|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 6 (September 15), 1999:
pp. 1906-1914
Reconstitution of Early Lymphoid Proliferation and Immune Function
in Jak3-Deficient Mice by Interleukin-3
By
Michael P. Brown,
Tetsuya Nosaka,
Ralph A. Tripp,
James Brooks,
Jan M.A. van Deursen,
Malcolm K. Brenner,
Peter C. Doherty, and
James N. Ihle
From the Howard Hughes Medical Institute and the Departments of
Biochemistry, Hematology-Oncology, Immunology, and Genetics, St. Jude
Children's Research Hospital, Memphis, TN; and the Departments of
Pediatrics, Pathology, and Biochemistry, University of Tennessee
Medical School, Memphis, TN.
 |
ABSTRACT |
Expansion of early lymphoid progenitors requires interleukin-7
(IL-7), which functions through  c-mediated receptor
activation of Jak3. Jak3 deficiency is a cause of severe combined
immunodeficiency (SCID) in humans and mice. IL-3 activates many of the
same signaling pathways as IL-7, such as Stat5, but achieves this
effect through the activation of Jak2 rather than Jak3. We hypothesized
that expansion of an IL-7-responsive precursor population through a Jak3-independent pathway using IL-3 may stimulate early lymphoid progenitors and restore lymphopoiesis in Jak3 / mice.
Newborn Jak3/ mice that were injected with IL-3
demonstrated thymic enlargement, a 2- to 20-fold increase in thymocyte
numbers, and up to a 10-fold expansion in the number of
CD4+, CD8+, and
B220+/IgM+ splenic lymphocytes, consistent
with an effect upon an early lymphoid progenitor population. In
contrast to control mice, IL-3-treated Jak3/ mice
challenged with the allogeneic major histocompatibility complex
(MHC) class I-bearing tumor P815 developed a specific CD8-dependent cytotoxic T lymphocyte (CTL) response.
IL-3-treated mice also mounted influenza-specific CTL responses and
survival was prolonged. The beneficial effects of IL-3 are proposed to be produced by stimulation of a lymphoid precursor population of
IL-7R +/IL-3R+ cells that we
identified in wild-type bone marrow. In vitro, we show that an early
IL-7R+ lymphoid progenitor population expresses IL-3R and
proliferates in response to IL-3 and that IL-3 activates Stat5
comparably to IL-7. Clinically, IL-3 may therefore be useful treatment
for X-linked and Jak3-deficient SCID patients who lack bone marrow donors.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
LYMPHOID DEVELOPMENT is regulated by
cytokines, including interleukin-2 (IL-2), IL-4, IL-7, IL-9, and IL-15.
The receptors for these cytokines share the common chain
(c), mutations of which cause the X-linked form of
severe combined immunodeficiency (SCID). This mutation accounts for
approximately half of all cases of SCID.1,2 The
c chain binds the cytoplasmic tyrosine kinase Jak3 and
mediates the activation of Jak3 after ligand binding.3-7 Jak3 mutations occur in an autosomal recessive subset of SCID that
comprises approximately 10% of all cases of
SCID.2,8,9 Defects in signaling via the c
and Jak3 are virtually indistinguishable, as are the phenotypes of
Jak3-deficient and X-linked SCID. The phenotype of Jak3-deficient mice
is similar to that of the human condition, except that a profound B
lymphopenia exists in the mutant mice.10-12
Among the cytokines that use the c-Jak3 pathway, IL-7
plays an essential role in the early development of the lymphoid
lineages. Mutant mice that lack IL-7 or that lack the IL-7-specific
receptor  -chain (IL-7R) also suffer from SCID.13,14
Nonetheless, in all of these murine models of SCID, some lymphoid cells
are generated, and in humans there may be a significant expansion of
lymphoid populations particularly affecting B cells.9,15
These observations have lead us to investigate whether other cytokines
might be able to mediate early lymphoid expansion, even in the absence
of a functional response to the cytokines that use c and
Jak3, and thereby compensate for the severe immunodeficiency associated with mutations in these pathways.
One of the cytokines that had previously been suggested to affect early
progenitors for both the myeloid and lymphoid lineages is
IL-3.16 Indeed, IL-3 was first isolated because of its
inferred role in thymocyte maturation.17 Recent studies of
cytokine signaling have demonstrated a remarkable similarity in the
signaling pathways that are activated. In particular, IL-3 and IL-7
activate virtually identical pathways, although the IL-7 receptor
system requires Jak3, whereas the IL-3 receptor system requires the
highly related Jak2.7,18 Hence, if the receptor for IL-3
was expressed in early lymphoid progenitors, it should allow some
degree of expansion of this population by a Jak2-dependent pathway and
compensate for later failure to expand cells via a Jak3-dependent
pathway. The studies described here demonstrate that IL-3 can
significantly expand early lymphoid progenitors and enhance immune
function in vivo.
| |
MATERIALS AND METHODS |
Mice.
Mice were bred and maintained in the Animal Resources Center of St Jude
Children's Research Hospital (Memphis, TN).
Jak3/ mice were generated by targeted gene
disruption10 and were housed under specific pathogen-free
(SPF) conditions. Age-matched wild-type mice were either
Jak3+/+ mice from the knockout colony or
B6J129SVF2 mice that have a similar genetic background.
SCID mice were BALB/cByJSCID and were also held under SPF conditions.
Antibodies and reagents.
Phycoerythrin (PE)-conjugated monoclonal antibodies (MoAbs) specific
for CD45R/B220 (clone RA3-6B2), CD43 (clone S7), and CD4 (clone RM4-4)
and fluorescein isothiocyanate (FITC)-conjugated MoAbs specific for
c-kit (clone 2B8), CD19 (clone 1D3), CD8 (clone 53-6.7), CD24 (clone
M1/69), BP-1 (clone 6C3), and IgM (clone R6-60.2) were purchased from
PharMingen (San Diego, CA). Unlabeled rat MoAbs specific for IL-7R
chain (clone A7R34) and IL-3R chain (clone 5B11) were kindly
provided by Drs S. Nishikawa19 (Kyoto University, Kyoto, Japan) and by D. Gorman20
(DNAX Research Institute, Palo Alto, CA), respectively.
