|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 6 (September 15), 1999:
pp. 2072-2079
The (4;11)(q21;p15) Translocation Fuses the NUP98 and
RAP1GDS1 Genes and Is Recurrent in T-Cell Acute Lymphocytic
Leukemia
By
Damian J. Hussey,
Mario Nicola,
Sarah Moore,
Gregory B. Peters, and
Alexander Dobrovic
From the Department of Haematology-Oncology and University of
Adelaide Department of Medicine, The Queen Elizabeth Hospital,
Woodville, Australia; and the Division of Haematology, Institute of
Medical and Veterinary Science, Adelaide, Australia.
 |
ABSTRACT |
We determined the breakpoint genes of the translocation
t(4;11)(q21;p15) that occurred in a case of adult T-cell acute
lymphocytic leukemia (T-ALL). The chromosome 11 breakpoint was mapped
to the region between D11S470 and D11S860. The
nucleoporin 98 gene (NUP98), which is rearranged in several
acute myeloid leukemia translocations, is located within this region.
Analysis of somatic cell hybrids segregating the translocation
chromosomes showed that the chromosome 11 breakpoint occurs within
NUP98. The fusion partner of NUP98 was identified as the
RAP1GDS1 gene using 3' RACE. RAP1GDS1 codes for
smgGDS, a ubiquitously expressed guanine nucleotide exchange factor
that stimulates the conversion of the inactive GDP-bound form of
several ras family small GTPases to the active GTP-bound form. In the
NUP98-RAP1GDS1 fusion transcript (abbreviated as NRG), the 5' end of the NUP98 gene is joined in
frame to the coding region of the RAP1GDS1 gene. This
joins the FG repeat-rich region of NUP98 to RAP1GDS1,
which largely consists of tandem armadillo repeats. NRG fusion
transcripts were detected in the leukemic cells of 2 other adult T-ALL
patients. One of these patients had a variant translocation with a more
5' breakpoint in NUP98. This is the first report of an
NUP98 translocation in lymphocytic leukemia and the first time
that RAP1GDS1 has been implicated in any human malignancy.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
THE STUDY OF GENES at the breakpoints of
chromosome translocations has identified a large number of genes
involved in the development of human cancer.1-6 We
previously reported the translocation t(4;11)(q21;p15) as a
t(4;11)(q21;p14-15) in a 21-year-old man with T-cell acute lymphocytic
leukemia (T-ALL).7 Somatic cell hybrids containing the
der(4) and der(11) chromosomes enabled the localization of the
chromosome 11 breakpoint to 11p15.5 in the region between the
IGF2 and RRM1 loci.8 Studies using cosmids
as fluorescence in situ hybridization (FISH) probes on the
patient material further localized the breakpoint region to between the
11p15.5 markers D11S470 and RRM1.9
We describe the identification of the chromosome 4 and 11 breakpoint
genes as RAP1GDS1 and NUP98 and show that the
(4;11)(q21;p15) translocation is recurrent in T-ALL. This is the first
report of RAP1GDS1 involvement in any malignancy. NUP98
has previously been shown to be involved in 3 distinct acute myeloid
leukemia (AML) translocations. Two translocations involving the
HOXA9 and DDX10 genes have been shown to be recurrent,
whereas the translocation involving the HOXD13 gene has so far
been reported in a single case of therapy-induced AML.10-13
| |
MATERIALS AND METHODS |
Patient samples.
Table 1 summarizes the clinical and
laboratory features of the patients described here. Patient no. 1, a
21-year-old man, presented with moderate hepato-splenomegaly, a large
mediastinal mass, and a white blood cell count of 423 × 109/L, a platelet count of 109 × 109/L,
and a hemoglobin level of 7.8 g/dL and was diagnosed as ALL (French-American-British [FAB] L1). The blood film showed 99% blasts. The patient underwent 2 matched bone marrow transplantations but relapsed on both occasions. Patient no. 2, a 25-year-old woman, presented with a white blood cell count of 1.8 × 109/L, a platelet count of 23 × 109/L,
and a hemoglobin level of 5.5 g/dL and was diagnosed as ALL (FAB L1).
She showed cervical, axillary, and inguinal lymphadenopathy. The
blood film showed 87% blasts. Induction of remission was unsuccessful, and the patient died 34 days after presentation. Patient no. 3, a
49-year-old man who presented with a white blood cell count of 169 × 109/L, a platelet count of 116 × 109/L, and a hemoglobin level of 9.3 g/dL, was diagnosed as
ALL (FAB L2). The chest x-ray and computerized tomographic
(CT) scan showed a thymic mass. The blood film showed 99%
blasts. After 4 weeks of induction therapy, the bone marrow showed
morphological remission, although thymic enlargement was still evident
on the CT scan. Three months later, the marrow showed several foci of
primitive cells, which is suggestive of early relapse. A decision was
made not to persist with intensive therapy. The patient died 14 months after presentation.
View this table:
[in this window]
[in a new window]
|
Table 1.
Clinical Features, Cytogenetics, Immunophenotype, and
Gene Rearrangements of Patients With a t(4;11)(q21p14-15)
|
|
Somatic cell hybrid screening.
Human-mouse somatic cell hybrids containing the der(4) and der(11)
chromosomes from patient no. 1 were described previously.8 Polymerase chain reaction (PCR) was performed on 100 ng of DNA using
AmpliTaq Gold (Perkin-Elmer, Foster City, CA), with an initial denaturation at 94°C for 9 minutes followed by 35 cycles of
96°C for 30 seconds, 60°C for 1 minute, and 72°C for 45 seconds. We used published primers for D11S47014
and D11S860.15 Primers for NUP98 (Genbank
accession no. U41815), exon B (N1428F, 5'GGCATCTTTGTT TGGGAACAACC; N1531R, 5'CAAAGCCCAAAGTGGCTGTCG), and exon C (N1585F 5'CAGGCTGTTCTCCAGCAGCACA; N1681R,
5'CCTTCTTCTTAGGGTCTGACATC) were designed based on the published
intron/exon boundaries.12 For exon B, 10 µL of PCR
product was digested using 10 U Taq I (New England Biolabs,
Beverley, MA) to distinguish the mouse product from the human product.
3' RACE.
Total RNA was extracted using Trireagent (Sigma, St Louis, MO).
