|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 6 (September 15), 1999:
pp. 1890-1898
Macrophage-Derived Chemokine Is Localized to Thymic Medullary
Epithelial Cells and Is a Chemoattractant for CD3+,
CD4+, CD8low Thymocytes
By
David Chantry,
Paola Romagnani,
Carol J. Raport,
Christi L. Wood,
Angela Epp,
Sergio Romagnani, and
Patrick W. Gray
From ICOS Corp, Bothell, WA; and the Department of Clinical
Physiopathology, Endocrinology Unit, and the Institute of Internal
Medicine and Immunoallergy, University of Florence, Italy.
 |
ABSTRACT |
Macrophage-derived chemokine (MDC) is a recently identified CC
chemokine that is a potent chemoattractant for dendritic cells, natural
killer (NK) cells, and the Th2 subset of peripheral blood T cells. In
normal tissues, MDC mRNA is expressed principally in the thymus.
Immunohistochemical analysis performed on 5 human postnatal thymuses
showed high MDC immunoreactivity, which was selectively localized to
epithelial cells within the medulla. To examine the effects of MDC on
immature T cells, we have identified cDNA clones for mouse and rat MDC.
Expression of MDC in murine tissues is also highly restricted, with
significant levels of mRNA found only in the thymus. Thymocytes express
high-affinity binding sites for MDC (kd = 0.7 nmol/L),
and, in vitro, MDC is a chemoattractant for these cells. MDC-responsive
murine thymocytes express mRNA for CCR4, a recently identified receptor
for MDC. Phenotypic analysis of MDC-responsive cells shows that they
are enriched for a subset of double-positive cells that express high levels of CD3 and CD4 and that have reduced levels of CD8. This subset
of MDC-responsive cells is consistent with the observed expression of
MDC within the medulla, because more mature cells are found there. MDC
may therefore play a role in the migration of T-cell subsets during
development within the thymus.
© 1999 by The American Society of Hematology.
 |
INTRODUCTION |
DURING T-CELL DEVELOPMENT, a complex
differentiation program takes place within the thymus leading to the
generation of mature T lymphocytes.1 These events include
the expression and rearrangement of the T-cell receptor genes and
commitment to the CD4 or CD8 lineage.2 In addition, cells
that recognize foreign antigen in the context of self major
histocompatibility complex (MHC) are expanded (positive
selection), whereas those that respond vigorously to self antigens are
deleted by activation of the apoptotic pathway (negative
selection).3
The mechanisms regulating positive and negative selection have yet to
be fully elucidated. Early studies suggested that cortical epithelial
cells were solely responsible for mediating positive selection,1,3 whereas thymic dendritic cells were
responsible for negative selection.3 It was subsequently
demonstrated that both epithelial and dendritic cells were capable of
mediating negative selection.3 This led to the suggestion
that anatomical constraints within the thymus may place restrictions on
the cell-cell interactions that occur during T-cell
development.4 For example, immature, double-positive T
cells will encounter predominantly epithelial cells in the thymic
cortex. As these cells mature and migrate into the medulla, they will
encounter dendritic cells and thymic macrophages in addition to
medullary epithelial cells.4 The factors that regulate such
selective migration of immature T-cell subsets have not been
extensively characterized.
The migration of mature T cells in the periphery has been more
extensively studied and is regulated, in large part, by chemokines. Chemokines are a family of secreted proteins that are characterized by
the spacing of 4 conserved cysteines.5-7 In the CC branch of the chemokine family, the first 2 cysteines are juxtaposed, whereas
in the CXC branch they are separated by a nonconserved residue. CC
chemokines are chemoattractants for monocytes, T cells, eosinophils,
and mast cells,8 whereas the CXC chemokines act principally
on neutrophils.5
Many chemokines are constitutively expressed in the thymus, including
TARC,9 TECK,10 PARC11
(also known as DC-CK-112), IP-10,13
I-309,14 and macrophage-derived chemokine
(MDC),15,16 suggesting that they may play a role in
thymocyte migration and ultimately thymic development. In addition,
several chemokine receptors are expressed predominantly in the thymus,
including CCR417 and CCR8.14
We identified MDC during the sequencing of randomly selected cDNA
clones from a human macrophage library.15,18 MDC is a potent chemoattractant for dendritic cells, activated natural killer
(NK) cells, and some T cells.15,16,19 We have recently identified CCR4 as a receptor for MDC.19 CCR4 is expressed
by the Th2 subset of mature CD4 T cells20,21; therefore,
MDC may play a role in the selective migration of these cells in
conditions such as allergic inflammation that are mediated by Th2 cells.
In normal human tissues, MDC and its receptor CCR4 are expressed almost
exclusively in the thymus, potentially playing a role in the migration
of immature T cells. To further investigate the role of MDC in T-cell
development, we have examined the localization of MDC in the postnatal
human thymus. Furthermore, we have identified cDNA clones for both
mouse and rat MDC to examine the phenotype of murine thymocytes that
respond to MDC.
 |
MATERIALS AND METHODS |
Mice.
Single-cell suspensions of thymocytes from female BALB/c mice (3 to 6 weeks old) were prepared by grinding freshly isolated thymuses between
frosted glass slides. Fibrous tissue was removed by filtration through
a 100-µm sterile cell strainer (VWR Scientific Products, Brisbane,
CA). Cells were pelleted by centrifugation at 1,200 rpm for 5 minutes
and resuspended in buffer (0.15 mol/L NH4Cl, 10 mmol/L
KHCO3, and 0.1 mmol/L EDTA, pH 7.2) for red blood cell
lysis. Cell viability was determined by trypan blue exclusion and was
always greater than 95%. Cell suspensions from at least 4 animals were
combined for each experiment.
Human thymuses.
Normal postnatal thymus specimens were obtained from 5 children during
corrective cardiac surgery at the Apuano Pediatric Hospital of Massa
Carrara, Italy. The 5 children were 5 days, 7 days, 5 months, 3 years,
and 8 years of age, respectively. The procedures followed in the study
were in accordance with the ethical standards of the responsible
regional committee on human experimentation.
Production of antibodies to MDC.
Monoclonal antibodies 252Y, 252Z, and 272D were generated by immunizing
mice with synthetic human MDC according to standard protocols.22 Each hybridoma was cloned twice
by limiting dilution and isotyped using the Isostrip system (Boehringer
Mannheim, Indianapolis, IN). Based on the capacity of these monoclonals
to compete with one another for binding to MDC, 252Y and 252Z recognize
common or overlapping epitopes, whereas 272D recognizes an epitope that is distinct from that recognized by 252Y and 252Z (M. Fahning, unpublished observations). Polyclonal antibodies to mouse
MDC were generated by immunizing rabbits with synthetic mouse MDC coupled to KLH.