Anti-IL-7R and IL-3R MoAbs were directly conjugated to R-PE and
Alexa 488 dyes, respectively, according to the manufacturer's
recommendations (Molecular Probes, Eugene, OR). All cytokines were
purchased from R&D Systems (Minneapolis, MN).
[3H]-thymidine was obtained from Amersham Life Sciences
(Cleveland, OH).
Preparation of bone marrow cell suspensions.
Femurs and tibiae were flushed with Hanks' balanced salt solution
(HBSS) containing 10% fetal calf serum (FCS). Cell debris was depleted
by passage through nylon mesh screens.
Flow cytometric analysis.
To examine the expression of surface antigens, the cells were washed
and then resuspended in phosphate-buffered saline (PBS) containing
0.2% bovine serum albumin and 0.02% sodium azide (PBSA). Saturating
concentrations of antibodies were added and incubated for 10 minutes at
room temperature. Cells were washed in PBSA after each incubation step.
Red blood cells from primary bone marrow cell suspensions were lysed by
treatment with FACS lysis solution (Becton Dickinson, San Jose, CA).
Finally, cells were fixed in 0.5% paraformaldehyde in PBS for analysis
on a FACScan flow cytometer (Becton Dickinson). Fluorescence data were
analyzed by the CellQuest program and presented either in the form of
histograms or 2-parameter log contour plots. Dead cells and debris were
excluded by characteristic forward and side scatter profiles.
Enrichment of IL-7R positive cells in vitro.
Cells from normal bone marrow were treated with ammonium
chloride-potassium bicarbonate solution (150 mmol/L NH4Cl
and 10 mmol/L KHCO3) to lyse red blood cells. Cells (1 × 106/mL) were cultured in RPMI-1640 medium
containing 5% FCS, 2 mmol/L L-glutamine, 100 U/mL each of penicillin
and streptomycin, and 50 µmol/L 2-mercaptoethanol (R5 medium) on
irradiated NIH-3T3 cells that retrovirally expressed the mIL-7 cDNA
(T220-29 cells; kindly provided by Dr Owen N. Witte [University of
California, Los Angeles, CA] and Dr Martine F. Roussel
[St Jude Children's Research Hospital, Memphis, TN]). After 4 days
in culture, greater than 95% of nonadherent cells were
B220+.
Proliferation assays.
Wild-type (B6J129SVF2) bone marrow cells were grown on
T220-29 cells for 8 to 10 days. The cells were washed and resuspended at a final concentration of 5 × 105 cells/mL in R5
medium alone or in medium that contained growth factors: recombinant
murine IL-7 (rmIL-7; 5 ng/mL), rmIL-3 (10 ng/mL), or rmSCF
(100 ng/mL). Cells (1 × 105) were added to each well
of a 96-well flat-bottomed plate and incubated for 36 hours at 37°C
in 5% CO2 in air. The cells were then pulse-labeled with 3 µCi/well of [3H]-thymidine for 14 hours and the
incorporation of [3H]-thymidine was measured. Individual
thymi were removed to tubes containing HBSS, dissociated into a
single-cell suspension, washed in HBSS, and resuspended to
107 cells/mL in TCM (S-minimal essential medium
[S-MEM] plus 10% FCS, 1% L-glutamine, 1%
antibiotic/antimycotic, 1% nonessential amino acids, 0.5% essential
amino acids, and 50 µmol/L 2-mercaptoethanol). Thymocytes were
stimulated for 72 hours with either anti-CD3 (clone 145-2C11; 10 µg/mL), anti-CD3 plus phorbol 12-myristate 13-acetate (PMA; 1 ng/mL), Concanavalin A (CA; 20 µg/mL), CA plus IL-2 (10 U/mL), or CA
plus IL-7 (5 ng/mL) and were pulsed with 1 µCi
[3H]-thymidine for 18 hours before harvest. Assays were
performed in triplicate and the incorporation of
[3H]-thymidine was measured. Stimulation indices were
determined as the mean experimental values over the mean control values
for each experiment.
STAT5 gel mobility shift assay.
Cells were stimulated with IL-3 (10 ng/mL) or IL-7 (50 ng/mL) for 30 minutes and used for the assay as described previously.10 The synthetic oligonucleotide probe used as the STAT5A binding site was
as follows: 5' GATCCGAATTCCAGGAATTCA 3'; 3' GCTTAAGGTCCTTAAGTCTAG 5'. The probe was labeled with a32P-dCTP by blunt-end
filling with the Klenow fragment.
Cytokine injections.
Recombinant murine IL-3 was reconstituted in RPMI-1640 medium (1 mg/mL)
and administered daily via subcutaneous injection into newborn
Jak3/ mice from days 1 to 14 (10 µg/kg/d)
after birth. Recombinant murine SCF was prepared (5 mg/mL) and,
similarly, injected subcutaneously for the first 14 postnatal days (50 µg/kg/d). The same volume of medium was injected into  /
littermates as a negative control.
Allogeneic tumor challenge and cytotoxic T lymphocyte
(CTL) assay.
P815 mastocytoma cells grown in RPMI-1640 medium containing 10% FCS
were washed in HBSS and resuspended in PBS to 2 × 106
cells/mL. Four mice from each group each received 1 mL of cell suspension: 0.5 mL intraperitoneally and 0.5 mL subcutaneously. Two
weeks later, 2 mice from each group were killed, and splenocytes were
isolated, washed in HBSS, and resuspended in S-MEM medium with 10%
FCS. Splenocytes (H-2b) were diluted in medium and
cocultured with either 51Cr-labeled P815 (H-2d)
target cells or 51Cr-labeled SV-B6KH(H-2b)
target cells in a standard 6-hour in vitro assay.21 The
percentage of specific lysis based on 51Cr release was
determined by the following ratio: (target cell release with effector
splenocytes from P815 injected mice spontaneous release)/(maximum release spontaneous release).