One-microgram aliquots of peripheral blood mononuclear
cell total RNA were reverse transcribed using Superscript II and the Adapter Primer (AP) from the 3' RACE kit (Life Technologies,
Gaithersburg, MD). The Expand Long Template PCR System (Roche,
Mannheim, Germany) was used in all subsequent PCR amplifications. The
reverse transcription product was amplified with an NUP98 exon
B primer, N1459F (5'ATTGGAGGGCCTCTTGGTACAGGAG), and the
Abridged Universal Amplification Primer (AUAP; Life Technologies). Touchdown PCR was performed with an initial step at 94°C for 2 minutes, followed by 10 cycles of 95°C for 30 seconds, 70°C
minus 1°C per cycle for 30 seconds, and 68°C for 8 minutes,
followed by 25 cycles of 95°C for 30 seconds, 60°C for 30 seconds, and 68°C for 8 minutes plus 20 seconds per cycle. A
biotinylated NUP98 exon B oligo, N1491F
(5'GGCCCCTGGATTTAATACTACG), internal to the oligo used in the
first round, was used to enrich for NUP98 containing sequences
using streptavidin-coated magnetic beads (Promega, Madison, WI).16 Second-round PCR of the enriched product was
performed using an NUP98 exon B primer, N1511F
(5'CGACAGCCACTTTGGGCTTTGGAGC), internal to the previous 2 sense primers and the AUAP with cycling conditions identical to the
first-round PCR. Second-round PCR products were electrophoresed in low
melting point agarose gels, purified using Wizard PCR Preps (Promega),
cloned into pGEM-T (Promega), and sequenced.
PCR and reverse transcription-PCR (RT-PCR) of
fusion mRNAs.
Reverse transcription of 1 µg of total RNA with Superscript II and
random hexamers was performed according to the manufacturer's protocol
(Life Technologies). One twentieth of the reverse transcription was
used for PCR. NUP98 forward primers (N1265F or N1428F) and a
RAP1GDS1 reverse primer, R108R
(5'TTGAGCCAGGGCTTGAAAGAAGCTG), were used to amplify NRG
fusion cDNAs, whereas the primers R 5'UTRF (GGTTCCTCACCCTCGGGGAGC) and N1848R (GGATGGTTCATCGTCATCCAGCC) were used
to amplify RGN cDNAs. PCR using AmpliTaq Gold was performed with an initial step at 94°C for 9 minutes, followed by 35 cycles of 94°C for 30 seconds, 65°C for 1 minute, and 72°C for 45 seconds. PCR products were electrophoresed in low melting point agarose gels, purified using Wizard PCR Preps, and sequenced.
Southern analysis of PCR products.
PCR products were electrophoresed through agarose gels and transferred
to Hybond N+ membrane (Amersham Pharmacia Biotech, Uppsala, Sweden).
Hybridization to end-labeled oligo probes was performed for 16 hours at
42°C in a 20-mL solution of 4× SSPE, 1% sodium dodecyl
sulfate (SDS), 1 in 20 dilution of blotto (5% nonfat dried milk
powder, 0.02% sodium azide), and 0.1 mg/mL denatured salmon sperm DNA.
After washing at 42°C in 2× SSC, 0.1% SDS, the membranes
were autoradiographed at  80°C.
NUP98 and RAP1GDS1 probes.
Probes were generated by PCR after reverse transcription of peripheral
blood mononuclear cell RNA and gel purified from low melting point
agarose gels using Wizard PCR Preps. The identity of the probes was
confirmed by sequencing. The 1,084-bp NUP98 cDNA probe was
amplified using the primers N301F and N1384R, using AmpliTaq
Gold with an initial step at 94°C for 9 minutes followed by 35 cycles of 94°C for 30 seconds, 65°C for 1 minute, and 72°C for 45 seconds. The RAP1GDS1 primers, R11F
(5'TCAGTGATACCTTGAAGAAGCTG) and R1673R
(5'CTTTCCACAGTAAGTCTCTCTGCTC), were developed from the cDNA
sequence (Genbank accession no. X63465). A 1,665-bp RAP1GDS1
cDNA probe was amplified using the Expand Long Template PCR System with
an initial step at 94°C for 2 minutes, followed by 10 cycles of
94°C for 10 seconds, 63°C for 30 seconds, and 68°C for 2 minutes, followed by 35 cycles of 94°C for 10 seconds, 63°C for
30 seconds, and 68°C for 2 minutes plus 20 seconds per cycle.
Northern analysis.
Ten micrograms of RNA was electrophoresed in a 1% agarose/1.2 mol/L
formaldehyde gel, blotted onto Brightstar plus membrane (Ambion,
Austin, TX) according to the manufacturer's protocol, and UV fixed to
the membrane. Multiple tissue Northerns were from Clontech (Palo Alto,
CA). Hybridization to random nonamer-labeled probe was performed at
42°C in a 20-mL solution of 1 mol/L NaCl, 10% dextran sulphate,
1% SDS, 50% deionized formamide, and 0.2 mg/mL denatured salmon sperm
DNA. Membranes were washed to a final stringency of 0.2× SSPE,
1% SDS at 65°C and autoradiographed at 80°C.
| |
RESULTS |
Identification of NUP98 as the chromosome 11 breakpoint gene.
FISH analysis of cosmid probes had narrowed the chromosome 11 breakpoint region of patient no. 1 to between RRM1 and
D11S470 on 11p15.5 (Fig
1).9 The hybrids containing the der(4) and der(11)
chromosomes8 were tested with primers specific to
D11S470 and D11S860. D11S470 was on the der(4)
chromosome, and D11S860 was on the der(11) chromosome
(results not shown). This narrowed the breakpoint to the region
between D11S860 and D11S470. The nucleoporin 98 (NUP98) gene maps to a similar region and is located proximal
to the region recognized by the cosmid Z104.10 Analysis of
the PAC pDJ1173a5 shows that ZNF195, the zinc finger gene
within Z104, is distal to D11S470.17 NUP98
was absent from the PAC sequence, placing NUP98 proximal to
D11S470 and therefore within the breakpoint region (Fig 1).
View larger version (11K):
[in this window]
[in a new window]
| Fig 1.
Position of the chromosome 11 breakpoint with respect to
the 11p15.5 markers used for FISH and PCR mapping. NUP98 lies
within the candidate breakpoint region indicated by the arrowed line.