Immunohistochemical analysis.
Immunohistochemical staining was performed on 10-µm cryostat sections
fixed in 4% paraformaldehyde for 20 minutes or in acetone for 10 minutes. Sections were subsequently exposed to 0.3% hydrogen peroxide-methanol solution to quench endogenous peroxidase activity. After 30 minutes of preincubation with normal horse serum (Vectastain ABC kit; Vector Laboratories, DBA, Milan, Italy), sections were incubated for 30 minutes with anti-MDC monoclonal antibodies (252Y, 252Z, and 272D; 5 µg/mL), followed by biotinylated antimouse IgG antibody and the avidin-biotin-peroxidase complex as
described.23 3-Amino-9-ethylcarbazole (AEC) was used as a
peroxidase substrate. Finally sections were counterstained with Gill's
hemotoxylin and mounted with Kaiser's glycerol-gelatin. All
incubations were performed at room temperature. As a negative control,
primary antibody was replaced with an isotype matched antibody with
irrelevant specificity or mouse ascites fluid.
Double immunostaining was performed with anti-MDC (252Z; 5 µg/mL) and
anti-pan-T (anti-CD3; 5 µg/mL; Ancell, Bayport, MN) or
macrophage-associated antigen mannose receptor
(anti-PAM-124; 5 µg/mL) or anti-pan cytokeratin (C-11;
0.5 µg/mL; Sigma Immunochemical, Milan, Italy) antibody, using the
avidin-biotin-peroxidase system with 2 different substrates, as
previously described.23 To identify expression of CD3 and
MDC or PAM-1 and MDC on the same section, the AEC (red) and the Vector
SG (blue-gray) substrates were used, respectively. No counterstain was applied.
Isolation of cDNA clones for mouse and rat MDC.
cDNA libraries from mouse and rat thymus were purchased from Stratagene
(La Jolla, CA). Libraries were screened using a gel-purified fragment
encompassing the complete coding region of human MDC. The fragment was
labeled by random priming using the Random Prime cDNA Labeling Kit
(Boehringer Mannheim) according to the manufacturer's instructions.
One million clones from each library were hybridized in 5× SSC,
5× Denhardt's solution, 1% sodium dodecyl sulfate (SDS), and
30% formamide at 42°C. After hybridization overnight, filters were
washed in 2× SSC and 0.1% SDS at 50°C. Hybridizing plaques were identified by autoradiography and plaque-purified. In vivo excision of the Bluescript phagemid was performed according to the
manufacturer's instructions (Stratagene).
Computer analysis.
Protein comparisons (see Fig 2) were
performed with the Geneworks program (Intelligenetics, Mountain View, CA).
Preparation of chemokines.
The mature form of murine MDC was chemically synthesized by Gryphon
Sciences (South San Francisco, CA) using t-butyl-oxycarbonyl chemistry
on a peptide synthesizer (model 430A; Applied Biosystems, Foster City,
CA). Lyophilized powder was dissolved at 10 mg/mL in 4 mmol/L HCl and immediately diluted to 0.1 mg/mL in phosphate-buffered saline (PBS) plus 0.1% bovine serum albumen (BSA) for storage at
80°C. Additional chemokines were purchased from Peprotech (Rocky Hill, NJ). Recombinant murine MDC was expressed as a fusion protein with secreted placental alkaline phosphatase (SEAP) as previously described for human MDC.19 The MDC-SEAP
expression plasmid was transfected into COS cells using diethyl
aminoethyl (DEAE)-Dextran followed by 1 minute of treatment with 10%
dimethyl sulfoxide (DMSO).22 Transfected cells
were cultured overnight in Dulbecco's modified Eagle's medium
(DMEM) supplemented with 10% fetal bovine serum (FBS).
Cells were then washed once with calcium- and magnesium-free PBS and
placed in fresh DMEM medium containing 1% FBS. After an additional 3 days of culture, supernatants were collected, filtered through a
0.45-µm membrane, and stored at 4°C. The concentration of
MDC-SEAP was determined based on the specific activity of
SEAP.25
Binding assays.
For saturation binding experiments, 1 × 106
thymocytes were incubated for 1 hour at 4°C in the presence of
increasing concentrations of MDC-SEAP. Assays were performed in a total
volume of 0.2 mL of binding buffer (RPMI 1640 medium containing 25 mmol/L HEPES, pH 7.4, 1% BSA, and 0.02% sodium azide). After
incubation, cells were washed 4 times in binding buffer and lysed in 50 mL of 10 mmol/L Tris-HCl, pH 8.0, and 1% Triton X-100. Samples were
heated to 65°C for 15 minutes to inactivate endogenous cellular
phosphatases, centrifuged to remove cellular debris, and stored at
20°C until assay. Alkaline phosphatase activity in each
sample was determined using the Great Escape Detection kit (Clontech,
Palo Alto, CA) according to the manufacturer's instructions.
Chemotaxis assays.
Approximately 106 freshly isolated thymocytes were
resuspended in 0.1 mL of RPMI 1640 containing 0.5% BSA and loaded into
the upper well of a transwell chamber (3-µm pore size; Costar,
Corning, NY). Chemokine was added in the same buffer to
the lower well in a volume of 0.6 mL. After 4 hours at 37°C, cells
in the lower chamber were collected and counted by
fluorescence-activated cell sorting (FACS). Data are expressed as the
mean number of cells that migrate through the filter. Each experiment
was performed in triplicate at least 3 times, unless otherwise
indicated. Cells that migrated in the absence of MDC served as a
negative control.
FACS analysis.
Phycoerythrin (PE)-conjugated antibodies to mouse CD3 and CD8 and
fluorescein isothiocyanate (FITC)-conjugated antibodies to CD4 were
purchased from Pharmingen (San Diego, CA). For analysis by flow
cytometry, 106 thymocytes were washed once in PBS and
resuspended in 0.1 mL of FACS buffer (RPMI 1640, 1% BSA, and 0.02%
sodium azide). Cells were incubated with 1 µg of anti-CD4-FITC and 1 µg of anti-CD8-PE or 1 µg of anti-CD4-FITC and 1 µg of
anti-CD3-PE for 1 hour on ice. Cells were washed twice in PBS and
resuspended in 0.2 mL of 1% paraformaldehyde in PBS. Analysis was
performed on Becton Dickinson FACscan using Lysis II software (Becton
Dickinson, Mountain View, CA).