In vivo CD8 depletion.
Mice were depleted in vivo of CD8+ T cells22 by
successive intraperitoneal administration of 0.5 mL of diluted mouse
ascitic fluid that contained the 2.43.1 (anti-CD8) MoAb.
Influenza A virus infection experiments.
Five-week-old mice were anesthetized by intraperitoneal administration
of Avertin (2,2,2-tribromoethanol) and then infected intranasally
with 30 µL of PBS containing 240 hemagglutinating units of the
influenza A HKx31 virus.23
Statistical analysis.
Thymocyte numbers were compared using a 2-tailed Student's
t-test.
| |
RESULTS |
We initially examined the bone marrow from wild-type and
Jak3/ mice for the presence of cells that
expressed the IL-7 receptor (IL-7R) chain and the IL-3 receptor
(IL-3R) chain by flow cytometry (Fig
1). As shown, approximately 19% of wild-type bone marrow cells express
the IL-7R chain, and this population is clearly reduced in bone
marrow from Jak3/ mice. Among the wild-type
IL-7R+ cells, approximately 70% also express the
IL-3R. Similarly, a subpopulation of B220+ cells in
wild-type mice also expressed IL-3R and were reduced in frequency in
the bone marrow of Jak3/ mice. Because stem
cell factor (SCF) has been implicated in early hematopoietic progenitor
expansion, we examined the pattern of expression of the SCF receptor,
c-kit. As indicated, a population of cells expressing either IL-7R
or B220 together with c-kit was evident in wild-type mice but reduced
in Jak3/ mice. The results are consistent
with the hypothesis that a population of
IL-7R+/IL-3R+ cells exists in the bone
marrow, which is reduced in the Jak3/ mice.
This population may be a precursor for an
IL-7R+/IL-3R lymphoid-committed
cell.
View larger version (72K):
[in this window]
[in a new window]
| Fig 1.
(A) IL-7R and IL-3R are coexpressed by a minor
fraction of wild-type and Jak3-deficient bone marrow cells. Bone marrow
cells were obtained from wild-type (WT) or Jak3/
(/) and were stained, fixed, and analyzed by flow cytometry. One
hundred and fifty thousand cells were analyzed in a lymphoid gate
defined by scatter criteria. (B) Staining with isotype control
antibodies for anti-IL-7R and anti-IL-3R antibodies is shown
for wild-type and Jak3/ lymphoid-gated cells from
bone marrow. The numbers in each quadrant indicate the percentage of
positive cells in total bone marrow.
|
|
We next examined whether IL-7R+ cells contained a
population of cells capable of responding to IL-3. For these
experiments, wild-type IL-7R+ bone marrow cells were
enriched by culturing on stromal cells secreting IL-7. In these
cultures, the majority of the IL-7R+ cells were B cells
(B220+, CD19+) and expressed c-kit and had a
pro-B-cell or early pre-B-cell phenotype (B220+,
CD43+ [Fig 2A] and
CD24+, BP-1+/, IgM
[data not shown]).24 In contrast, no cells
were obtained from the cultures when bone marrow cells from
Jak3/ mice were used. Nearly all cells in the
cultures also expressed a low level of IL-3R. Moreover, there was
not a significant fraction of IL-3R+ cells that were
either IL-7R or B220,
demonstrating the enrichment for lymphoid progenitors relative to
myeloid lineage cells (Fig 2A). The responses of these cells to various
cytokines are shown in Fig 2B. As indicated, the cells responded to
both IL-7 and IL-3, and the response to IL-3 was approximately 80%
that of IL-7. As another functional measure of the response of the
cells, we examined the ability of IL-7 or IL-3 to induce the activation
of Stat5 DNA binding activity. As shown in Fig 2C, both cytokines
induced comparable levels of Stat5 DNA binding activity.
View larger version (133K):
[in this window]
[in a new window]
| Fig 2.
IL-7-responsive bone marrow cells are pro-B cells and
early pre-B cells that express IL-7R, IL-3R, and c-kit. (A) Flow
cytometric analysis of IL-7R, IL-3R, B220, and c-kit expression
of IL-7-responsive normal bone marrow cells. The cells are
IL-7R+, predominantly CD19+ and
c-kit+, and B220+, CD43+.
They also express IL-3R at low density, and after gating, these
cells were found to coexpress IL-7R and B220 (lower histograms).
Bone marrow cells from a 7-week-old B6J129SVF2 mouse were
cultured for 10 days on NIH-3T3 cells that secrete mIL-7 (T220-29
cells) and then stained, fixed, and analyzed by flow cytometry. Fifty
thousand cells were analyzed without gating for size. The percentage of
positive cells is shown in the quadrant. Histograms: dotted line,
isotype-matched control antibody; heavy line, antibody. (B) IL-3 and
SCF induce the proliferation of IL-7-responsive cells.
IL-7-responsive cells (wild-type bone marrow cells cultured for 9 days
on T220-29 cells) were washed and cultured without feeder cells in the
presence of rmIL-7 (5 ng/mL), rmIL-3 (10 ng/mL), or rmSCF (100 ng/mL).
The cells were pulse-labeled with [3H]-thymidine and the
incorporation of [3H]-thymidine was measured as counts
per minute (cpm). Error bars show the standard deviation of 12 replicates. (C) IL-3 and IL-7 both activate STAT5 in
IL-7R+ B-lymphoid progenitors from normal bone marrow. A
gel mobility shift assay was performed after 10 hours of IL-7
starvation by using +/+ bone marrow cells that had been cultured
for 14 days on T220-29 cells. The addition of anti-Stat5A
antiserum50 reduced STAT5-DNA complex formation, whereas
control serum did not. The arrowhead indicates the position of the
Stat5-DNA complex.