The  chain of hemoglobin (HBBC) and the H-ras oncogene
(HRAS) are at the extremities of 11p15.5. C and T denote
centromeric and telomeric, respectively.
|
|
We therefore sought to investigate NUP98 as a candidate
breakpoint gene. Five exons, named A through E, have been defined in
the NUP98 breakpoint region.12 Most NUP98
breakpoints occur between exons B and C.10-13 The der(4)-
and der(11)-containing hybrids derived from patient no. 1 were tested
by PCR for the presence of exons B and C. The der(11) hybrid contained
exon B and the der(4) hybrid contained exon C
(Fig 2). Because exons B and C are on the
complementary derivative chromosomes, NUP98 is disrupted
between exons B and C in patient no. 1 and is the chromosome 11 breakpoint gene.
View larger version (57K):
[in this window]
[in a new window]
| Fig 2.
PCR analysis of the der(4) and der(11) containing somatic
cell hybrids. m is the pUC19/Hpa II molecular weight marker, H
is normal human, M is mouse, 4 is the der(4) hybrid, and 11 is the
der(11) hybrid. (A) NUP98 exon B PCR product digested with
Taq I. Mouse and human NUP98 cDNA sequences are highly
conserved and the exon B PCR also amplified mouse NUP98. The
mouse and human exon B PCR products were distinguished by a Taq
I restriction site, which is present in the mouse product but absent in
the human product. (B) NUP98 exon C PCR product.
|
|
Identification of RAP1GDS1 as the chromosome 4 breakpoint gene by
3' RACE.
3' RACE was used to determine the chromosome 4 gene fused to
NUP98 in patient no. 1. Experiments were performed in parallel on the presentation sample of patient no. 1 and peripheral blood mononuclear cells from a normal individual. One predominant band was
seen in the normal individual. Additional bands were seen in the
leukemic presentation sample (results not shown). The bands were
sequenced and analyzed using the BLAST algorithm to search the GenBank
sequence database.18 The common band was shown to correspond to the normal 4.05-kb NUP98 transcript.
A band that was slightly larger than the normal NUP98 band had
the 5' end of NUP98 fused with the coding region of the
guanine nucleotide disassociation stimulator gene, RAP1GDS1.
The fusion maintained the reading frame of RAP1GDS1. We
hereafter denote this hybrid transcript as NRG (for
NUP98-RAP1GDS1). The RAP1GDS1 sequence in NRG
starts at nucleotide 5 of the coding sequence. The methionine
and the first G of the codon for aspartic acid are lost. However, the
aspartic acid is retained in the fusion protein, because the last base
of NUP98 exon B is a G (Fig 3).
Other RACE products that were cloned and sequenced had an identical
NUP98 - RAP1GDS1 junction to NRG but continued
into presumed RAP1GDS1 intron/exon splice sites and terminated
in either introns of RAP1GDS1 or as yet-unsequenced exons of
RAP1GDS1 (data not shown).
RT-PCR.
RT-PCR of patient no. 1 using primers flanking the
NUP98-RAP1GDS1 junction gave a product of the expected
size (395 bp), confirming that an NRG fusion mRNA was formed
(Fig 4). No bands were seen in the
peripheral blood mononuclear cells from normal controls. Two T-ALL
patients with a similar karyotype (patients no. 2 and 3; see Table 1)
were also tested for the fusion mRNA by RT-PCR (Fig 4). Patient no. 2 was clearly positive, with an RT-PCR product of identical size to that
of patient no. 1. Patient no. 3 had a smaller RT-PCR product of 162 bp.
Sequencing showed that patient no. 3 had a novel in-frame fusion of
NUP98 to RAP1GDS1 with the NUP98 breakpoint
immediately preceding exon A and an RAP1GDS1 junction
(nucleotide 5 of the coding sequence) identical to that of patients no.
1 and 2 (Fig 3). This transcript, denoted as NRG2, also
maintains the first aspartic acid in the RAP1GDS1 sequence.
View larger version (87K):
[in this window]
[in a new window]
| Fig 4.
RT-PCR analysis of NRG and RGN fusion
transcripts in 3 t(4;11)(q21;p15) patients. P1, P2, and P3 are RT-PCR
products from peripheral blood mononuclear cells from the patients. C1
and C2 are RT-PCR products from peripheral blood mononuclear cells of
normal donors. Samples marked with a minus sign are negative control
RT-PCRs without reverse transcriptase. H2O controls are
negative control RT-PCRs without target. The lane marked m contains
both SPP1/EcoRI and pUC19/Hpa II molecular weight
markers. The most prominent bands in the RGN PCR of patient no.
3 are alternative splicings of RGN with and without exon B.
|
|
The complexity of minor bands seen with all 3 patients in the
NRG RT-PCR (Fig 4) is a repeatable observation. Whereas some of
the faint upper bands in patient no. 3 appear to be the same size as
the NRG RT-PCR products in patients no. 1 and 2, they do not
contain NUP98 exon B, as shown by hybridization with the N1511F
oligo (data not shown), confirming that NRG2 is not just an
alternatively spliced version of NRG.
We analyzed expression of the complementary fusion cDNA,
RAP1GDS-NUP98 (RGN), by RT-PCR. Primers that could
amplify RGN from all 3 patients showed that RGN is only
expressed in patient no. 3 (Fig 4).
Some of the RACE products of patient no. 1 showed an insertion of the
trinucleotide CAG at the NUP98-RAP1GDS1 junction. The variable
insertion of CAG was also seen in RT-PCR products from all 3 patients
(data not shown). This insertion is most likely due to alternative
splicing of intronic sequence immediately adjacent to an exon. Because
there are 2 distinct NUP98 breakpoint regions in our patients,
we deduce that it probably comes from the intron adjacent to the first
RAP1GDS1 exon in the translocation. The CAG conforms to the
consensus sequence YAG (Y is a pyrimidine) of the 3' end of an
intron.19 Alternative splicing involving a single
trinucleotide has previously been reported for the c-kit gene.20
Northern analysis.
A 1,084-bp NUP98 cDNA probe was used for Northern analysis
(Fig 5A). The normal controls show 4.05- and 7.25-kb bands. The 4.4-kb NRG transcript can be seen above
the 4.05-kb NUP98 transcript for the presentation samples of
patients no. 1 and 2. In patient no. 3, the NRG2 transcript
cannot readily be seen as it migrates just above the normal
NUP98 band. NRG is not seen in the remission sample
from patient no. 1. The relapse specimen from the same patient shows
markedly increased NRG expression compared with the endogenous
NUP98. The increased NRG expression in the relapse specimen may be related to the addition to the short arm of the previously normal chromosome 11 (Table 1).
View larger version (67K):
[in this window]
[in a new window]
| Fig 5.
Northern analysis of NRG expression. (A)
Hybridization using a NUP98 cDNA probe. (B) Hybridization of
the same membrane with a RAP1GDS1 cDNA probe. (C) 18S rRNA from
the ethidium bromide-stained gel before transfer. RNA was isolated from
2 normal controls (C1 and C2) and from the 3 patients (P1, P2, and P3).
pres is a presentation sample, rem is a remission sample, and rel is a
relapse sample. Each lane contains 5 µg of total RNA from peripheral
blood mononuclear cells, except that P1 rem contains 5 µg of total
RNA from bone marrow. The lane marked m is a RNA ladder (Promega). The
band in this lane in (C) is marker and not 18S RNA. N indicates the
NUP98 4.05- and 7.25-kb bands. The 7.25-kb band is a precursor
that also contains the NUP96 coding sequence.47 RG
indicates the 2.8- and 4.1-kb RAP1GDS1 bands. NRG
indicates the 4.4-kb NRG transcript. NRG2 in patient no. 3 is
not indicated, because it is not distinguishable from the 4.05-kb
NUP98 and 4.1-kb RAP1GDS1 bands. The arrowheads
indicate higher molecular weight transcripts that hybridize with both
the NUP98 and RAP1GDS1 probes.
|
|
A second new transcript of approximately 5.8 kb was seen in the
presentation and relapse samples of patient no. 1. This band is also
present in patient no. 2 but is not discernible on Fig 5A. Patient no.
3 showed a 5.5-kb transcript. The shorter size corresponds
approximately to the size difference (233 bp) between NRG and
NRG2.
RAP1GDS1 shows 2.8- and 4.1-kb transcripts in all tissues
tested (Fig 6). When the patient was
Northern probed with the RAP1GDS1 probe, the
4.1-kb transcript was visible as a distinct band slightly lower than
the NRG transcript, although the 2 bands are not readily distinguishable after photo-reproduction (Fig 5B). The 5.8- and 5.5-kb
bands are present in the patient samples, confirming that they are
NRG transcripts. They are probably generated by the same mechanism that generates the upper 4.1-kb RAP1GDS1 transcript.
View larger version (107K):
[in this window]
[in a new window]
| Fig 6.
Multiple tissue Northern analysis of RAP1GDS1.
Each lane contains 2 µg of polyA RNA. (A) Hybridization with a
RAP1GDS1 cDNA probe shows two predominant bands of 4.1 and 2.8 kb. (B) Hybridization with a -actin cDNA probe (Clontech).
|
|
| |
DISCUSSION |
We originally reported a t(4;11)(q21;p14-15) translocation in a patient
with T-ALL.7 Molecular analysis then localized the
chromosome 11 breakpoint to 11p15.5. 8 Subsequently, 2 further T-ALL patients (no. 2 and 3), karyotyped as t(4;11)(q21;p14-15)
and t(4;11)(q21;p15), respectively, were identified by us. Three other
patients have been reported with either a t(4;11)(q21;p14-15) or a
t(4;11)(q21;p15) as the primary translocation.21-23 The
clinical data, cytogenetics, and immunophenotype of all 6 patients are
summarized in Table 1.
Whereas different surface markers have been tested in each individual,
the following generalizations can be drawn: (1) the cytochemistry and
surface markers of all 6 patients are consistent with T-ALL; (2) the
leukemic cells are positive for CD7 and CD5 and usually positive for
CD2, but are negative for CD4 and CD8; (3) CD10 is often positive in a
proportion of the cells; and (4) most express 1 or more of the myeloid
markers CD11b, CD13, and CD33 in a proportion of the cells. None of the
6 patients with the primary translocation was an infant. They ranged
from 6 to 53 years of age, with a preponderance of younger individuals, as is typical for T-ALL.24 All had a fairly short survival
after diagnosis. Patient no. 1, who showed the longest survival,
underwent 2 matched allogeneic bone marrow transplants but relapsed
with aggressive disease on both occasions.
Four of the 6 patients presented with additional karyotypic
rearrangements (Table 1). This may account for some of the differences between their clinical pictures. Interestingly, the 2 patients who
presented with a very low white blood cell count both had a 12p deletion.
We identified NUP98 as the chromosome 11 breakpoint gene by PCR
analysis of somatic cell hybrids containing the derivative chromosomes
of patient no. 1. It was shown that exons B and C of NUP98 were
found on the der(11) and der(4) chromosomes, respectively, thereby
mapping the breakpoint to the intron between exons B and C. This
confirms the previously reported orientation of NUP98 with
regard to the centromere.11 Because the principal
transcript in the other NUP98 translocations fuses the 5'
end of the NUP98 gene in frame to the 3' end of a second
gene, we used 3' RACE and identified the RAP1GDS1 gene as
the 3' partner. RAP1GDS1 has previously been mapped to
4q21-25.25
RT-PCR showed that NUP98-RAP1GDS1 (NRG) fusion mRNAs
were present in patients no. 1, 2, and 3. Sequencing showed that the same RAP1GDS1 sequence, starting at nucleotide 5 of the coding region, was present in all 3 patients (Fig 3). Patients no. 1 and 2 had
an identical fusion mRNA containing the 5' sequence of
NUP98 up to and including exon B, whereas patient no. 3 lacked NUP98 exons A and B. Breakpoints in NUP98 have been
reported to occur between exons B and C10-13 or between
exons D and E,12 with a predominance of breakpoints between
exons B and C.
The breakpoint in patient no. 3 (in the intron preceding exon A) is the
most proximal NUP98 breakpoint reported. The more proximal
breakpoint position is consistent with the Northern results in which
the NRG2 fusion band is almost identically sized to the 4.05-kb
NUP98 transcript. NRG2 is 233 bp shorter than
NRG on account of the missing exons A and B.
The absence of the reciprocal RGN transcript in patients no. 1 and 2 (Fig 4) indicates that NRG is the leukemia-associated transcript. It is unclear why the reciprocal transcript is absent as
RAP1GDS1 is universally expressed and RGN is under the
control of the RAP1GDS1 promoter. A similar situation has been
observed for the BCR-ABL translocation in which the reciprocal
ABL-BCR transcript is not expressed in all CML patients,
although ABL is also universally expressed.26
Nup98 is a component of the nuclear pore complex, involved in
the export of RNA and protein from the nucleus.27,28 The previously described fusion partners of NUP98 are functionally diverse.10-13 HOXA9 and HOXD13 code for
transcription factors required for normal development29,30
and DDX10 codes for a putative RNA helicase.31
Another nucleoporin gene, NUP214, is also involved in
translocations in leukemia. NUP214, also known as CAN,
is fused to either the DEK gene or to the SET gene in
cases of AML.32,33
Both nup98 and nup214 contain multiple phenylalanine-glycine (FG)
repeats. The FG repeats are presumed contact sites for multiprotein transport complexes that mediate bidirectional transport across the
nuclear pores.34 All known NUP98 and NUP214
translocations retain the majority of the FG repeats.10-13
The FG repeats are also retained in the 3 patients reported here (Fig
7). Patient no. 3, who has the most 5' breakpoint yet reported,
still has 30 of the 37 FG repeats.