Northern analysis.
The expression of murine MDC mRNA was determined by Northern blotting.
Tissue was isolated from normal rats and snap-frozen in liquid
nitrogen. Total RNA was isolated using RNA Stat-60 (Tel-Test "B"
Inc, Friendswood, TX). Total RNA was fractionated on a 0.8% agarose
formaldehyde gel (20 µg per lane) and transferred to nitrocellulose as described.15 The blot was hybridized with the coding
region of rat MDC. The -actin cDNA was from Clontech. Probes were
labeled by random-priming as described for cDNA library screening.
Hybridization (5× SCC, 5× Denhardt's solution, 1% SDS,
and 50% formamide at 42°C) and washing (0.2× SSC and 0.1%
SDS at 50°C) were performed at high stringency.
Reverse transcription-polymerase chain reaction
(RT-PCR).
CCR4 expression in MDC responsive cells was determined by RT-PCR. Total
RNA was isolated from cells that had migrated in response to MDC (cells
were prepared as described for FACS analysis) using RNA Stat-60 (Tel
Test "B" Inc). cDNA was synthesized using the 1st Strand cDNA
Synthesis Kit (Boehringer Mannheim), according to the manufacturer's
instructions, in a total volume of 50 µL. Reactions were performed in
the presence or absence of reverse transcriptase. One tenth of the
resulting cDNA was used as a template in the PCR reaction, using
oligonucleotide primers specific for murine CCR4. The forward primer
was ATGAATGCCACAGAGGTCACAGAC and the reverse primer was
CAAAGCGTCACGGAAGTCTACTAG. Ten microliters of the PCR reaction was
separated on a 1.5% agarose gel. The identity of the amplified
products was confirmed by dideoxy sequencing.
 |
RESULTS |
Immunolocalization of MDC.
To more precisely localize MDC expression within the thymus, 5 postnatal human thymuses were examined using immunohistochemistry. Using monoclonal antibodies specific for human MDC (252Y and 252Z), MDC
reactivity appeared to be selectively localized in cells scattered in
the medullary areas and in the outer walls of Hassal's corpuscles, whereas no MDC-positive cells were found in the cortex (Fig
1A through D). This pattern of MDC immunoreactivity was
confirmed using a monoclonal antibody (272D) that recognizes a
different epitope on MDC to that seen by 252Y and 252Z. No staining of
medullary thymic epithelial cells or Hassal's corpuscles was found by
using an isotype-matched control antibody (data not shown). The nature of MDC-expressing cells in the human thymus was investigated by double
immunostaining CD3 (T cells) or PAM-1 (macrophages and dendritic cells)
or cytokeratin (epithelial cells). Obvious separation was seen between
staining for MDC and staining for CD3 (Fig 1E) or PAM-1 (Fig 1F). In
contrast all MDC-reactive cells also stained positive for cytokeratin
(Fig 1G and H), suggesting that MDC expression within the thymus is
restricted to medullary epithelial cells.

View larger version (109K):
[in this window]
[in a new window]
| Fig 1.
Distribution of MDC in the human thymus. (A)
Selective MDC expression in the medullary areas. The section was
immunostained with anti-MDC monoclonal antibody using the
avidin-biotin-peroxidase method and the AEC substrate (red color;
original magnification × 40). (B) MDC immunostaining in the medulla
is clearly visible in cells of the outer layer of a Hassal's corpuscle
and in the other cells scattered throughout the medulla (red color;
original magnification × 100). (C) High power magnification of cells
scattered in the medulla (shown by arrows) showing MDC immunostaining
(red color; original magnification × 250). (D) High power
magnification of a Hassal's corpuscle showing strong MDC
immunoreactivity (original magnification × 1,000). (E) Double
immunostaining for MDC (blue-gray) and CD3 (red); individual cells
staining for MDC but not CD3 are shown by arrows (original
magnification × 250). (F) Double immunostaining for MDC (blue-gray)
and PAM-1 (red) showing clear cut separation between MDC-positive
Hassal's corpuscles or single cells (arrows) and macrophage dendritic
cells (original magnification × 250). (G) Double immunostaining for
MDC (red) and cytokeratin (blue-gray). Hassal's corpuscles and some
cells staining for both MDC and cytokeratin (purple-brown), as well as
many cells staining for cytokeratin alone (blue-gray) are visible
(original magnification × 250). (H) Higher magnification of medullary
cells showing double immunostaining for MDC and cytokeratin
(purple-brown; indicated by arrows) or cytokeratin alone (blue-gray;
original magnification × 1,000). (A) through (D) were counterstained
with Gill's hematoxylin, whereas no counterstain was applied in (E)
through (H).
|
|
Cloning of murine MDC.
Mouse and rat thymus cDNA libraries were hybridized with a human MDC
probe at low stringency. Three cDNA clones were obtained for mouse MDC
and 2 clones were obtained for rat MDC. In addition, a single sequence
with identity to our mouse MDC clones has been deposited in the
expressed sequence tag (EST) database (Genbank no. AA175762). An
alignment of the predicted mature protein sequence of mouse, rat, and
human MDC is shown in Fig 2. The start of
the mature sequence for rodent MDC is based on comparison with the
human sequence. Mouse, rat, and human MDC are highly conserved around
the predicted signal peptide cleavage site; 11 of the first 13 residues
of the mature protein are completely identical. The start of the mature
protein is also in accord with rules governing signal sequence
cleavage.26

View larger version (19K):
[in this window]
[in a new window]
| Fig 2.
Comparison of the mature forms of mouse, rat, and human
MDC. (A) Residues that are shared with the murine sequences are shown
by (.). (B) Dendrogram analysis illustrating similarity of CC
chemokines. The sequences reported here for mouse and rat MDC have been
deposited with Genbank under the accession numbers AF163477 and
AF163476.
|
|
Over the entire mature protein sequence, mouse and rat MDC are
85% identical and share 65% identity with human MDC. Many of the
amino acid differences between human and rodent MDC are conservative substitutions (eg, Ile to Leu or Lys to Arg). Dendrogram analysis shows
that these genes are more closely related to each other than to any
other CC chemokine family members (Fig 2B).
Tissue expression of murine MDC mRNA.
The expression pattern of MDC was examined in normal rat
tissues by Northern hybridization. As presented in
Fig 3, MDC mRNA could be readily detected
in thymus but not in the other tissues examined (lymph node, brain, and
heart). On prolonged exposure of the autoradiograph (12 days)
expression of MDC could also be detected in lymph node (data not
shown). To confirm the presence and integrity of the RNA samples, the
blot was probed for -actin, which was readily detected in all
tissues.