|
|
The results given above demonstrated the existence of an
IL-3-responsive population of IL-7R+ lymphoid
progenitors. However, the essential question was whether an
IL-3-responsive lymphoid progenitor population could be demonstrated in vivo. We reasoned that such a population might be difficult to
detect during normal lymphoid development, during which IL-7 is the
predominant functional cytokine. Because the IL-3 receptor does not
require Jak3, unlike the IL-7 receptor, we examined the ability of IL-3
to expand early lymphoid progenitors in the absence of IL-7 signaling
by using Jak3/ mice. In these experiments,
newborn Jak3/ mice were injected
subcutaneously with recombinant IL-3 (10 µg/kg/d) for 14 days and
analyzed at various times thereafter. For comparison, Jak3/ mice were also injected with SCF (50 µg/kg/d). At 2 to 3 weeks of age, there was a clear response in the
IL-3-treated mice, as was evident from thymic size
(Fig 3A). The thymocyte numbers in IL-3-treated mice were 2- to 20-fold higher than those of littermates injected with control media (Fig 3B) or with SCF (data not shown). The
mean number of thymocytes (±SD) from wild-type mice was 1.09 (±0.25) × 108. The mean thymocyte number in
IL-3-treated Jak3-deficient mice (1.44 [±0.47] × 107) was significantly different from that for
control-treated Jak3-deficient mice (2.95 [±2.87] × 106; P < .001). This effect was sustained such
that IL-3-treated Jak3/ mice had 4 to 10 times the number of thymocytes compared with control mice at 4 to 6 weeks of age (data not shown). Thymocytes from control or IL-3-treated
Jak3/ mice, as well as thymocytes from
wild-type mice, had a comparable pattern of expression of CD4 and CD8
single- and double-positive cells. These results indicate that the
primary effect of IL-3 was to expand the normal, IL-7-responsive,
thymocyte populations.
View larger version (114K):
[in this window]
[in a new window]
| Fig 3.
Effects of IL-3 treatment on lymphoid populations.
IL-3-treated Jak3/ mice have thymic enlargement and
increased numbers of thymocytes and peripheral T and B cells. (A) Thymi
from 15-day-old mice are shown. (B) Thymocyte number from mice at 2 to
3 weeks of age. Control-treated Jak3/ mice ( ; n
= 17), IL-3-treated Jak3/ littermates ( ; n = 16), and Jak3+/+ mice ( ; n = 13). (C) Flow
cytometric analysis of splenocytes from 3-week-old mice. The percentage
of positive cells is shown for each quadrant. This experiment is
representative of 4 independent experiments.
|
|
The effects of IL-3 treatment of Jak3/ mice
on peripheral T and B cells were also examined (Fig 3C). The numbers of
splenic CD4+ or CD8+ T cells were increased 2- to 10-fold and 2- to 6-fold, respectively, relative to control-treated
littermates. The percentage and absolute numbers of B220+,
IgM+ splenic cells also increased in the spleens of
IL-3-treated Jak3/ mice relative to
control-treated mice. This value ranged from 3- to 10-fold, depending
on the individual animals (Table 1). In
contrast to IL-3, there were no significant differences in the
percentage or absolute numbers of splenic T or B cells in SCF-treated
mice relative to the controls. As anticipated, IL-3 also increased the
percentage of cells expressing the myeloid lineage markers Gr-1 and
Mac-1 by 3- to 4-fold and the total number of splenocytes was increased
by 2- to 3-fold (data not shown).
View this table:
[in this window]
[in a new window]
|
Table 1.
IL-3 Treatment of Jak3-Deficient Mice Increased the
Proportion of Peripheral CD4+ and CD8+ T
Cells and B220+IgM+ B Cells
|
|
Although IL-3 can expand the number of lymphoid populations by
expanding the early progenitor population, it would be anticipated that
the lack of Jak3 would preclude functional reconstitution, because the
cells would not be able to respond to any of the other cytokines that
require c and Jak3. This point is evident in the lack of
a detectable response of thymocytes from IL-3-treated Jak3/ mice to anti-CD3 in combination with
PMA (Fig 4). In addition, peripheral T
cells were not responsive (data not shown). However, some level of
function exists in the IL-3-amplified, peripheral T cells, even in the
absence of Jak3. When we examined the T-cell response to
intraperitoneal injections of the allogeneic major histocompatibility
complex (MHC) class I-bearing tumor, P815
(Fig 5A and B), a
P815-specific CTL response was mounted by IL-3-treated, Jak3/ mice but not by either control-treated
Jak3/ mice or SCID mice (data not shown).
Both in vitro (data not shown) and in vivo depletion of
CD8+ cells abolished this response. However, survival of
the IL-3-treated Jak3/ mice was not
significantly prolonged relative to the control-treated Jak3/ mice. Similarly, IL-3-treated
Jak3/ mice, but not controls, displayed
influenza-specific cytolytic activity after infection with an
attenuated strain of influenza virus. This was associated with a
prolonged survival to influenza, although ultimately all of the mice
succumbed to the infection, whereas control Jak3+/+ mice
survived such infections (Fig 5C).
View larger version (24K):
[in this window]
[in a new window]
| Fig 4.
Proliferative responses of thymocytes from
Jak3+/+ mice (+/+), control-treated
Jak3/ mice (/), and IL-3-treated
Jak3/ littermates (/ IL-3).
Jak3/ thymocytes do not respond to T-cell mitogenic
and Jak3-dependent cytokine stimuli. Thymocytes were stimulated with
mitogen/cytokine combinations as described in Materials and Methods,
and their proliferation was measured by incorporation of
[3H]-thymidine. Values are average stimulation indices ± SD (n = 2 in each group).
|
|
View larger version (28K):
[in this window]
[in a new window]
| Fig 5.
Effects of IL-3 treatment on lymphocyte
function. CD8-mediated cytolytic activity of IL-3-treated
Jak3/ splenocytes after challenge with allogeneic
P815 tumor cells. P815 cells were injected into wild-type (+/+)
mice, Jak3-deficient (/) mice, or Jak3/ mice
receiving IL-3 (IL-3) in the presence or absence (CD8) of
CD8+ T cells. The CTL response from pooled splenocytes
was measured 14 days after the administration of P815 cells (n = 2 in
each group). Triplicate wells for each sample were analyzed and the
mean value is shown. The effector to target ratios of 30:1 ( ) are
presented using either (A) allogeneic P815 or (B) syngeneic SVB6KHA
target cells. This experiment is representative of 3 independent
experiments. (C) Survival of mice after influenza A HKx31 virus
infection (n = 7 in each group). Control-treated
Jak3/ mice (/; ), IL-3-treated
Jak3/ littermates (/ IL-3; ), and
Jak3+/+ mice (+/+; ).
|
|
| |
DISCUSSION |
The results show that the functional redundancy of the cytokines
involved in lymphoid development may provide an opportunity to
compensate for genetic disorders involving their signaling pathways.
Jak3/ mice represent a suitable model to test
this hypothesis, because most of the cytokines affecting lymphoid
development do not function, thus permitting otherwise redundant
cytokines to be identified. The model has the additional advantage of a
low background of cytokine effects, because functional T cells, which
could produce cytokines such as IL-3, are not generated. Furthermore,
Jak3/ mice may be used to investigate the
potentially useful therapeutic effects of later-acting cytokines such
as IL-12, which, although required for T helper 1 maturation, do not
use Jak3-dependent pathways.25
In vivo, we identified among lymphoid cells in the bone marrow of
wild-type and Jak3/ mice an
IL-7R+, IL-3R+ subpopulation that was
predominantly B220lo. Although this subpopulation was
reduced approximately 4-fold in Jak3/ mice,
it was relatively well preserved in contrast to the markedly reduced
subpopulation of mature B220+, IgM+ B cells.
The relationship of the IL-7R+/ IL-3R+
cell population to the Lin IL-7R+
Thy-1 Sca-1lo c-Kitlo common
lymphoid progenitor (CLP) described by Kondo et al26 is not
defined, but investigation of IL-3R expression on the CLP may
contribute to further understanding of lymphoid lineage development.
Treatment of Jak3/ mice with IL-3 increased
thymic size, thymocyte number, and the numbers of peripheral B and T
cells and enhanced cytolytic T-cell function. These effects of IL-3
upon lymphopoiesis in vivo are consistent with an effect on an early lymphoid progenitor population. We hypothesized that IL-3 acts upon a
progenitor cell population that also expresses IL-7 but which cannot
respond to IL-7 in Jak3-deficient mice. To test this hypothesis, we
enriched wild-type bone marrow for IL-7-responsive cells and found
that they also expressed IL-3 receptor. Although not proven, we
expected that this relatively pure population of IL-7-responsive cells
would represent a physiological target for IL-3 action equivalent to
the presumed target population in Jak3-deficient mice. Thus, our in
vitro data indirectly support the notion that IL-7R+,
IL-3R+ bone marrow cells were the target of IL-3 action
in vivo: wild-type IL-7R+ bone marrow cells, which were
enriched by culture in IL-7, expressed the receptor for IL-3, and both
proliferated in response to IL-3 and activated Stat5 comparably to
stimulation with IL-7. In support of our findings, Winkler et
al27 found that IL-3 and IL-7 were interchangeable in their
proliferative effects on purified B220+, c-kit+
bone marrow-derived pre-B cells in the presence of stromal cells. We
note that our results differ from the inhibitory effects of IL-3 on
lymphoid progenitors previously observed by Ogawa et
al.28-30 Our experimental system differs significantly in
that IL-3 was used in vivo on unselected target cells in neonatal mice
that lack IL-7-dependent lymphopoiesis. It is possible that, among other factors, the inhibitory effects of IL-3 on lymphoid progenitors may depend on the target cell type. Alternatively, IL-3-induced lymphoid expansion may depend critically on the hematopoietic microenvironment.
In addition to Stat5, IL-3 and IL-7 activate pathways involving ras and
the expression of the antiapoptotic genes for Bcl-2 and
Bcl-XL. The importance of the activation of Bcl-2 was
elegantly illustrated by the observation that transgenic expression of
Bcl-2 rescued the T-cell lymphopenia of mice deficient in the IL-7
receptor or c chains.31-33 However, the
B-cell defect was not rescued, demonstrating the requirement for
additional signaling events in some cell populations.
In contrast to IL-3, SCF was unable to rescue the lymphoid populations
in Jak3/ mice. We propose that SCF regulates
an earlier precursor than IL-7/IL-3-responsive lymphoid progenitors,
which may be multilineage precursors.34,35 It should be
noted that SCF stimulation of hematopoietic cells does not result in
the detectable activation of Jak3 and thus Jak3 would not be predicted
to be required for SCF function. Furthermore, whereas a deficiency of
SCF or its receptor reduces thymic cellularity, c-kit deficiency
combined with a c deficiency abrogates thymocyte
development.36-38
IL-3 is produced predominantly by activated T cells and was therefore
envisioned to be an immune response mediator of early hematopoietic
function. Whereas mutant mice lacking IL-3 clearly demonstrate that
IL-3 does not have an essential role in early lymphoid expansion, other
data indicate that IL-3 may influence the generation of immune
responses. For example, in comparison with laboratory strains, wild
strains and species of mice preferentially retain an intact IL-3
receptor system. This observation suggests that retention of the IL-3
receptor system confers an evolutionary advantage upon wild mice, which
are exposed to more vigorous infectious challenges.39,40
Furthermore, in IL-3-deficient mice, impaired mast cell effector
functions reduced host defenses against pathogenic parasites.41 Our results lead us to suggest that, in
addition, one of the physiological functions of IL-3 may be to expand
early lymphoid progenitors during the course of an immune response. Specifically, after the initial differentiation of the immune system,
IL-7 may become limiting and any subsequent expansions may require
other cytokines, including IL-3.
Finally, we believe that our findings may have clinical relevance. In
Jak3/ mice, IL-3 expanded the numbers of
peripheral B and T cells, the latter ostensibly via a thymic pathway,
and enhanced the cytolytic function of T cells against allogeneic
targets. The cytolytic activity itself does not depend on Jak3, and we
propose that, after IL-3 treatment, increased numbers of
CD8+ T cells generated within a large pool of alloreactive
CTL precursors underwent an initial Jak3-independent phase of limited
clonal expansion.42,43 Also, IL-3 may promote survival of
apoptosis-prone Jak3-deficient T cells, as it does for other cell
types,44 and IL-3 may enhance antigen presentation via
effects on myeloid lineage cells.
In addition, we predict that our results would extend to
c-deficient mice, because c signaling
depends on intact Jak3 function. Thus, IL-3 treatment may be of value
in SCID patients who have either X-linked or Jak3-deficient SCID.
Although allogeneic bone marrow transplantation is the only treatment
that is potentially curative, it is only available to approximately
60% of patients who have histocompatible donors.45 For
patients who lack donors or who are otherwise unsuited to bone marrow
transplantation, our data imply that administration of IL-3 might help
to alleviate the infectious complications of SCID. Other cytokines have
shown promise in the treatment of immunodeficiency. For example, IL-7 hastened the reconstitution of a functional immune system in mice after
syngeneic bone marrow transplantation.46,47 However, in
human immunodeficiency disorders, the potential role of IL-7 in
enhancing lymphopoiesis is less certain. IL-7 will not be effective in
primary immunodeficiencies caused by defects of c or
Jak3 and, unlike murine B lymphopoiesis, IL-7 was not required for human B lymphopoiesis in vitro.27,48 On the other hand,
IL-3 has been widely tested in clinical trials for various hematologic disorders.49
| |
ACKNOWLEDGMENT |
The authors thank D. Wang for the oligonucleotide probe, O.N. Witte and
M.F. Roussel for T220-29 cells, S. Nishikawa and T. Sudo for
anti-IL-7R antibody, and D. Gorman for the anti-IL-3R antibody.
M. Holladay, K. Farris, and R. Cross assisted with the FACS analysis.
M.F. Roussel, W.E. Thierfelder, and D. Stravopodis gave technical
advice and Y. Minegishi provided valuable discussions. Lastly, L. Snyder, C. J. Nagy, and J. H. Swift provided technical assistance throughout.
| |
FOOTNOTES |
Submitted December 18, 1998; accepted April 7, 1999.
M.P.B. and T.N. contributed equally to the studies.
Supported in part by Cancer Center CORE Grant No. CA21765 and Grant No.
DK42932 to J.N.I., Grant No. AI-29579 to P.C.D., Grants No. CA 78792 and CA 75014 to M.K.B., the Assisi Foundation, and the American
Lebanese Syrian Associated Charities (ALSAC).
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to James N. Ihle, PhD, Howard Hughes Medical
Institute, St. Jude Children's Research Hospital, 332 N Lauderdale,
Memphis, TN 38105; e-mail: james.ihle{at}stjude.org.
| |
REFERENCES |
1.
Noguchi M, Nakamura Y, Russell SM, Ziegler SF, Tsang M, Cao X, Leonard WJ:
Interleukin-2 receptor gamma chain: A functional component of the interleukin-7 receptor.
Science
262:1877, 1993[Abstract/Free Full Text]
2.
Buckley RH, Schiff RI, Schiff SE, Markert ML, Williams LW, Harville TO, Roberts JL, Puck JM:
Human severe combined immunodeficiency: Genetic, phenotypic, and functional diversity in one hundred eight infants.
J Pediatr
130:378, 1997[Medline]
[Order article via Infotrieve]
3.
Johnston JA, Kawamura M, Kirken R, Chen Y-Q, Blake TB, Shibuya K, Ortaldo JR, McVicar DW, O'Shea JJ:
Phosphorylation and activation of the JAK3 Janus kinase in response to IL-2.
Nature
370:151, 1994[Medline]
[Order article via Infotrieve]
4.
Miyazaki T, Kawahara A, Fujii H, Nakagawa Y, Minami Y, Liu Z-J, Oishi I, Silvennoinen O, Witthuhn BA, Ihle JN, Taniguchi T:
Functional activation of Jak1 and Jak3 by selective association with IL-2 receptor subunits.
Science
266:1045, 1994[Abstract/Free Full Text]
5.
Russell SM, Johnston JA, Noguchi M, Kawamura M, Bacon CM, Friedmann M, Berg M, McVicar DW, Witthuhn BA, Silvennoinen O, Goldman AS, Schmalstieg FC, Ihle JN, O'Shea JJ, Leonard WJ:
Interaction of IL-2 receptor beta and c chains with JAK1 and JAK3, respectively: Defective c-JAK3 association in XSCID.
Science
266:1042, 1994[Abstract/Free Full Text]
6.
Witthuhn BA, Silvennoinen O, Miura O, Lai KS, Cwik C, Liu ET, Ihle JN:
Involvement of the JAK3 Janus kinase in IL-2 and IL-4 signalling in lymphoid and myeloid cells.
Nature
370:153, 1994[Medline]
[Order article via Infotrieve]
7.
Ihle JN:
The Janus protein tyrosine kinase family and its role in cytokine signaling.
Adv Immunol
60:1, 1995[Medline]
[Order article via Infotrieve]
8.
Macchi P, Villa A, Giliani S, Sacco MG, Frattini A, Porta F, Ugazio AG, Johnston JA, Candotti F, O'Shea JJ, Vezzoni P, Notarangelo LD:
Mutations of Jak-3 gene in patients with autosomal severe combined immune deficiency (SCID).
Nature
377:65, 1995[Medline]
[Order article via Infotrieve]
9.
Russell SM, Tayebi N, Nakajima H, Riedy MC, Roberts JL, Aman MJ, Migone T-S, Noguchi M, Markert ML, Buckley RH, O'Shea JJ, Leonard WJ:
Mutation of Jak3 in a patient with SCID: Essential role of Jak3 in lymphoid development.
Science
270:797, 1995[Abstract/Free Full Text]
10.
Nosaka T, van Deursen JMA, Tripp RA, Thierfelder WE, Witthuhn BA, McMickle AP, Doherty PC, Grosveld GC, Ihle JN:
Defective lymphoid development in mice lacking Jak3.
Science
270:800, 1995[Abstract/Free Full Text]
11.
Park SY, Saijo K, Takahashi T, Osawa M, Arase H, Hirayama N, Miyake K, Nakauchi H, Shirasawa T, Saito T:
Developmental defects of lymphoid cells in Jak3 kinase-deficient mice.
Immunity
3:771, 1995[Medline]
[Order article via Infotrieve]
12.
Thomis DC, Gurniak CB, Tivol E, Sharpe AH, Berg LJ:
Mice lacking Jak3 have defects in B lymphocyte maturation and T lymphocyte activation.
Science
270:794, 1995[Abstract/Free Full Text]
13.
von Freeden-Jeffry U, Vieria P, Lucian LA, McNeil T, Burdach SEG, Murray R:
Lymphopenia in interleukin (IL)-7 gene-deleted mice identifies IL-7 as a nonredundant cytokine.
J Exp Med
181:1519, 1995[Abstract/Free Full Text]
14.
Peschon JJ, Morrissey PJ, Grabstein KH, Ramsdell FJ, Maraskovsky E, Gliniak BC, Park LS, Ziegler SF, Williams DE, Ware CB, Meyer JD, Davison BL:
Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice.
J Exp Med
180:1955, 1994[Abstract/Free Full Text]
15.
Leonard WJ, Shores EW, Love PE:
Role of the common cytokine receptor gamma chain in cytokine signaling and lymphoid development.
Immunol Rev
148:97, 1995[Medline]
[Order article via Infotrieve]
16.
Ihle JN:
Interleukin-3 and hematopoiesis.
Chem Immunol
51:65, 1992[Medline]
[Order article via Infotrieve]
17.
Ihle JN, Pepersack L, Rebar L:
Regulation of T cell differentiation: In vitro induction of 20 alpha hydroxysteroid dehydrogenase in splenic lymphocytes from athymic mice by a unique lymphokine.
J Immunol
126:2184, 1981[Abstract]
18.
Parganas E, Wang D, Stravopodis D, Topham DJ, Marine J-C, Teglund S, Vanin EF, Bodner S, Colamonici OR, van Deursen JM, Grosveld G, Ihle JN:
Jak2 is essential for signaling through a variety of cytokine receptors.
Cell
93:385, 1998[Medline]
[Order article via Infotrieve]
19.
Sudo T, Nishikawa S, Ohno N, Akiyama N, Tamakoshi M, Yoshida H:
Expression and function of the interleukin 7 receptor in murine lymphocytes.
Proc Natl Acad Sci USA
90:9125, 1993[Abstract/Free Full Text]
20.
Steelman LS, Algate PA, Blalock WL, Wang XY, Prevost KD, Hoyle PE, McCubrey JA:
Oncogenic effects of overexpression of the interleukin-3 receptor on hematopoietic cells.
Leukemia
10:528, 1996[Medline]
[Order article via Infotrieve]
21.
Tripp RA, Sarawar SR, Doherty PC:
Characteristics of the influenza virus-specific CD8+ T cell response in mice homozygous for disruption of the H-2lAb gene.
J Immunol
155:2955, 1995[Abstract]
22.
Topham DJ, Tripp RA, Sarawar SR, Sangster MY, Doherty PC:
Immune CD4+ T cells promote the clearance of influenza virus from major histocompatibility complex class II / respiratory epithelium.
J Virol
70:1288, 1996[Abstract]
23.
Tripp RA, Hou S, McMickle A, Houston J, Doherty PC:
Recruitment and proliferation of CD8+ T cells in respiratory virus infections.
J Immunol
154:6013, 1995[Abstract]
24.
Hardy RR, Carmack CE, Shinton SA, Kemp JD, Hayakawa K:
Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse bone marrow.
J Exp Med
173:1213, 1991[Abstract/Free Full Text]
25.
Thierfelder WE, van Deursen J, Yamamoto K, Tripp RA, Sarawar SR, Carson RT, Sangster MY, Vignali DAA, Doherty PC, Grosveld G, Ihle JN:
Stat4 is required for IL-12 mediated responses of NK and T-cells.
Nature
382:171, 1996[Medline]
[Order article via Infotrieve]
26.
Kondo M, Weissman IL, Akashi K:
Identification of clonogenic common lymphoid progenitors in mouse bone marrow.
Cell
91:661, 1997[Medline]
[Order article via Infotrieve]
27.
Winkler TH, Melchers F, Rolink AG:
Interleukin-3 and interleukin-7 are alternative growth factors for the same B-cell precursors in the mouse.
Blood
85:2045, 1995[Abstract/Free Full Text]
28.
Hirayama F, Clark SC, Ogawa M:
Negative regulation of early B lymphopoiesis by interleukin 3 and interleukin 1 alpha.
Proc Natl Acad Sci USA
91:469, 1994[Abstract/Free Full Text]
29.
Hirayama F, Ogawa M:
Negative regulation of early T lymphopoiesis by interleukin-3 and interleukin-1.
Blood
86:4527, 1995[Abstract/Free Full Text]
30.
Matsunaga T, Hirayama F, Yonemura Y, Murray R, Ogawa M:
Negative regulation by interleukin-3 (IL-3) of mouse early B-cell progenitors and stem cells in culture: Transduction of the negative signals by beta c and beta IL-3 proteins of IL-3 receptor and absence of negative regulation by granulocyte-macrophage colony-stimulating factor.
Blood
92:901, 1998[Abstract/Free Full Text]
31.
Akashi K, Kondo M, von Freeden-Jeffry U, Murray R, Weissman IL:
Bcl-2 rescues T lymphopoiesis in interleukin-7 receptor-deficient mice.
Cell
89:1033, 1997[Medline]
[Order article via Infotrieve]
32.
Maraskovsky E, O'Reilly LA, Teepe M, Corcoran L, Peschon JJ, Strasser A:
Bcl-2 can rescue T lymphocyte development in interleukin-7 receptor-deficient mice but not in mutant rag-1/ mice.
Cell
89:1011, 1997[Medline]
[Order article via Infotrieve]
33.
Kondo M, Akashi K, Domen J, Sugamura K, Weissman IL:
Bcl-2 rescues T lymphopoiesis, but not B or NK cell development, in common gamma chain-deficient mice.
Immunity
7:155, 1997[Medline]
[Order article via Infotrieve]
34.
Ryan DH, Nuccie BL, Ritterman I, Liesveld JL, Abboud CN, Insel RA:
Expression of interleukin-7 receptor by lineage-negative human bone marrow progenitors with enhanced lymphoid proliferative potential and B-lineage differentiation capacity.
Blood
89:929, 1997[Abstract/Free Full Text]
35.
Orlic D, Girard LJ, Lee D, Anderson SM, Puck JM, Bodine DM:
Interleukin-7R mRNA expression increases as stem cells differentiate into T and B lymphocyte progenitors.
Exp Hematol
25:217, 1997[Medline]
[Order article via Infotrieve]
36.
Galli SJ, Zsebo KM, Geissler EN:
The kit ligand, stem cell factor.
Adv Immunol
55:1, 1994[Medline]
[Order article via Infotrieve]
37.
Rodewald HR, Kretzschmar K, Swat W, Takeda S:
Intrathymically expressed c-kit ligand (stem cell factor) is a major factor driving expansion of very immature thymocytes in vivo.
Immunity
3:313, 1995[Medline]
[Order article via Infotrieve]
38.
Rodewald HR, Ogawa M, Haller C, Waskow C, DiSanto JP:
Pro-thymocyte expansion by c-kit and the common cytokine receptor gamma chain is essential for repertoire formation.
Immunity
6:265, 1997[Medline]
[Order article via Infotrieve]
39.
Hara T, Ichihara M, Takagi M, Miyajima A:
Interleukin-3 (IL-3) poor-responsive inbred mouse strains carry the identical deletion of a branch point in the IL-3 receptor subunit gene.
Blood
85:2331, 1995[Abstract/Free Full Text]
40.
Nishinakamura R, Miyajima A, Mee PJ, Tybulewicz VLJ, Murray R:
Hematopoiesis in mice lacking the entire granulocyte-macrophage colony-stimulating factor/interleukin-3/interleukin-5 functions.
Blood
88:2458, 1996[Abstract/Free Full Text]
41.
Lantz CS, Boesiger J, Song CH, Mach N, Kobayashi T, Mulligan RC, Nawa Y, Dranoff G, Galli SJ:
Role for interleukin-3 in mast-cell and basophil development and in immunity to parasites.
Nature
392:90, 1998[Medline]
[Order article via Infotrieve]
42.
Sohn SJ, Forbush KA, Nguyen N, Witthuhn B, Nosaka T, Ihle JN, Perlmutter RM:
Requirement for Jak3 in mature T cells: Its role in regulation of T cell homeostasis.
J Immunol
160:2130, 1998[Abstract/Free Full Text]
43.
Thomis DC, Berg LJ:
The role of Jak3 in lymphoid development, activation, and signaling.
Curr Opin Immunol
9:541, 1997[Medline]
[Order article via Infotrieve]
44.
Ikushima S, Inukai T, Inaba T, Nimer SD, Cleveland JL, Look AT:
Pivotal role for the NFIL3/E4BP4 transcription factor in interleukin 3-mediated survival of pro-B lymphocytes.
Proc Natl Acad Sci USA
94:2609, 1997[Abstract/Free Full Text]
45.
O'Reilly RJ, Keever CA, Small TN, Brochstein J:
The use of HLA-non-identical T-cell-depleted marrow transplants for correction of severe combined immunodeficiency disease.
Immunodefic Rev
1:273, 1989[Medline]
[Order article via Infotrieve]
46.
Abdul-Hai A, Ben-Yehuda A, Weiss L, Friedman G, Zakay-Rones Z, Slavin S, Or R:
Interleukin-7-enhanced cytotoxic T lymphocyte activity after viral infection in marrow transplanted mice.
Bone Marrow Transplant
19:539, 1997[Medline]
[Order article via Infotrieve]
47.
Abdul-Hai A, Or R, Slavin S, Friedman G, Weiss L, Matsa D, Ben-Yehuda A:
Stimulation of immune reconstitution by interleukin-7 after syngeneic bone marrow transplantation in mice.
Exp Hematol
24:1416, 1996[Medline]
[Order article via Infotrieve]
48.
Prieyl JA, LeBien TW:
Interleukin 7 independent development of human B cells.
Proc Natl Acad Sci USA
93:10348, 1996[Abstract/Free Full Text]
49.
Eder M, Geissler G, Ganser A:
IL-3 in the clinic.
Stem Cells
15:327, 1997[Medline]
[Order article via Infotrieve]
50.
Quelle FW, Wang D, Nosaka T, Thierfelder WE, Stravopodis D, Weinstein Y, Ihle JN:
Erythropoietin induces activation of Stat5 through association with specific tyrosines on the receptor that are not required for a mitogenic response.
Mol Cell Biol
16:1622, 1996[Abstract]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. G. Cornejo, M. G. Kharas, M. B. Werneck, S. L. Bras, S. A. Moore, B. Ball, M. Beylot-Barry, S. J. Rodig, J. C. Aster, B. H. Lee, et al.
Constitutive JAK3 activation induces lymphoproliferative syndromes in murine bone marrow transplantation models
Blood,
March 19, 2009;
113(12):
2746 - 2754.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. R. Dillon and M. S. Schlissel
Partial restoration of B cell development in Jak-3-/- mice achieved by co-expression of IgH and E{micro}-myc transgenes
Int. Immunol.,
August 1, 2002;
14(8):
893 - 904.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. M. Crooks, Q.-L. Hao, D. Petersen, L. W. Barsky, and D. Bockstoce
IL-3 Increases Production of B Lymphoid Progenitors from Human CD34+CD38- Cells
J. Immunol.,
September 1, 2000;
165(5):
2382 - 2389.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION