{kappa}B
J. Virol., August 28, 2002; 76(19): 9664 - 9672.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
M. Hellmuth, C. Wetzler, M. Nold, J.-H. Chang, S. Frank, J. Pfeilschifter, and H. Muhl
Expression of interleukin-8, heme oxygenase-1 and vascular endothelial growth factor in DLD-1 colon carcinoma cells exposed to pyrrolidine dithiocarbamate
Carcinogenesis, August 1, 2002; 23(8): 1273 - 1279.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
V. Pentikainen, L. Suomalainen, K. Erkkila, E. Martelin, M. Parvinen, M. O. Pentikainen, and L. Dunkel
Nuclear Factor-{kappa}B Activation in Human Testicular Apoptosis
Am. J. Pathol., January 1, 2002; 160(1): 205 - 218.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
Y. Zhang, B. A. Luxon, A. Casola, R. P. Garofalo, M. Jamaluddin, and A. R. Brasier
Expression of Respiratory Syncytial Virus-Induced Chemokine Gene Networks in Lower Airway Epithelial Cells Revealed by cDNA Microarrays
J. Virol., October 1, 2001; 75(19): 9044 - 9058.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. Jamaluddin, S. Wang, R. P. Garofalo, T. Elliott, A. Casola, S. Baron, and A. R. Brasier
IFN-{beta} mediates coordinate expression of antigen-processing genes in RSV-infected pulmonary epithelial cells
Am J Physiol Lung Cell Mol Physiol, February 1, 2001; 280(2): L248 - L257.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Ryu, H. Pyo, I. Jou, and E. Joe
Thrombin Induces NO Release from Cultured Rat Microglia via Protein Kinase C, Mitogen-activated Protein Kinase, and NF-kappa B
J. Biol. Chem., September 22, 2000; 275(39): 29955 - 29959.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. H. Boulares, A. J. Zoltoski, A. Yakovlev, M. Xu, and M. E. Smulson
Roles of DNA Fragmentation Factor and Poly(ADP-ribose) Polymerase in an Amplification Phase of Tumor Necrosis Factor-induced Apoptosis
J. Biol. Chem., October 5, 2001; 276(41): 38185 - 38192.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vlahopoulos, S.
Right arrow Articles by Brasier, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vlahopoulos, S.
Right arrow Articles by Brasier, A. R.
Related Collections
Right arrow Chemokines, Cytokines, and Interleukins
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1999 by American Society of Hematology         Online ISSN: 1528-0020