View larger version (46K):
[in this window]
[in a new window]
| Fig 3.
Northern blot analysis of MDC expression in rat tissues.
Total RNA was isolated from various rat tissues, fractionated on a
formaldehyde agarose gel, and blotted onto nitrocellulose. The blot was
hybridized sequentially with cDNA probes for MDC and -actin. Probe
removal was confirmed between each round of hybridization by
autoradiography. Exposure times were 2 days for MDC and 8 hours for
-actin. The more rapidly migrating species present in heart
represents hybridization of the -actin probe to -actin, which is
the major species of actin present in this tissue.27
|
|
Characterization of the MDC receptor on murine thymocytes.
To investigate the effects of MDC on immature T cells, we initially
examined the specific binding of MDC to mouse thymocytes using a mouse
MDC-SEAP fusion protein. When binding experiments were performed using
increasing concentrations of MDC-SEAP, saturable binding to thymocytes
was observed (Fig 4A). Scatchard analysis showed that the binding was to a single high-affinity site with a
calculated kd of 0.7 nmol/L (shown inset). Binding of MDC-SEAP to mouse
thymocytes could be competed with unlabeled mouse or human MDC. The
IC50 for mouse MDC was approximately 0.5 nmol/L, whereas
that for human MDC was approximately 3.0 nmol/L (Fig 4B).

View larger version (14K):
[in this window]
[in a new window]
| Fig 4.
Binding characteristics of mouse MDC:SEAP to murine
thymocytes. (A) Mouse thymocytes (1 × 106 cells) were
incubated with increasing concentrations of mouse MDC:SEAP. Nonspecific
binding was determined in the presence of 500-fold molar excess of
unlabeled murine MDC. (Inset) Scatchard analyis of the binding data.
(B) Competition binding of mouse or human MDC with mouse MDC:SEAP to
mouse thymocytes.
|
|
Induction of thymocyte chemotaxis by chemokines.
To determine if thymocytes functionally respond to murine MDC,
chemotaxis experiments were performed in which the chemotactic response
of thymocytes to MDC and a panel of 8 additional chemokines was
examined. MDC induced a dose-dependent chemotaxis of freshly isolated
thymocytes, as shown in Fig 5G. The
bell-shaped curve is a chemotactic response that is characteristic of
chemokines. Chemotaxis was detectable at concentrations of MDC as low
as 10 nmol/L (P < .05), although maximal chemotaxis was
observed at 100 nmol/L of MDC (P < .01; Fig
5G). The number of thymocytes that migrated in response to MDC was
relatively small, representing approximately 0.2% of the starting
population. A similar induction of thymocyte chemotaxis was seen in
response to the chemokines ELC and SLC (Fig 5H and I), whereas MCP-4,
RANTES, Lymphotactin, and MIP1 failed to stimulate significant
chemotaxis (Fig 5A, B, C, and F).

View larger version (33K):
[in this window]
[in a new window]
| Fig 5.
Chemotaxis of murine thymocytes to chemokines. Freshly
isolated thymocytes from 3- to 6-week-old BALB/c mice were assayed for
chemotaxis in response to a panel of chemokines. The number of cells
migrating was determined by FACS analysis. All assays were performed on
samples in triplicate; data shown are representative of three to 5 independent experiments. Significant chemotaxis above background is
indicated by *P < .05 or **P < .01.
|
|
To determine whether the observed chemotaxis was due to MDC
or secondary to the induction of other factors, we performed
the following experiment. Murine thymocytes were cultured for 4 hours in the presence of 50 nmol/L MDC. Thymocytes were removed by
centrifugation, and this (MDC-conditioned) media was used to stimulate
the chemotaxis of fresh thymocytes. As shown in
Fig 6A, the chemotactic activityof this
media was inhibited by antibodies to MDC.

View larger version (26K):
[in this window]
[in a new window]
| Fig 6.
MDC acts directly on CCR4 expressing thymocytes. (A) The
migration of thymocytes is MDC-dependent. Freshly isolated thymocytes
from 3- to 6-week-old BALB/c mice were assayed for chemotaxis in
response to murine MDC as follows. Thymocytes were cultured for 4 hours
in the presence of 50 nmol/L MDC, and cells were removed by
centrifugation. The resulting MDC-conditioned media was then used to
stimulate the chemotaxis of fresh thymocytes in the presence or absence
of a neutralizing antibody to MDC. The number of cells migrating was
determined by FACS analysis. All assays were performed on samples in
triplicate; data shown are the mean ± SEM and are representative of 3 independent experiments. (B) Expression of CCR4 by cells that had
migrated in response to MDC was determined by RT-PCR.
|
|
We have previously identified CCR4 as a receptor for human
MDC,19 and both human and murine CCR4 are expressed at high
levels in the thymus.17 RT-PCR analysis was performed to
determine whether thymocytes that had migrated in response to MDC
expressed CCR4. As shown in Fig 6B, CCR4 mRNA was found to be expressed by cells that had migrated in response to MDC.
Phenotypic characterization of MDC and ELC-responsive thymocytes.
Thymocytes were isolated after chemotaxis to MDC or ELC and analyzed by
flow cytometry for the expression of CD4, CD8, and CD3. The majority of
the cells in the thymus (80% to 90%) are CD4+CD8+.4 The
remainder are composed of mature single-positive cells and the
double-negative population, representing cells at the earliest stages
of T-cell development. We observed similar results for the total
thymocyte population, as presented in Fig 7
(upper panels). Thymocytes that had migrated in response to an optimal concentration of MDC (100 nmol/L) were also collected and analyzed. These cells were highly enriched for double-positive thymocytes that
have reduced levels of expression of CD8. Although these cells were
still CD8+, the mean number of CD8 molecules expressed per
cell is reduced, and this is reflected in the reduction in the median
flourescence for the CD8+ marker (from 3,429 fluorescence
units to 311; Fig 7). In addition, the expression of the T-cell
receptor complex (CD3) was augmented in the MDC-responsive population,
because the median fluorescence was increased 8.3-fold (Fig 7, lower
panels). The levels of CD4 were not significantly different between the
total thymocyte population and those cells that had migrated in
response to MDC. Thus, MDC preferentially attracts lineage-committed
thymocytes that are CD3+CD4+CD8low.
In contrast, ELC acts as a chemoattractant for T cells that are at a
more advanced stage of development, causing the selective accumulation
of both single-positive CD4 and CD8 thymocytes in addition to
double-positive cells ( Fig 8).

View larger version (28K):
[in this window]
[in a new window]
| Fig 7.
Phentotypic analysis of MDC-responsive thymocytes. FACS
analysis was performed on thymocytes after chemotaxis towards an
optimal concentration of MDC (100 nmol/L). The upper panels show
staining of freshly isolated thymocytes with CD4 and CD8 or CD3. The
lower panels show staining of thymocytes that had migrated in response
to MDC for the same markers. Data shown are representative of 3 separate experiments.
|
|

View larger version (30K):
[in this window]
[in a new window]
| Fig 8.
Phentotypic analysis of ELC-responsive thymocytes. FACS
analysis was performed on thymocytes after chemotaxis towards an
optimal concentration of ELC (500 nmol/L). The left-hand panel shows
staining of freshly isolated thymocytes with CD4 and CD8, whereas the
right-hand panel shows staining of those thymocytes that had migrated
in response to ELC. Data shown are representative of 3 separate
experiments.
|
|
 |
DISCUSSION |
In an effort to characterize the role of MDC in the thymus, we have
examined its expression by immunocytochemistry. Using different
monoclonal antibodies that recognize nonoverlapping epitopes on MDC,
MDC immunoreactivity was localized to epithelial cells in the medullary
areas of 5 human thymuses (ages ranged from 5 days to 8 years).
Epithelial expression of MDC was unexpected, because we
previously observed MDC expression in macrophages and dendritic
cells.15,18 We cannot exclude the possibility that this
finding may reflect the local accumulation of MDC protein perhaps
associated with epithelial glycosaminoglycans. However, we were unable
to detect MDC immunoreactivity associated with dendritic cells,
macrophages, or T cells in the medulla. The absence of detectable MDC
expression in macrophages and dendritic cells within the thymus may
reflect phenotypic and functional differences between cells
derived in vitro from peripheral blood and those resident within the
thymic microenvironment. MDC may therefore act to attract developing T
lymphocytes towards medullary epithelial cells.
To examine the effects of MDC on the chemotaxis of thymocytes in vitro,
murine thymocytes were studied. cDNA clones for murine MDC were
isolated. Rat and mouse MDC are 85% identical, and they share
approximately 65% identity with the human molecule. Dendrogram analysis confirms that the rat and mouse sequences described here are
more closely related to human MDC than to other CC chemokines. The murine sequences have an identical pattern of in vivo gene expression to that reported for human MDC and interact with CCR4, providing further support that they are murine homologues of MDC.
Binding studies showed interaction of MDC with a single class of
high-affinity receptors present on thymocytes (kd = 0.7 nmol/L). Competition assays demonstrated that the binding of MDC-SEAP to these
cells could be inhibited by mouse and human MDC. The receptor responsible for thymic MDC effects is likely to be CCR4. CCR4 mRNA is
expressed constitutively in the thymus,17 and thymocytes that had migrated in response to MDC expressed CCR4 mRNA. CCR4 is the
only receptor thus far identified for MDC, and murine MDC is
chemotactic for L1.2 cells stably transfected with human CCR4 (data not
shown). Alternatively, other receptors for MDC may yet be
characterized. Consistent with this, macrophages and dendritic cells
express little or no CCR4 and yet respond to MDC by
chemotaxis.15
MDC was shown to be chemotactic for thymocytes, although maximum
chemotaxis was observed at relatively high concentrations (100 nmol/L).
These results are similar to those observed for monocytes,15 but dendritic cells and T cells respond at 1 to 10 nmol/L.15,19 Although it is conceivable that the
primary role of MDC in the thymus is distinct from
chemotaxis,28 we believe this to be unlikely and may
reflect limitations in our in vitro chemotaxis assay. Within the
thymus, MDC may be more efficiently presented to immature T cells,
perhaps in the context of cell surface proteoglycans. This type of
presentation has been described for interleukin-829 and
macrophage inflammatory protein-1 (MIP-1 ).27 It is
noteworthy that the chemokines ELC and SLC, which also stimulated
significant thymocyte chemotaxis, did so at high concentrations greater
than 100 nmol/L. Alternatively, under physiological conditions, the
microenvironment of the thymus may be able to generate high local
concentrations of MDC. This is quite possible, because MDC was first
isolated as a highly abundant cDNA from cultured human
macrophages.15,18
Phenotypic analysis of thymocytes that migrated in response to MDC
showed that they were enriched for double-positive cells that had
reduced the levels of cell surface expression of CD8. In addition,
these cells showed an increase in the density of their T-cell receptor,
CD3. At this latter stage of development, thymocytes, which have been
positively selected, migrate from the cortex into the medulla. Although
we cannot formally exclude species differences in the biological role
of MDC between humans and mice, these findings, together with our
immunolocalization studies on human thymuses, suggests that MDC may act
to attract thymocytes from the cortex into the medulla.1-3
The role of the medulla in T-cell development is poorly
understood,3,4 but it may play an important role in
negative selection.3,4 Cells undergoing apoptosis have been
identified in situ within the thymic medulla,30 and
tolerance to human C-reactive protein by CD4+ T cells is
mediated by medullary thymic epithelium.31 In previous work, we have shown that medullary epithelial cells from human thymus
express high levels of the ligand for CD30 (CD30L).23 CD30
is a member of the tumor necrosis factor (TNF) receptor superfamily and
activation of this receptor by its ligand can lead to activation of the
apoptotic pathway.32 Studies in the mouse have suggested a
role for CD30 in the negative selection of autoreactive T cells within
the thymus.33
The demonstration that MDC acts as a chemoattractant for thymocytes and
is localized to cells in the medulla that express the ligand for CD30
(a potential mediator of apoptosis) suggests that MDC may target
potentially autoreactive T lymphocytes for elimination by activation of
the apoptotic pathway. These findings are consistent with the
hypothesis that medullary epithelial cells play an important role in
the negative selection. MDC is also chemotactic for cells of the
monocyte/macrophage lineage.15,18 Macrophages play an
important role in the phagocytosis and removal of apoptotic cells
within the thymus.34 MDC may also attract macrophages
towards areas where there are apoptotic cells.
However, CD30 expression is restricted to a small number of cells
within the thymus,23,33 and its expression is not
significantly increased in those cells that migrate in response to MDC
(data not shown). This may be due to the transient expression of CD30 during T-cell development.23,33 Alternatively, the effects of MDC as a chemoattractant for immature T cells may not be restricted to those cells that are destined to undergo negative selection. Rather,
MDC may act more broadly to attract thymocytes from the cortex to the medulla.
A number of chemokines are expressed at high levels in the thymus,
including PARC11 (also known as DC-CK112),
TECK,9 I-309,14 and TARC.10 One
possible explanation for the diversity of chemokine expression may be
to control the diversity of cell types within the thymus and to allow
for the complexity of cell movements that occur during T-cell
development. For example, immature T-cell progenitors that originate in
the bone marrow enter the subcapsular region of the thymus; from there,
they migrate into the thymic cortex and then into the medulla before
exiting to the periphery as mature differentiated T
cells.1,3 It is tempting to speculate that the selective
expression of chemokines and their receptors regulate the migration
(and perhaps other properties) of developing T-cell subsets. Consistent
with this, we and others have found that the chemokine ELC acts as a
chemoattractant for T cells that are at a more advanced stage of
development than those that migrate in response to MDC (Fig 8; see also
Ngo et al35). Formal testing of this hypothesis will
require the detailed characterization of the temporal and spatial
pattern of chemokine expression during T-cell development within the
thymus, along with the selective inactivation of these chemokines in
the germline by homologous recombination.
 |
ACKNOWLEDGMENT |
The authors thank Dina Levitan and Marsalina Quiggle for
oligonucleotide synthesis and DNA sequencing, Rick Jasman for FACS analysis, Reyna Simon and Michael Siani (Gryphon Sciences) for chemical
synthesis of murine MDC, and Mitch Fahning for monoclonal antibody
preparation and characterization.
 |
FOOTNOTES |
Submitted October 12, 1998; accepted May 13, 1999.
P.R. and S.R. are supported by AIRC and Italian Ministry of Health
(AIDS Project).
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Patrick W. Gray, PhD, ICOS Corp, 22021 20th
Ave SE, Bothell, WA 98021; e-mail: pgray{at}icos.com.
 |
REFERENCES |
1.
Robey E, Fowlkes BJ:
Selective events in T cell development.
Annu Rev Immunol
12:675, 1994[Medline]
[Order article via Infotrieve]
2.
Von Boehmer H:
T cell development: Is Notch a key player in lineage decisions?
Curr Biol
7:308, 1997[Medline]
[Order article via Infotrieve]
3.
Sprent J, Lo D, Gao E-K, Ron Y:
T cell selection in the thymus.
Immunol Rev
101:173, 1988[Medline]
[Order article via Infotrieve]
4.
Punt JA, Havran W, Abe R, Sarin A, Singer A:
T cell receptor (TCR) induced death of immature CD4+CD8+ thymocytes by two distinct mechanisms differing in their requirements for CD28 co-stimulation: Implications for negative selection in the thymus.
J Exp Med
186:1911, 1997[Abstract/Free Full Text]
5.
Oppenheim JJ:
Overview of chemokines.
Adv Exp Med Biol
351:183, 1993[Medline]
[Order article via Infotrieve]
6.
Baggiolini M, Dewald B, Moser B:
Human chemokines: An update.
Annu Rev Immunol
15:675, 1997[Medline]
[Order article via Infotrieve]
7.
Baggiolini M:
Chemokines and leukocyte traffic.
Nature
392:565, 1998[Medline]
[Order article via Infotrieve]
8.
Schall TJ:
Biology of the RANTES/SIS cytokine family.
Cytokine
3:165, 1991[Medline]
[Order article via Infotrieve]
9.
Imai T, Yoshida T, Baba M, Nishimura M, Kakizaki M, Yoshie O:
Molecular cloning of a novel T cell-derived CC chemokine expressed in thymus by signal sequence trap using Epstein-Barr virus vector.
J Biol Chem
271:21514, 1996[Abstract/Free Full Text]
10.
Vicari AP, Figueroa DJ, Hedrck JA, Foster JS, Singh KP, Menon S, Copeland NG, Gilbert DJ, Jenkins NA, Bacon KB, Zlotnik A:
TECK: A novel CC chemokine specifically expressed by thymic dendritic cells and potentially involved in T cell development.
Immunity
7:291, 1997[Medline]
[Order article via Infotrieve]
11.
Hieshima K, Imai T, Baba M, Shouda K, Ishizuki K, Nakagawa T, Tsurata J, Takeya M, Sakaki Y, Takatsuki K, Miura R, Opdenakker G, Damme JV, Yoshie O, Nomiyama H:
A novel human CC chemokine PARC that is most homologous to macrophage-inflammatory protein-1 /LD78 and chemotactic for T lymphocytes, but not for monocytes.
J Immunol
159:1140, 1997[Abstract]
12.
Adema GJ, Hartgers F, Verstraten R, de Vries E, Marland G, Menon S, Foster J, Xu Y, Nooyen P, McClanahan T, Bacon KB, Figdor CG:
A dendritic cell derived CC chemokine that preferentially attracts naive T cells.
Nature
387:713, 1997[Medline]
[Order article via Infotrieve]
13.
Luster A, Leder P:
IP-10, a -C-X-C- chemokine, elicits a potent thymus-dependent antitumor response in vivo.
J Exp Med
178:1057, 1993[Abstract/Free Full Text]
14.
Tiffany HL, Lautens LL, Gao J-L, Pease J, Locati M, Combadiere C, Modi W, Bonner TI, Murphy PM:
Identification of CCR-8: A human monocyte and thymus receptor for the CC chemokine I-309.
J Exp Med
165:165, 1997
15.
Godiska R, Chantry D, Raport CJ, Sozzani S, Allavena P, Leviten D, Mantovani A, Gray PW:
Human macrophage derived chemokine (MDC) a novel chemoattractant for monocytes, monocyte derived dendritic cells, and natural killer cells.
J Exp Med
185:1595, 1997[Abstract/Free Full Text]
16.
Chang M-S, McNinch J, Elias C III, Manthey CL, Grosshans D, Meng T, Andrew DP:
Molecular cloning and functional characterization of a novel CC chemokine, stimulated T cell chemotactic protein (STCP-1) that specifically acts on activated T lymphocytes.
J Biol Chem
272:25229, 1997[Abstract/Free Full Text]
17.
Hoogewerf AJ, Black D, Proudfoot AEI, Wells TNC, Power CA:
Molecular cloning of murine CC CKR-4 and high affinity binding of human chemokines to murine and human CC CKR-4.
Biochem Biophys Res Commun
218:337, 1996[Medline]
[Order article via Infotrieve]
18.
Chantry D, DeMaggio AJ, Brammer H, Raport CJ, Wood CL, Schweickart VL, Epp A, Smith A, Stine JT, Walton K, Tjoelker L, Godiska R, Gray PW:
Profile of human macrophage transcripts: Insights into macrophage biology and identification of novel chemokines.
J Leukoc Biol
64:49, 1998[Abstract]
19.
Imai T, Chantry D, Raport CJ, Wood CL, Nishimura M, Godiska R, Yoshie O, Gray PW:
Macrophage-derived chemokine is a functional ligand for the CC chemokine receptor-4.
J Biol Chem
273:1764, 1998[Abstract/Free Full Text]
20.
Bonecchi BR, Bianchi G, Panina P, D'Ambrosio Lang R, Borsatti A, Sozzani S, Allavena P, Gray PW, Mantovani A, Sinigaglia F:
Differential expression of chemokine receptors and chemotactic responsiveness of Th1 and Th2 cells.
J Exp Med
187:129, 1998[Abstract/Free Full Text]
21.
Sallusto F, Lenig D, Mackay C, Lanzavecchia A:
Flexible programs of chemokine receptor expression on polarized T helper 1 and 2 lymphocytes.
J Exp Med
187:875, 1998[Abstract/Free Full Text]
22.
Sambrook J, Fritsch EF, Maniatis T:
Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1989.
23.
Romagnani P, Annunziato F, Manetti R, Mavilia C, Lasagni L, Manuelli C, Vannelli V, Maggi E, Pupilli C, Romagnani S:
High CD30 ligand expression by epithelial cells and Hassal's corpuscles in the medulla of human thymus.
Blood
91:3323, 1998[Abstract/Free Full Text]
24.
Uccini S, Sirianni MC, Vincenzi L, Stopacciaro A, Lesnoni LA, Parola L, Capuana M, Cerimele D, Cella M, Lanzavecchia A, Allavena P, Mantovani A, Baroni CD, Ruco LP:
Kaposi's sarcoma cells express the macropahge associated antigen mannose receptor and develop in peripheral blood cultures of Kaposi's sarcoma patients.
Am J Pathol
150:929, 1997[Abstract]
25.
Berger J, Hauber J, Hauber R, Geiger R, Cullen B:
Secreted placental alkaline phosphatase: A powerful new quantitative indicator of gene expression in eukaryotic cells.
Gene
66:1, 1988[Medline]
[Order article via Infotrieve]
26.
Von Heijne J:
A new method for predicting signal sequence cleavage sites.
Nucleic Acids Res
14:4683, 1986[Abstract/Free Full Text]
27.
Tanaka Y, Adams DH, Hubscher S, Hirano H, Siebenlist U, Shaw S:
T-cell adhesion induced by proteoglycan-immobilized cytokine MIP-1 beta.
Nature
361:79, 1993[Medline]
[Order article via Infotrieve]
28.
Van Snick J, Houssiau F, Proost P, Renauld J-C:
I-309/T cell activation gene-3 chemokine protects murine T cell lymphomas against dexamethasone induced apoptosis.
J Immunol
157:2570, 1996[Abstract]
29.
Middleton J, Neil S, Wintle J, Clarke-Lewis I, Moore H, Lam C, Auer M, Hub E, Rot A:
Transcytosis and surface presentation of IL-8 by venular endothelial cells.
Cell
91:385, 1997[Medline]
[Order article via Infotrieve]
30.
Surh CD, Sprent J:
T-cell apoptosis detected in situ during positive and negative selection in the thymus.
Nature
372:100, 1994[Medline]
[Order article via Infotrieve]
31.
Klein L, Klein T, Ruther U, Kyewski B:
CD4 T cell tolerance to human C-reactive protein, an inducible serum protein, is mediated by medullary thymic epithelium.
J Exp Med
188:5, 1998[Abstract/Free Full Text]
32.
Gruss HJ, Boiani N, Williams DE, Armitage RJ, Smith CA, Goodwin RG:
Pleitropic effects of the CD30 ligand on CD30-expressing cells and lymphoma cell lines.
Blood
83:2045, 1994[Abstract/Free Full Text]
33.
Amakawa R, Hakem A, Kundig TM, Matsuyama T, Simard IJL, Timms E, Wakeham A, Mittruecker H-W, Griesser H, Takimoto H, Schmits R, Shahinian A, Oshaki PS, Penninger JF, Mak TW:
Impaired negative selection of T cells in Hodgekin's disease antigen CD30-deficient mice.
Cell
84:551, 1996[Medline]
[Order article via Infotrieve]
34.
Anderson G, Moore CN, Owen JTT, Jenkinson EJ:
Cellular interactions in thymic development.
Annu Rev Immunol
14:73, 1996[Medline]
[Order article via Infotrieve]
35.
Ngo VN, Tang HL, Cyster JG:
Epstein-Barr virus-induced molecule 1 ligand chemokine is expressed by dendritic cells in lymphoid tissues and strongly attracts naïve T cells and activated B cells.
J Exp Med
188:181, 1998[Abstract/Free Full Text]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Laan, K. Kisand, V. Kont, K. Moll, L. Tserel, H. S. Scott, and P. Peterson
Autoimmune Regulator Deficiency Results in Decreased Expression of CCR4 and CCR7 Ligands and in Delayed Migration of CD4+ Thymocytes
J. Immunol.,
December 15, 2009;
183(12):
7682 - 7691.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. I. Proietto, S. van Dommelen, P. Zhou, A. Rizzitelli, A. D'Amico, R. J. Steptoe, S. H. Naik, M. H. Lahoud, Y. Liu, P. Zheng, et al.
Dendritic cells in the thymus contribute to T-regulatory cell induction
PNAS,
December 16, 2008;
105(50):
19869 - 19874.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Yin, E. Ladi, S. W. Chan, O. Li, N. Killeen, D. J. Kappes, and E. A. Robey
CCR7 Expression in Developing Thymocytes Is Linked to the CD4 versus CD8 Lineage Decision
J. Immunol.,
December 1, 2007;
179(11):
7358 - 7364.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Gui, X. Zhu, J. Dohkan, L. Cheng, P. F. Barnes, and D.-M. Su
The aged thymus shows normal recruitment of lymphohematopoietic progenitors but has defects in thymic epithelial cells
Int. Immunol.,
October 1, 2007;
19(10):
1201 - 1211.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F Annunziato, L Cosmi, F Liotta, E Lazzeri, P Romagnani, R Angeli, L Lasagni, R Manetti, F Marra, C Gerard, et al.
CXCR3 and {alpha}E{beta}7 integrin identify a subset of CD8+ mature thymocytes that share phenotypic and functional properties with CD8+ gut intraepithelial lymphocytes
Gut,
July 1, 2006;
55(7):
961 - 968.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Pende, R. Castriconi, P. Romagnani, G. M. Spaggiari, S. Marcenaro, A. Dondero, E. Lazzeri, L. Lasagni, S. Martini, P. Rivera, et al.
Expression of the DNAM-1 ligands, Nectin-2 (CD112) and poliovirus receptor (CD155), on dendritic cells: relevance for natural killer-dendritic cell interaction
Blood,
March 1, 2006;
107(5):
2030 - 2036.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. J. Carpenter and C. M. Hogaboam
Immunosuppressive Effects of CCL17 on Pulmonary Antifungal Responses during Pulmonary Invasive Aspergillosis
Infect. Immun.,
November 1, 2005;
73(11):
7198 - 7207.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Jakubzick, H. Wen, A. Matsukawa, M. Keller, S. L. Kunkel, and C. M. Hogaboam
Role of CCR4 Ligands, CCL17 and CCL22, During Schistosoma mansoni Egg-Induced Pulmonary Granuloma Formation in Mice
Am. J. Pathol.,
October 1, 2004;
165(4):
1211 - 1221.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. G. Cronshaw, C. Owen, Z. Brown, and S. G. Ward
Activation of Phosphoinositide 3-Kinases by the CCR4 Ligand Macrophage-Derived Chemokine Is a Dispensable Signal for T Lymphocyte Chemotaxis
J. Immunol.,
June 15, 2004;
172(12):
7761 - 7770.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Efroni, D. Harel, and I. R. Cohen
Toward Rigorous Comprehension of Biological Complexity: Modeling, Execution, and Visualization of Thymic T-Cell Maturation
Genome Res.,
November 1, 2003;
13(11):
2485 - 2497.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Gao, X.-Y. Zhou, Y. Yashiro-Ohtani, Y.-F. Yang, N. Sugimoto, S. Ono, T. Nakanishi, S. Obika, T. Imanishi, T. Egawa, et al.
The unique target specificity of a nonpeptide chemokine receptor antagonist: selective blockade of two Th1 chemokine receptors CCR5 and CXCR3
J. Leukoc. Biol.,
February 1, 2003;
73(2):
273 - 280.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Liu, J. G. Heuer, S. Na, E. Galbreath, T. Zhang, D. D. Yang, A. Glasebrook, and H. Y. Song
Accelerated Onset and Increased Severity of Acute Graft-Versus-Host Disease Following Adoptive Transfer of DR6-Deficient T Cells
J. Immunol.,
October 1, 2002;
169(7):
3993 - 3998.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Zaitseva, T. Kawamura, R. Loomis, H. Goldstein, A. Blauvelt, and H. Golding
Stromal-Derived Factor 1 Expression in the Human Thymus
J. Immunol.,
March 15, 2002;
168(6):
2609 - 2617.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. A. Jopling, I. Sabroe, D. P. Andrew, T. J. Mitchell, Y. Li, M. R. Hodge, T. J. Williams, and J. E. Pease
The Identification, Characterization, and Distribution of Guinea Pig CCR4 and Epitope Mapping of a Blocking Antibody
J. Biol. Chem.,
February 22, 2002;
277(9):
6864 - 6873.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. W. Chensue
Molecular Machinations: Chemokine Signals in Host-Pathogen Interactions
Clin. Microbiol. Rev.,
October 1, 2001;
14(4):
821 - 835.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zhang, B. A. Luxon, A. Casola, R. P. Garofalo, M. Jamaluddin, and A. R. Brasier
Expression of Respiratory Syncytial Virus-Induced Chemokine Gene Networks in Lower Airway Epithelial Cells Revealed by cDNA Microarrays
J. Virol.,
October 1, 2001;
75(19):
9044 - 9058.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Katou, H. Ohtani, T. Nakayama, K. Ono, K. Matsushima, A. Saaristo, H. Nagura, O. Yoshie, and K. Motegi
Macrophage-Derived Chemokine (MDC/CCL22) and CCR4 Are Involved in the Formation of T Lymphocyte-Dendritic Cell Clusters in Human Inflamed Skin and Secondary Lymphoid Tissue
Am. J. Pathol.,
April 1, 2001;
158(4):
1263 - 1270.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Romagnani, F. Annunziato, E. Lazzeri, L. Cosmi, C. Beltrame, L. Lasagni, G. Galli, M. Francalanci, R. Manetti, F. Marra, et al.
Interferon-inducible protein 10, monokine induced by interferon gamma, and interferon-inducible T-cell alpha chemoattractant are produced by thymic epithelial cells and attract T-cell receptor (TCR) {alpha}{beta}+CD8+ single-positive T cells, TCR{gamma}{delta}+ T cells, and natural killer-type cells in human thymus
Blood,
February 1, 2001;
97(3):
601 - 607.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. P. Andrew, N. Ruffing, C. H. Kim, W. Miao, H. Heath, Y. Li, K. Murphy, J. J. Campbell, E. C. Butcher, and L. Wu
C-C Chemokine Receptor 4 Expression Defines a Major Subset of Circulating Nonintestinal Memory T Cells of Both Th1 and Th2 Potential
J. Immunol.,
January 1, 2001;
166(1):
103 - 111.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Mantovani, P. A. Gray, J. Van Damme, and S. Sozzani
Macrophage-derived chemokine (MDC)
J. Leukoc. Biol.,
September 1, 2000;
68(3):
400 - 404.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Annunziato, P. Romagnani, L. Cosmi, C. Beltrame, B. H. Steiner, E. Lazzeri, C. J. Raport, G. Galli, R. Manetti, C. Mavilia, et al.
Macrophage-Derived Chemokine and EBI1-Ligand Chemokine Attract Human Thymocytes in Different Stage of Development and Are Produced by Distinct Subsets of Medullary Epithelial Cells: Possible Implications for Negative Selection
J. Immunol.,
July 1, 2000;
165(1):
238 - 246.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Matsukawa, C. M. Hogaboam, N. W. Lukacs, P. M. Lincoln, H. L. Evanoff, and S. L. Kunkel
Pivotal Role of the CC Chemokine, Macrophage-Derived Chemokine, in the Innate Immune Response
J. Immunol.,
May 15, 2000;
164(10):
5362 - 5368.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. L. Schweickart, A. Epp, C. J. Raport, and P. W. Gray
CCR11 Is a Functional Receptor for the Monocyte Chemoattractant Protein Family of Chemokines
J. Biol. Chem.,
March 24, 2000;
275(13):
9550 - 9556.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|