View larger version (36K):
[in this window]
[in a new window]
| Fig 7.
Schematic representation of the NUP98, smgGDS, NRG, and
NRG2 proteins. Vertical arrowheads represent breakpoints in NUP98 and
smgGDS. FG, FG (phenylalanine-glycine) repeat-rich areas; GLEBS, GLEBS
(Gle2p-binding motif) -like motif48; NRM, nucleoporin RNA
binding motif; ARMADILLO, tandem armadillo repeats.
|
|
The FG repeat-containing nup98 portion of the nup98-hoxa9 fusion
protein acts as a potent activator of hoxa9 activity by recruiting the
CBP and p300 transcriptional coactivators.35 The CBP/p300 binding activity of the nup98-hoxa9 fusion protein is correlated to its
transforming activity. The transforming ability is retained when the FG
repeat region from nup98 is exchanged for that of nup214, which
directly implicates the FG repeats in the transforming activity. Not
all of the FG repeats are required to interact with CBP/p300 or to
transform, because a nup98-hoxa9 splice variant with 20 FG repeats
still retains transforming ability.35
The entire coding region, except for the initial methionine of
RAP1GDS1, is retained in the NRG and NRG2
transcripts. The product rap1gds, usually referred to as
smgGDS, has guanine nucleotide exchange factor (GEF)
activity.36 GEFs stimulate or inhibit exchange of GDP for
GTP at small GTPase proteins to convert the inactive GDP bound form to
the active GTP bound form. SmgGDS was first reported as a stimulator of
GDP/GTP exchange for rap1a, then called smg p21a.37 SmgGDS
also acts on rap1b as well as on other small GTPases, including K-ras,
rac1, rac2, rhoA, and ralB.36,38,39 Interestingly, rap1a
and K-ras are antagonistic, because the protein smg p21a/rap1a was
first identified as Krev-1, which has the ability to revert
K-ras-transformed NIH 3T3 fibroblasts.40 However, rap1 is
unlikely to be the principal target of smgGDS, because smgGDS
cooperates with K-ras in transformation.41 RhoA and rac2
have been reported to be more important targets for smgGDS than
rap1a.38
SmgGDS is structurally unique among the GEFs, because it shows no
homology to other GEFs and is composed largely of tandem repeats of the
43 amino acid armadillo motif (Fig 7).42 The armadillo
motif was originally found in the Drosophila melanogaster armadillo gene and its vertebrate homologues -catenin and
plakoglobin.43,44 Subsequently, it was identified in a
number of other genes that contain tandem repeats of
armadillo,42 including importin  .45 It has
been suggested that armadillo repeats mediate protein-protein interactions. 42
Determining the cellular location of nrg will be critical in
determining its role in malignancy. SmgGDS normally interacts with
membrane-bound and cytoplasmic ras superfamily GTPPases. If the nrg
hybrid protein is cytoplasmic, its function may involve alterations of
signaling via ras family small GTPases. However, by analogy to other
armadillo proteins, such as -catenin and importin , smgGDS may
have an as yet undescribed cytoplasmic-nuclear shuttling capacity. The
armadillo repeats of smgGDS may lead it to mimic -catenin and
interact with the transcription factors involved in the wingless
signaling pathway.46 Alternatively, the amino terminal end
of nup98 might relocate smgGDS to the nuclear pore so that the fusion
protein may modify nuclear transport. Because nrg contains an intact
smgGDS sequence, it may act as a second GEF for ran in promoting
nuclear transport. Finally, nrg may be located in the nucleus, where it
may modify transcription, as happens with other nup98 fusion
proteins.35 Transcription factors that interact with the
armadillo repeats may become coupled to transcription factors that
interact with FG repeats.
This report shows that NUP98 can be involved in T-ALL as well
as myeloid malignancies. Moreover, the identification of 3 patients with the NRG fusion shows that the t(4;11)(q21;p15) is a
recurrent translocation in T-ALL. Whether NRG is capable of
causing cellular transformation and hematological malignancy is the
subject of further investigation in our laboratory.
| |
ACKNOWLEDGMENT |
The authors thank Ed Sage for his support during the duration of this
research. Jenny Hardingham, Viki Kalatzis, and Jennie Finch were
involved in the preliminary work that led to this investigation. We
also thank Alec Morley, Tim Hughes, Luen Bik To, Lesley Snell, and Pam
Dyson for access to patient material and information; Peter Little,
Marcel Mannens, and Bert Redeker for cosmids; Nick Wickham for reading
the manuscript; Peter Aplan, Leonie Ashman, and Sarah Swinburne for
discussions; and Tina Bianco for assistance with figure preparation.
| |
FOOTNOTES |
Submitted March 16, 1999; accepted May 19, 1999.
Supported by the National Health and Medical Research Council, Anti
Cancer Foundation of South Australia, and the Queen Elizabeth Hospital
Research Foundation. D.J.H. was supported by the Queen Elizabeth
Hospital Research Foundation.
Sequences reported in this manuscript have been deposited in the
Genbank database with accession nos. AF133331 and AF133333.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Alexander Dobrovic, PhD, Chief Medical
Scientist, Department of Haematology-Oncology, The Queen Elizabeth
Hospital, Woodville, SA 5011, Australia; e-mail:
adobrovic{at}medicine.adelaide.edu.au.
| |
REFERENCES |
1.
Rabbitts TH:
Chromosomal translocations in human cancer.
Nature
372:143, 1994[Medline]
[Order article via Infotrieve]
2.
Sawyers CL:
Molecular genetics of acute leukaemia.
Lancet
349:196, 1997[Medline]
[Order article via Infotrieve]
3.
Look AT:
Oncogenic transcription factors in the human acute leukemias.
Science
278:1059, 1997[Abstract/Free Full Text]
4.
Gilliland DG:
Molecular genetics of human leukemia.
Leukemia
12:S7, 1998 (suppl 1)
5.
Rowley JD:
The critical role of chromosome translocations in human leukemias.
Annu Rev Genet
32:495, 1998[Medline]
[Order article via Infotrieve]
6.
Nowell PC, Rowley JD, Knudson AG Jr:
Cancer genetics, cytogenetics Defining the enemy within.
Nat Med
4:1107, 1998[Medline]
[Order article via Infotrieve]
7.
Hardingham JE, Peters GB, Dobrovic A, Dale BM, Kotasek D, Ford HE, Story CJ, Sage RE:
A rare translocation (4;11)(q21;p14-15) in an acute lymphoblastic leukemia expressing T-cell and myeloid markers.
Cancer Genet Cytogenet
56:255, 1991[Medline]
[Order article via Infotrieve]
8.
Kalatzis V, Peters GB, Dobrovic A:
Mapping of the chromosome 11 breakpoint of the t(4;11)(q21;p14-15) translocation.
Cancer Genet Cytogenet
69:122, 1993[Medline]
[Order article via Infotrieve]
9.
Dobrovic A, Peters G, Finch J, Kalatzis V, Fitzgerald D, Hardingham JE, Sage RE:
Localisation of chromosome 11 breakpoint in a translocation t(4;11) (q21:p15) in T cell acute lymphoblastic leukemia.
Amer J Hum Genet
55:298, 1994 (suppl)
10.
Nakamura T, Largaespada DA, Lee MP, Johnson LA, Ohyashiki K, Toyama K, Chen SJ, Willman CL, Chen IM, Feinberg AP, Jenkins NA, Copeland NG, Shaughnessy JD Jr:
Fusion of the nucleoporin gene NUP98 to HOXA9 by the chromosome translocation t(7;11)(p15;p15) in human myeloid leukaemia.
Nat Genet
12:154, 1996[Medline]
[Order article via Infotrieve]
11.
Borrow J, Shearman AM, Stanton VP Jr, Becher R, Collins T, Williams AJ, Dube I, Katz F, Kwong YL, Morris C, Ohyashiki K, Toyama K, Rowley J, Housman DE:
The t(7;11)(p15;p15) translocation in acute myeloid leukaemia fuses the genes for nucleoporin NUP98 and class I homeoprotein HOXA9.
Nat Genet
12:159, 1996[Medline]
[Order article via Infotrieve]
12.
Arai Y, Hosoda F, Kobayashi H, Arai K, Hayashi Y, Kamada N, Kaneko Y, Ohki M:
The inv(11)(p15q22) chromosome translocation of de novo and therapy-related myeloid malignancies results in fusion of the nucleoporin gene, NUP98, with the putative RNA helicase gene, DDX10.
Blood
89:3936, 1997[Abstract/Free Full Text]
13.
Raza-Egilmez SZ, Jani-Sait SN, Grossi M, Higgins MJ, Shows TB, Aplan PD:
NUP98-HOXD13 gene fusion in therapy-related acute myelogenous leukemia.
Cancer Res
58:4269, 1998[Abstract/Free Full Text]
14.
Miwa T, Sudo K, Nakamura Y, Imai T:
Fifty sequenced-tagged sites on human chromosome 11.
Genomics
17:211, 1993[Medline]
[Order article via Infotrieve]
15.
McNoe LA, Eccles MR, Reeve AE:
Dinucleotide repeat polymorphism at the D11S860 locus.
Nucleic Acids Res
20:1161, 1992[Free Full Text]
16.
Lankiewicz S, Gisselmann G, Hatt H:
Enhanced RACE method using specific enrichment by biotinylated oligonucleotides bound to streptavidin coated magnetic particles.
Nucleic Acids Res
25:2037, 1997[Abstract/Free Full Text]
17.
Hussey DJ, Parker NJ, Hussey ND, Little PFR, Dobrovic A:
Characterization of a KRAB family zinc finger gene, ZNF195, mapping to chromosome band 11p15.5.
Genomics
45:451, 1997[Medline]
[Order article via Infotrieve]
18.
Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ:
Gapped BLAST and PSI-BLAST: A new generation of protein database search programs.
Nucleic Acids Res
25:3389, 1997[Abstract/Free Full Text]
19.
Moore MJ, Query CC, Sharp PA:
Splicing of precursors to messenger RNAs by the spliceosome, in
Atkins J,
Gesteland R
(eds):
The RNA World. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1993, p 303.
20.
Crosier PS, Ricciardi ST, Hall LR, Vitas MR, Clark SC, Crosier KE:
Expression of isoforms of the human receptor tyrosine kinase c-kit in leukemic cell lines and acute myeloid leukemia.
Blood
82:1151, 1993[Abstract/Free Full Text]
21.
Inoue S, Tyrkus M, Ravindranath Y, Gohle N:
A variant translocation between chromosomes 4 and 11, t(4q;11p) in a child with acute leukemia.
Am J Pediatr Hematol Oncol
7:211, 1985[Medline]
[Order article via Infotrieve]
22.
Bloomfield CD, Goldman AI, Alimena G, Berger R, Borgstrom GH, Brandt L, Catovsky D, de la Chapelle A, Dewald GW, Garson OM, Garwicz S, Golomb HM, Hossfeld DK, Lawler SD, Mitelman F, Nilsson P, Pierre RV, Philip P, Prigogina E, Rowley JD, Sakurai M, Sandberg AA, Secker Walker LM, Tricot G, Van Den Berghe H, Van Orshoven A, Vuopio P, Whang-Peng J:
Chromosomal abnormalities identify high-risk and low-risk patients with acute lymphoblastic leukemia.
Blood
67:415, 1986[Abstract/Free Full Text]
23.
Pui CH, Frankel LS, Carroll AJ, Raimondi SC, Shuster JJ, Head DR, Crist WM, Land VJ, Pullen DJ, Steuber CP:
Clinical characteristics and treatment outcome of childhood acute lymphoblastic leukemia with the t(4;11)(q21;q23): A collaborative study of 40 cases.
Blood
77:440, 1991[Abstract/Free Full Text]
24.
Catovsky DFR:
The Lymphoid Leukaemias. London, UK, Butterworth, 1990.
25.
Riess O, Epplen C, Siedlaczck I, Epplen JT:
Chromosomal assignment of the human smg GDP dissociation stimulator gene to human chromosome 4q21-q25.
Hum Genet
92:629, 1993[Medline]
[Order article via Infotrieve]
26.
Melo JV, Gordon DE, Cross NC, Goldman JM:
The ABL-BCR fusion gene is expressed in chronic myeloid leukemia.
Blood
81:158, 1993[Abstract/Free Full Text]
27.
Powers MA, Forbes DJ, Dahlberg JE, Lund E:
The vertebrate GLFG nucleoporin, Nup98, is an essential component of multiple RNA export pathways.
J Cell Biol
136:241, 1997[Abstract/Free Full Text]
28.
Zolotukhin AS, Felber BK:
Nucleoporins nup98 and nup214 participate in nuclear export of human immunodeficiency virus type 1 Rev.
J Virol
73:120, 1999[Abstract/Free Full Text]
29.
Lawrence HJ, Helgason CD, Sauvageau G, Fong S, Izon DJ, Humphries RK, Largman C:
Mice bearing a targeted interruption of the homeobox gene HOXA9 have defects in myeloid, erythroid, and lymphoid hematopoiesis.
Blood
89:1922, 1997[Abstract/Free Full Text]
30.
Muragaki Y, Mundlos S, Upton J, Olsen BR:
Altered growth and branching patterns in synpolydactyly caused by mutations in HOXD13.
Science
272:548, 1996[Abstract]
31.
Savitsky K, Ziv Y, Bar-Shira A, Gilad S, Tagle DA, Smith S, Uziel T, Sfez S, Nahmias J, Sartiel A, Eddy RL, Shows TB, Collins FS, Shiloh Y, Rotman G:
A human gene (DDX10) encoding a putative DEAD-box RNA helicase at 11q22-q23.
Genomics
33:199, 1996[Medline]
[Order article via Infotrieve]
32.
von Lindern M, Fornerod M, van Baal S, Jaegle M, de Wit T, Buijs A, Grosveld G:
The translocation (6;9), associated with a specific subtype of acute myeloid leukemia, results in the fusion of two genes, dek and can, and the expression of a chimeric, leukemia-specific dek-can mRNA.
Mol Cell Biol
12:1687, 1992[Abstract/Free Full Text]
33.
von Lindern M, van Baal S, Wiegant J, Raap A, Hagemeijer A, Grosveld G:
Can, a putative oncogene associated with myeloid leukemogenesis, may be activated by fusion of its 3' half to different genes: Characterization of the set gene.
Mol Cell Biol
12:3346, 1992[Abstract/Free Full Text]
34.
Radu A, Moore MS, Blobel G:
The peptide repeat domain of nucleoporin Nup98 functions as a docking site in transport across the nuclear pore complex.
Cell
81:215, 1995[Medline]
[Order article via Infotrieve]
35.
Kasper LH, Brindle PK, Schnabel CA, Pritchard CE, Cleary ML, van Deursen JM:
CREB binding protein interacts with nucleoporin-specific FG repeats that activate transcription and mediate NUP98-HOXA9 oncogenicity.
Mol Cell Biol
19:764, 1999[Abstract/Free Full Text]
36.
Mizuno T, Kaibuchi K, Yamamoto T, Kawamura M, Sakoda T, Fujioka H, Matsuura Y, Takai Y:
A stimulatory GDP/GTP exchange protein for smg p21 is active on the post-translationally processed form of c-Ki-ras p21 and rhoA p21.
Proc Natl Acad Sci USA
88:6442, 1991[Abstract/Free Full Text]
37.
Yamamoto T, Kaibuchi K, Mizuno T, Hiroyoshi M, Shirataki H, Takai Y:
Purification and characterization from bovine brain cytosol of proteins that regulate the GDP/GTP exchange reaction of smg p21s, ras p21-like GTP-binding proteins.
J Biol Chem
265:16626, 1990[Abstract/Free Full Text]
38.
Chuang TH, Xu X, Quilliam LA, Bokoch GM:
SmgGDS stabilizes nucleotide-bound and -free forms of the Rac1 GTP-binding protein and stimulates GTP/GDP exchange through a substituted enzyme mechanism.
Biochem J
303:761, 1994
39.
Iouzalen N, Camonis J, Moreau J:
Identification and characterization in Xenopus of XsmgGDS, a RalB binding protein.
Biochem Biophys Res Commun
250:359, 1998[Medline]
[Order article via Infotrieve]
40.
Kitayama H, Sugimoto Y, Matsuzaki T, Ikawa Y, Noda M:
A ras-related gene with transformation suppressor activity.
Cell
56:77, 1989[Medline]
[Order article via Infotrieve]
41.
Fujioka H, Kaibuchi K, Kishi K, Yamamoto T, Kawamura M, Sakoda T, Mizuno T, Takai Y:
Transforming and c-fos promoter/enhancer-stimulating activities of a stimulatory GDP/GTP exchange protein for small GTP-binding proteins.
J Biol Chem
267:926, 1992[Abstract/Free Full Text]
42.
Peifer M, Berg S, Reynolds AB:
A repeating amino acid motif shared by proteins with diverse cellular roles (letter).
Cell
76:789, 1994[Medline]
[Order article via Infotrieve]
43.
Peifer M, Wieschaus E:
The segment polarity gene armadillo encodes a functionally modular protein that is the Drosophila homolog of human plakoglobin.
Cell
63:1167, 1990[Medline]
[Order article via Infotrieve]
44.
McCrea PD, Turck CW, Gumbiner B:
A homolog of the armadillo protein in Drosophila (plakoglobin) associated with E-cadherin.
Science
254:1359, 1991[Abstract/Free Full Text]
45.
Gorlich D, Henklein P, Laskey RA, Hartmann E:
A 41 amino acid motif in importin-alpha confers binding to importin-beta and hence transit into the nucleus.
EMBO J
15:1810, 1996[Medline]
[Order article via Infotrieve]
46.
Dierick H, Bejsovec A:
Cellular mechanisms of wingless/Wnt signal transduction.
Curr Top Dev Biol
43:153, 1999[Medline]
[Order article via Infotrieve]
47.
Fontoura BM, Blobel G, Matunis MJ:
A conserved biogenesis pathway for nucleoporins: Proteolytic processing of a 186-kilodalton precursor generates Nup98 and the novel nucleoporin, Nup96.
J Cell Biol
144:1097, 1999[Abstract/Free Full Text]
48.
Pritchard CE, Fornerod M, Kasper LH, van Deursen JM:
RAE1 is a shuttling mRNA export factor that binds to a GLEBS-like NUP98 motif at the nuclear pore complex through multiple domains.
J Cell Biol
145:237, 1999[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
P. Gorello, L. Brandimarte, R. La Starza, V. Pierini, L. Bury, R. Rosati, M. F. Martelli, P. Vandenberghe, I. Wlodarska, and C. Mecucci
t(3;11)(q12;p15)/NUP98-LOC348801 fusion transcript in acute myeloid leukemia
Haematologica,
September 1, 2008;
93(9):
1398 - 1401.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Slape, Y. W. Lin, H. Hartung, Z. Zhang, L. Wolff, and P. D. Aplan
NUP98-HOX Translocations Lead to Myelodysplastic Syndrome in Mice and Men
J Natl Cancer Inst Monographs,
July 1, 2008;
2008(39):
64 - 68.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Strehl, K. Nebral, M. Konig, J. Harbott, H. Strobl, R. Ratei, S. Struski, B. Bielorai, M. Lessard, M. Zimmermann, et al.
ETV6-NCOA2: A Novel Fusion Gene in Acute Leukemia Associated with Coexpression of T-Lymphoid and Myeloid Markers and Frequent NOTCH1 Mutations
Clin. Cancer Res.,
February 15, 2008;
14(4):
977 - 983.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Vitale, A. Guarini, C. Ariola, M. Mancini, C. Mecucci, A. Cuneo, F. Pane, G. Saglio, G. Cimino, A. Tafuri, et al.
Adult T-cell acute lymphoblastic leukemia: biologic profile at presentation and correlation with response to induction treatment in patients enrolled in the GIMEMA LAL 0496 protocol
Blood,
January 15, 2006;
107(2):
473 - 479.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Chiaretti, X. Li, R. Gentleman, A. Vitale, K. S. Wang, F. Mandelli, R. Foa, and J. Ritz
Gene Expression Profiles of B-lineage Adult Acute Lymphocytic Leukemia Reveal Genetic Patterns that Identify Lineage Derivation and Distinct Mechanisms of Transformation
Clin. Cancer Res.,
October 15, 2005;
11(20):
7209 - 7219.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y.-W. Lin, C. Slape, Z. Zhang, and P. D. Aplan
NUP98-HOXD13 transgenic mice develop a highly penetrant, severe myelodysplastic syndrome that progresses to acute leukemia
Blood,
July 1, 2005;
106(1):
287 - 295.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. M. Gurevich, P. D. Aplan, and R. K. Humphries
NUP98-Topoisomerase I acute myeloid leukemia-associated fusion gene has potent leukemogenic activities independent of an engineered catalytic site mutation
Blood,
August 15, 2004;
104(4):
1127 - 1136.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. Lahortiga, J. L. Vizmanos, X. Agirre, I. Vazquez, J. C. Cigudosa, M. J. Larrayoz, F. Sala, A. Gorosquieta, K. Perez-Equiza, M. J. Calasanz, et al.
NUP98 Is Fused to Adducin 3 in a Patient with T-Cell Acute Lymphoblastic Leukemia and Myeloid Markers, with a New Translocation t(10;11)(q25;p15)
Cancer Res.,
June 15, 2003;
63(12):
3079 - 3083.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Rosati, R. La Starza, A. Veronese, A. Aventin, C. Schwienbacher, T. Vallespi, M. Negrini, M. F. Martelli, and C. Mecucci
NUP98 is fused to the NSD3 gene in acute myeloid leukemia associated with t(8;11)(p11.2;p15)
Blood,
May 15, 2002;
99(10):
3857 - 3860.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Fujino, A. Suzuki, Y. Ito, K. Ohyashiki, Y. Hatano, I. Miura, and T. Nakamura
Single-translocation and double-chimeric transcripts: detection of NUP98-HOXA9 in myeloid leukemias with HOXA11 or HOXA13 breaks of the chromosomal translocation t(7;11)(p15;p15)
Blood,
February 15, 2002;
99(4):
1428 - 1433.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L.-w. Tan, T. Bianco, and A. Dobrovic
Variable promoter region CpG island methylation of the putative tumor suppressor gene Connexin 26 in breast cancer
Carcinogenesis,
February 1, 2002;
23(2):
231 - 236.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. J. Hussey and A. Dobrovic
Recurrent coiled-coil motifs in NUP98 fusion partners provide a clue to leukemogenesis
Blood,
February 1, 2002;
99(3):
1097 - 1097.
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Taketani, T. Taki, N. Shibuya, E. Ito, J. Kitazawa, K. Terui, and Y. Hayashi
The HOXD11 Gene Is Fused to the NUP98 Gene in Acute Myeloid Leukemia with t(2;11)(q31;p15)
Cancer Res.,
January 1, 2002;
62(1):
33 - 37.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
U. Klein, Y. Tu, G. A. Stolovitzky, M. Mattioli, G. Cattoretti, H. Husson, A. Freedman, G. Inghirami, L. Cro, L. Baldini, et al.
Gene Expression Profiling of B Cell Chronic Lymphocytic Leukemia Reveals a Homogeneous Phenotype Related to Memory B Cells
J. Exp. Med.,
December 3, 2001;
194(11):
1625 - 1638.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. J. Jaju, C. Fidler, O. A. Haas, A. J. Strickson, F. Watkins, K. Clark, N. C. P. Cross, J.-F. Cheng, P. D. Aplan, L. Kearney, et al.
A novel gene, NSD1, is fused to NUP98 in the t(5;11)(q35;p15.5) in de novo childhood acute myeloid leukemia
Blood,
August 15, 2001;
98(4):
1264 - 1267.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. G. Ahuja, J. Hong, P. D. Aplan, L. Tcheurekdjian, S. J. Forman, and M. L. Slovak
t(9;11)(p22;p15) in Acute Myeloid Leukemia Results in a Fusion between NUP98 and the Gene Encoding Transcriptional Coactivators p52 and p75-Lens Epithelium-derived Growth Factor (LEDGF)
Cancer Res.,
November 1, 2000;
60(22):
6227 - 6229.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
B. M. A. Fontoura, G. Blobel, and N. R. Yaseen
The Nucleoporin Nup98 Is a Site for GDP/GTP Exchange on Ran and Termination of Karyopherin beta 2-mediated Nuclear Import
J. Biol. Chem.,
September 29, 2000;
275(40):
31289 - 31296.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. J. Dupuy, K. Morgan, F. C. von Lintig, H. Shen, H. Acar, D. E. Hasz, N. A. Jenkins, N. G. Copeland, G. R. Boss, and D. A. Largaespada
Activation of the Rap1 Guanine Nucleotide Exchange Gene, CalDAG-GEF I, in BXH-2 Murine Myeloid Leukemia
J. Biol. Chem.,
April 6, 2001;
276(15):
11804 - 11811.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION