|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, Vol. 94 No. 6 (September 15), 1999:
pp. 2080-2089
By
From the Department of Pathology, University of Calgary, Calgary
Laboratory Services, Calgary, Alberta, Canada; School of Biological
Science, University of East Anglia, Norwich, Norfolk, UK; Department of
Epidemiology, Prevention and Screening, Alberta Cancer Board, Calgary,
Alberta, Canada; SWOG Lymphoma Lab, Tucson, AZ; Canadian Blood Services
and Department of Medicine, University of Alberta, Edmonton, Alberta,
Canada.
We showed previously that human malignant non-Hodgkin's lymphomas
(NHL) degrade extracellular matrix (ECM) components through the action
of metalloproteinases and that elevated expression of matrix
metalloproteinase-9 (MMP-9) and tissue inhibitor of metalloproteinase-1
(TIMP-1) correlated with a poor clinical outcome in patients with NHL.
In the present study we sought to investigate whether there is any
correlation between the expression of gelatinases (MMP-2 and MMP-9),
TIMP-1, and the expression of cytokines and growth factors such as
interleukin-1
HUMAN MALIGNANT non-Hodgkin's lymphomas
(NHL) represent a heterogeneous group of tumors, which vary in their
biological aggressiveness and clinical course.1 We have
shown previously that high-grade human NHL degrade extracellular matrix
(ECM) components in vitro and that metalloproteinases play an important
role in this phenomenon.2 We have also shown that matrix
metalloproteinase-9 (MMP-9, Gelatinase B) and tissue inhibitor of
metalloproteinase-1 (TIMP-1) are overexpressed in a subset of human
high-grade NHL and this overexpression is associated with a poor
clinical outcome for patients with these tumors.3-6
The MMPs are a family of zinc- and calcium-dependent proteolytic
enzymes capable of degrading most ECM components.7 Their action in tissues is inhibited by specific tissue inhibitors
(TIMPs).7 The majority of MMPs are secreted enzymes, but
membrane-type matrix metalloproteinases (MT-MMPs) have also been
described.8 Depending on their substrate specificity, MMPs
are broadly divided into collagenases, stromelysins, and
gelatinases.7 The latter group, consisting of Gelatinase A
(MMP-2) and Gelatinase B (MMP-9), degrade denatured collagens
(gelatin), native type IV and V collagens, and elastin.7
MMPs have been implicated in tumor invasion and metastasis,9,10 and their role in the dissemination of
hematologic malignancies, such as human NHL and acute myelogenous
leukemia (AML), has recently been appreciated.2-4,11-14
TIMP-1 has also been shown to be expressed by established neoplastic
B-cell lines and high-grade NHL.3-6, 11, 15 In addition to
and separately from its function as an MMP inhibitor, TIMP-1 has other
functions, eg, it promotes the growth of a variety of cells, prevents
apoptosis in B cells, and induces their
differentiation.16-18 However, the mechanisms that control
MMP and TIMP expression in human NHL are not known.
Under physiological and certain pathological conditions, regulation of
MMP and TIMP expression involves several factors including steroid
hormones, cellular oncogenes, growth factors, and
cytokines.19 Different MMPs and TIMPs are stimulated by
different factors and cell types respond differently to these various
stimuli. For example, in immunological response, cell-type specific
activation of various MMPs and TIMPs is mediated by many
proinflammatory cytokines.20 In fibroblasts and
macrophages, MMP-9 is upregulated by transforming growth factor
Because human NHL are composed of a variety of malignant and
non-neoplastic cells, all capable of MMP and TIMP production, the aim
of this study was to examine which growth factors and cytokines are
expressed in this complex environment and whether their overexpression
and the expression of gelatinases (MMP-2 and MMP-9) and TIMP-1 are
correlated. Finally, to establish a functional relationship, we
evaluated whether cytokines stimulate lymphoid cell lines of T- and
B-cell lineage to produce gelatinases and/or TIMP-1 and to degrade ECM
in vitro.
Specimen collection.
Twenty-one NHL tissue samples, as well as 1 hyperplastic tonsil, were
received in the Department of Pathology at the Foothills Hospital,
Calgary, Canada. Tissue in excess of that needed for diagnostic
purposes was snap-frozen in liquid nitrogen and subsequently stored at
Diagnostic procedures and case description.
The cases were examined histopathologically and classified
independently by two pathologists according to the Working Formulation (WF).1 Assessment was also done at a later date to classify the samples according to the REAL classification.41
Assessment of lineage was done by flow cytometry and
immunohistochemistry, as well as by Southern blot analysis for the
presence of immunoglobulin heavy-chain and T-cell receptor beta gene
rearrangements. All cases but one were of B-cell lineage. One
large-cell lymphoma was of T-cell origin and was classified as a
large-cell anaplastic NHL (case 10; Fig 1).
Two cases (cases 1 and 2; Fig 1) were small lymphocytic NHL (WF and
REAL), 3 (cases 3 to 5; Fig 1) follicular NHL (1 follicular,
predominantly small cleaved cell in WF, follicular center, grade I in
REAL; 1 follicular, mixed in WF, follicular center, grade II in REAL;
and 1 follicular, predominantly large cell in WF, follicular center,
grade III in REAL), 2 (cases 6 and 7; Fig 1) diffuse, small cleaved
cell NHL in WF (marginal-zone lymphomas in REAL), 2 (cases 8 and 9 in
Fig 1) diffuse-, mixed-, small- and large-cell NHL in WF (diffuse large
B cell in REAL), 1 (case 11 in Fig 1) small, noncleaved NHL in WF
(high-grade B-cell Burkitt's-like in REAL), and 21 (cases 12 to 32 in
Fig 1) large-cell immunoblastic in WF (diffuse, large B cell in REAL).
RNA extraction.
Total cellular RNA was extracted from tissues and cell lines by the
acid guanidinium thiocyanate-phenol-chloroform extraction method,
described by Chomczynski and Sacchi.42 RNA concentrations were determined using a Beckman DU65 spectrophotometer (Beckman Instruments, Fullerton, CA) (absorbance at 260 nm). The
extent of protein contamination was checked by examining 260 nm/280 nm ratios.
RT reactions.
mRNA was converted to complementary DNA (cDNA) by RT reactions done in
0.5 mL tubes. Approximately 2 µg of RNA was added to each reaction
tube. A master mixture was made with the following volume of reagents
used per sample: 4 µL GIBCO-BRL (Rockville, MD) 5×
First Strand Buffer [250 mmol/L Tris-HCl (pH 8.3 at room temperature),
375 mmol/L KCl, 15 mmol/L MgCl2], 2 µL N6 random oligonucleotides (100 pmol), 2 µL dNTP mixture (containing 10 mmol/L
each of dATP, dGTP, dCTP, and dTTP at neutral pH), 2 µL GIBCO-BRL
SuperScript RT RNAse H-RT, 0.2 µL of 1 mol/L dithiolthreitol (DTT)
and 0.3 µL of ribonuclease inhibitor (RNAguard, Pharmacia). 10.5 µL
of the master mixture was added to each tube and the final volume was
made up to 20 µL with GIBCO water (ddH2O, RNAse-free). Subsequently, the samples were incubated at 42°C for 90 minutes using a Perkin Elmer-Cetus (Norwalk, CT) thermocycler. At the end of
the incubation period, the samples were heated to 95°C for 5 minutes to inactivate the RT. Finally, the RT products were cooled to
4°C and stored at that temperature until use.
PCR.
Multiplex PCR were performed using a technique modeled after Wong et
al.43 Fifty µL reaction volumes were used in PCR tubes with screw-cap lids containing volume-reducing inserts. Each reaction mixture contained 1 to 3 µL of RT product serving as template DNA.
The volume of RT product put into the reaction was dictated by the
volume of sample necessary to equalize the intensities of
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) bands visualized during agarose gel electrophoresis. From 35.8 to 38.8 µL of GIBCO water was added to each tube depending on the volume of sample already
present. Additional ingredients added to the master mixture included
(per sample) 5 µL of 10× PCR reaction buffer (500 mmol/L KCl,
15 mmol/L MgCl2, and 100 mmol/L Tris-HCl), 1 µL dNTP
mixture (10 mmol/L), and 1 µL each of the 5' and 3'
starter primers (20 mmol/L). For all of the primer pairs except for
IL-10 a "cold start" was performed. All of the reagents were kept
on ice and Taq polymerase (0.2 µL per sample; Pharmacia, Piscataway,
NJ) was added to the cold master mixture. 8.2 µL of the master
mixture was then aliquoted into each reaction tube, and thermocycling was started using a Perkin Elmer-Cetus thermocycler. At 20 cycles, 1 µL of both 5' and 3' GAPDH primers were added. For all of
the primers except IL-10, each PCR cycle consisted of a heat
denaturation step at 94°C for 1 minute, a primer-annealing step at
55°C for 1 minute, and a strand elongation step at 72°C for 1 minute. The conditions for IL-10 PCR were based on those of Voorzanger
et al.44 After a precycle at 95°C, a "hot start"
was performed for primer specificity enhancement, meaning that Taq
polymerase was not added to the master mixture, but instead was added
during the first denaturation step (0.5 µL of Taq polymerase per
tube). The denaturing step for the IL-10 reaction was conducted at
95°C for 30 seconds, with the annealing step at 60°C and an
extension step at 72°C for 2 minutes. After the final cycle, the
reaction was held at 72°C for 2 minutes. More than one PCR reaction
had to be done for each set of primers so cDNA from one hyperplastic tonsil was run with each reaction as a control for differing reaction conditions. The conditions for the reactions were such that the plateau
was not reached.
Gel electrophoresis and quantification.
Aliquots of PCR products (approximately 10 µL) were electrophoresed
through 1.8% agarose gels containing 0.1 µg/µL ethidium bromide.
Loading was equalized to the internal control mRNA (GAPDH) to give
equivalent signals. Gels were illuminated with UV light and
photographed using Polaroid film (Cambridge, MA). The intensities of
the bands were quantified by computer densitometry. The photographs were scanned using a Hewlett-Packard (Palo Alto, CA)
ScanJet Ink Scanner and DeskScan II software, then analyzed using the
National Institutes of Health (NIH) (Bethesda, MD) Image
program. Each band corresponded to a peak, the pixel density of which
was proportional to the intensity of the ethidium bromide fluorescence
signals. The final activity was defined as the ratio of specific
primer/GAPDH intensity. For comparison of gels from different PCR
reactions, but using the same primer, a control tonsil was run with
each batch and gels were standardized to this sample. Because the mRNA levels in a sample would not change between PCR reactions but slightly
different signals could result depending on the PCR conditions, different batches were adjusted to give equal target/GAPDH ratios in
the control tonsil for all the batches. For instance, if PCR batch one
had a target/GAPDH ratio of 1.8 for the control tonsil and PCR batch
two had a ratio of 2.0 for the same sample, the ratios of all the
samples in batch one would be multiplied by 1.11 to give equal tonsil
activity in both batches.
Primers.
Sequences for human MMP-2, MMP-9, TIMP-1, IL-1 Cell-conditioned media and cytokines.
The human cell lines Burkitt's lymphoma (Raji), acute T-cell leukemia
(Jurkat), and peripheral blood B lymphoblasts (NC-37) were obtained
from the American Type Culture Collection (ATCC, Rockville, MD) and
grown in 90% RPMI 1640 media supplemented with 10% fetal calf serum
(GIBCO BRL Products, Burlington, Ontario, Canada). The cells were
harvested at the exponential growth phase, washed 3× in
serum-free Iscove's modified Dulbecco's medium (IMDM), aliquoted into
sterile Eppendorf tubes at a concentration of 2 × 106
cells/mL and incubated for 24 hours at 37°C and 5% CO2
in the absence (control) or presence of cytokines (IL-6, IL-10,
TNF- Zymographic analysis.
Gelatinolytic activities were assessed under nonreducing conditions
using modified sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Fifteen µL of supernatants mixed with 5 µL of loading buffer (0.16 mol/L Tris-HC1, 50% glycerol, 8% SDS,
and 0.08% bromophenol blue) were applied onto a 10% polyacrylamide gel copolymerized with 2 mg/mL gelatin (Sigma, Oakville, Ontario, Canada). Electrophoresis was performed using a mini-PROTEAN II electrophoresis system (Bio-Rad Laboratories, Mississauga, Ontario, Canada) under constant voltage (150 V) for 3 hours at 4°C. The gels
were washed 3× for 20 minutes each with 2.5% Triton X-100 (Sigma) to remove the SDS and to allow the electrophoresed enzymes to
renature, before being incubated in zymography buffer (5 mmol/L CaC12 and 50 mmol/L Tris-HC1, pH 7.5) for 18 hours at
37°C. The gels were then stained with 0.05% Coomassie brilliant
blue G-250 (Sigma) in 2.5:1:7 ethanol:acetic acid:water and destained
with 2:1:7 isopropanol:acetic acid:water. Prestained standard
high-range (47 to 201 kD) protein markers (Bio-Rad) were used to
determine the molecular weights of the gelatinases. Gels were laminated using BioDesign GelWrap (BioDesign Inc, Carmel, NY), photographed and
scanned using a ScanJet 3c scanner and DeskScan II software (Hewlett
Packard). The intensity of the bands in zymography was quantified using
Scion Image for Windows software (Scion Corp, Frederick, MD).
Reverse zymography.
TIMP activities in cell-conditioned media were analyzed using reverse
zymography as described by us previously.2 Briefly, the
samples were electrophoresed in 0.1% SDS, 12% polyacrylamide gels
containing 1 mg/mL gelatin. Conditioned medium from BHK cell line was
added as a source of MMP-2. After electrophoresis the gels were washed
overnight with 2.5% Triton X-100, incubated in 50 mmol/L Tris/HCl, pH
7.5, and 5 mmol/L CaCl2 for 16 to 18 hours at 37°C,
then stained and destained. Dark blue bands against a pale blue
background represent TIMP activity. Conditioned medium from BHK cells
was used as a positive control for TIMP activities.
Matrigel invasion assay.
In vitro cell migration was determined in the Matrigel-based assay as
described by us.45 Briefly, 13-mm polycarbonate filters of
8-µm pore size (Costar/Nucleopore, Toronto, Ontario, Canada) were
coated with 25 µg of Matrigel. The lower compartments of the modified
(blind well) Boyden chambers (Neuro Probe Inc, Gaithersburg, MD) were
filled with IMDM conditioned by bone marrow fibroblasts and
supplemented with 0.1% bovine serum albumin (BSA). Matrigel-coated filters were placed between the upper and lower compartments. Raji and
Jurkat cells were suspended in IMDM/0.1% BSA at a concentration of 1.5 × 106 cells/mL then loaded onto the upper chambers.
To assess whether cytokines modulate migration through Matrigel, cells
were also preincubated at 37°C with 100 ng/mL IL-6 or IL-10 for 3 to 18 hours at 37°C in 5% CO2. Cells that had migrated
through the Matrigel-coated filters were recovered from the lower
compartments after 3 hours and counted using a Neubauer hemocytometer
(VWR Scientific, Mississauga, Ontario, Canada). Percentage of cell
invasion was calculated from the ratio of the number of cells recovered
from the lower compartment to the total number of cells loaded in the
upper compartment. Each experiment was performed using at least five
chambers for each cell sample, and repeated at least
3×.
Statistical analysis.
Correlation between various measurements was established by Kendall's
rank correlation and Kruskal-Wallis rank sum tests. Significant
differences between means of paired samples were determined using
Student's t-test (Microsoft Excel, Redmond, WA) and a
P value < .05 was considered statistically significant.
Expression of cytokines, growth factors, MMPs, and TIMP-1 in NHL.
The results of RT-PCR analysis of the mRNA expressions of MMP-9, MMP-2,
TIMP-1, IL-6, IL-10, and TNF-
Correlation between expression of cytokines, growth factors, and of
MMPs and TIMP-1 in NHL.
The Kendall's rank correlation tau and P values are shown in
Table 2. The strongest positive correlation
was observed between RNA expression of MMP-9 and IL-6 (Fig
2), followed by correlation between TIMP-1
and IL-6. MMP-9 expression also correlated with IL-10, and a weak
correlation between MMP-9 and IL-1
IL-6 stimulates MMP-2 and MMP-9 secretion in lymphoma cell lines.
MMP-9 was found to be constitutively secreted into serum-free media by
Raji and NC-37 cells but not by the Jurkat cell line and none of these
cell lines secreted MMP-2 without a stimulus (Fig
3A). However, after incubation with IL-6,
both MMP-2 and MMP-9 activities were detected in supernatants of Raji,
Jurkat, and NC-37 cells by gelatin zymography. Densitometric analysis showed that MMP-9 secretion by Raji cells was stimulated by IL-6 (1.75-fold). IL-10 and TNF-
IL-6-stimulated Matrigel invasion by lymphoma cell lines is
inhibited by recombinant TIMP-1 and anti-MMP-9 and MMP-2 antibodies.
After a 16-hour incubation with IL-6, both Raji and Jurkat cells
showed increased in vitro invasion of Matrigel in comparison to the
control (Fig 3B). The percentage of Raji and Jurkat cells migrating
through the Matrigel increased significantly (P = .046 and P = .0002, respectively) after incubation with IL-6, but
not after incubation with IL-10.
IL-6 induces MMP-9 and MMP-2 transcripts in lymphoid cell lines and
has no effect on TIMP-1 production by these cells.
RT-PCR analysis of RNA extracted from Raji and Jurkat cell lines showed
induction of MMP-9 and MMP-2 mRNA in cells stimulated with IL-6 (Fig
4A). Neither MMP-9 nor MMP-2 transcripts
were detected in unstimulated Raji or Jurkat cell lines, whereas both
transcripts were observed after 6 hours of IL-6 stimulation. TIMP-1
transcripts were detected in Raji and Jurkat cells, but no induction of
TIMP-1 mRNA was observed with IL-6 (Fig 4A). Reverse zymography showed TIMP-1 activity in both Raji and Jurkat cells (Fig 4B). In addition to
TIMP-1 protein, TIMP-2 was also detected in Jurkat cells and TIMP-3 was
present in both cell lines. No induction of TIMP activity was observed
after treatment with IL-6 (Fig 4B).
There is growing evidence of the complexity of the mechanisms
regulating MMP and TIMP expression and their activity. This is due not
only to the fact that different cell types respond differently to
stimulation by cytokines and growth factors, but also due to formation
of TIMP/MMP complexes, which once formed, may assume new biological
activity.46 Because MMP-9 and TIMP-1 had previously been
shown by us to be overexpressed in a subset of human high-grade NHL,
which is associated with a poor clinical outcome,3-6 in
this study we decided to evaluate NHL for the coexpression of cytokines
and growth factors. Our primary goal was to look for possible
associations between overexpression of MMP-9 and TIMP-1 in relation to
the expression of cytokines and growth factors in lymphoma tissue
obtained from NHL patients. Assessment of the expression of IL-1 We acknowledge Maria Cobuhat and Adrian Dobrowsky (University of
Alberta) and Ms Anita Martin (University of Calgary) for technical
help; Lawrence S. Urbanski and Andrea L. Stabbler for assistance in
computer imaging, as well as Susan Watson for her secretarial assistance.
Submitted December 21, 1998; accepted May 19, 1999.
Supported by a grant from the Medical Research Council of Canada to
A.E.K. (MT-12706) and a grant from Canadian Blood Services R & D to
A.J-W. D.R.E. is supported by the Norfolk and Norwich Big C Appeal.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address correspondence to Anna E. Kossakowska, MD, Department of
Histopathology, Foothills Hospital, 1403 29th St NW,
Calgary, AB, Canada T2N 2T9; e-mail:
anna.kossakowska{at}crha-health.ab.ca.
1.
The Non-Hodgkin's Lymphoma Pathologic Classification Project:
National Cancer Institute sponsored study of classifications of non-Hodgkin's lymphomas. Summary and description of a Working Formulation for clinical usage.
Cancer
49:2112, 1982[Medline]
[Order article via Infotrieve].
2.
Kossakowska AE, Hinek A, Edwards DR, Lim MS, Zhang Ch-L, Breitman DR, Prusinkiewicz C, Stabbler AL, Urbanski LS, Urbanski SJ:
Proteolytic activity of human non-Hodgkin's lymphomas.
Am J Pathol
152:565, 1998[Abstract]
3.
Kossakowska AE, Urbanski SJ, Watson A, Hayden LJ, Edwards DR:
Patterns of expression of metalloproteinases and their inhibitors in human malignant lymphomas.
Oncol Res
5:19, 1993[Medline]
[Order article via Infotrieve]
4.
Kossakowska AE, Urbanski SJ, Hutchcroft SA, Edwards DR:
Relationship between the clinical aggressiveness of large cell immunoblastic lymphomas and expression of 92 kDa gelatinase (type IV Collagenase) and tissue inhibitor of metalloproteinases-1 (TIMP-1) RNAs.
Oncol Res
4:233, 1992[Medline]
[Order article via Infotrieve]
5.
Kossakowska AE, Urbanski SJ, Edwards DR:
Tissue inhibitor of metalloproteinases-1 (TIMP-1) RNA is expressed at elevated levels in malignant non-Hodgkin's lymphomas.
Blood
77:2475, 1991
6.
Kossakowska AE, Zhang MCh-L, Brasher P, Urbanski SJ, Edwards DR:
TIMP-1 is a predictor of survival in human non-Hodgkin's lymphomas.
Mod Pathol
12:140A, 1999
7.
Murphy G:
Matrix metalloproteinases and their inhibitors [Review].
Acta Orthop Scand Suppl
266:55, 1995[Medline]
[Order article via Infotrieve]
8.
d'Ortho MP, Will H, Atkinson S, Butler G, Messent A, Gavrilovic J, Smith B, Timpl R, Zardi L, Murphy G:
Membrane-type matrix metalloproteinases 1 and 2 exhibit broad-spectrum proteolytic capacities comparable to many matrix metalloproteinases.
Eur J Biochem
250:751, 1997[Medline]
[Order article via Infotrieve]
9.
Kossakowska AE, Huchcroft SA, Urbanski SJ, Edwards DR:
Comparative analysis of the expression patterns of metalloproteinases and their inhibitors in breast neoplasia, sporadic colorectal neoplasia, pulmonary carcinomas and malignant non-Hodgkin's lymphomas in humans.
Br J Cancer
73:1401, 1996[Medline]
[Order article via Infotrieve]
10.
Stetler-Stevenson WG, Hewitt R, Corcoran M:
Matrix metalloproteinases and tumor invasion: From correlation and causality to the clinic (Review).
Semin Cancer Biol
7:147, 1996[Medline]
[Order article via Infotrieve]
11.
Stetler-Stevenson M, Mansoor A, Lim M, Fukushima P, Kehrl J, Marti G, Ptaszynski K, Wang J, Stetler-Stevenson WG:
Expression of matrix metalloproteinases and tissue inhibitors of metalloproteinases in reactive and neoplastic lymphoid cells.
Blood
89:1708, 1997
12.
Matsuzaki A, Janowska-Wieczorek A:
Unstimulated human acute myelogenous leukemia blasts secrete matrix metalloproteinases.
J Cancer Res Clin Oncol
123:100, 1997[Medline]
[Order article via Infotrieve]
13.
Sawicki G, Matsuzaki A, Janowska-Wieczorek A:
Expression of the active form of MMP-2 on the surface of leukemic cells accounts for their in vitro invasion.
J Cancer Res Clin Oncol
124:245, 1998[Medline]
[Order article via Infotrieve]
14.
Janowska-Wieczorek A, Marquez LA, Matsuzaki A, Hashmi HR, Larratt LM, Boshkov LM, Turner AR, Zhang MC, Edwards DR, Kossakowska AE:
Expression of matrix metalloproteinases (MMP-2 and -9) and tissue inhibitors of metalloproteinases (TIMP-1 and -2) in acute myelogenous leukaemia blasts: Comparison with normal bone marrow cells.
Brit J Haematol
105:402, 1999[Medline]
[Order article via Infotrieve]
15.
Mansoor A, Birkedal-Hansen B, Lim MS, Guedez L, Stetler-Stevenson WG, Stetler-Stevenson M:
TIMP-1 expression correlates with histologic grade in B-cell lymphomas.
Mod Pathol
10:130A, 1997
16.
Hayakawa T, Yamashita K, Tanzawa E, Uchijima E, Iwata K:
Growth-promoting activity of tissue inhibitor of metalloproteinase-1 (TIMP-1) for a wide range of cells. A possible new growth factor in serum.
FEBS Lett
298:29, 1992[Medline]
[Order article via Infotrieve]
17.
Guedez L, Stetler-Stevenson WG, Wolff L, Wang J, Fukushima P, Mansoor A, Stetler-Stevenson M:
In vitro suppression of programmed cell death of B cells by tissue inhibitor of metalloproteinases-1.
J Clin Invest
102:2002, 1998[Medline]
[Order article via Infotrieve]
18.
Guedez L, Courtemanch L, Stetler-Stevenson M:
Tissue inhibitor of metalloproteinase (TIMP-1) induces differentiation and an antiapoptotic phenotype in germinal center B cells.
Blood
92:1342, 1998
19.
Murphy G, Reynolds JJ:
Extracellular matrix degradation, in
Royce PM,
Steinmann B
(eds):
Connective Tissue and its Heritable Disorders. New York, NY, Wiley-Liss, Inc, 1993, p 287.
20.
Goetzl EJ, Banda MJ, Leppert D:
Matrix metalloproteinases in immunity [Review].
J Immunol
156:1, 1996[Abstract]
21.
Unemori EN, Hibbs MS, Amento EP:
Constitutive expression of a 92-kDa gelantinase (type IV) collagenase by rheumatoid synovial fibroblasts and its induction in normal human fibroblasts by inflammatory cytokines.
J Clin Invest
88:1656, 1991
22.
Sato T, Ito A, Ogata Y, Nagase H, Mori Y:
Tumor necrosis factor alpha (TNF alpha) induces pro-matrix metalloproteinase-9 production in human uterine cervical fibroblasts but interleukin 1 alpha antagonizes the inductive effect of TNF alpha.
FEBS Lett
392:175, 1996[Medline]
[Order article via Infotrieve]
23.
Kurogi T, Nabeshima K, Kataoka Y, Okada Y, Koono OM:
Stimulation of gelatinase B and tissue inhibitors of metalloproteinase (TIMP) production in co-culture of human osteosarcoma cells and human fibroblasts: gelatinase B production was stimulated via upregulation of fibroblast growth factor (FGF) receptor.
Int J Cancer
66:82, 1996[Medline]
[Order article via Infotrieve]
24.
Saren P, Welgus HG, Kovanen PT:
TNF-alpha and IL-1 beta selectively induce expression of 92 kDa gelatinase by human macrophages.
J Immunol
157:4159, 1996[Abstract]
25.
Guedez L, Lim MS, Stetler-Stevenson WG:
The role of metalloproteinases and their inhibitors in hematological disorders (Review).
Crit Rev Oncog
7:205, 1996[Medline]
[Order article via Infotrieve]
26.
Johnatty RN, Taub DD, Reeder SP, Turcovski-Corrales SM, Cottam DW, Stephenson TJ, Rees RC:
Cytokine and chemokine regulation of proMMP-9 and TIMP-1 production by human peripheral blood lymphocytes.
J Immunol
158:2327, 1997[Abstract]
27.
Xia M, Leppert D, Hauser SL, Sreedharan SP, Nelson PJ, Krensky AM, Goetzl EJ:
Stimulus specificity of matrix metalloproteinase dependence of human T-cell migration through a model basement membrane.
J Immunol
156:160, 1996[Abstract]
28.
Stüve O, Dooley NP, Uhm JH, Antel JP, Francis GS, Williams G, Yong VW:
Interferon beta-1b decreases the migration of T lymphocytes in vitro: Effects on matrix metalloproteinase-9.
Ann Neurol
40:853, 1996[Medline]
[Order article via Infotrieve]
29.
Di Girolamo N, Tedla N, Lloyd A, Wakefield D:
Expression of matrix metalloproteinases by human plasma cells and B lymphocytes.
Eur J Immunol
28:1773, 1998[Medline]
[Order article via Infotrieve] |
TOP
ABSTRACT
INTRODUCTION
(IL-1
(TNF-
(TNF-
, and
IL-4 downregulate MMP-9 production in monocytes and macrophages.
70°C. An assessment of the sample was done by
histopathological examination of sections adjacent to the frozen tissue
to determine whether the sample was representative of the rest of the
specimen. Additionally, 1 NHL tissue was obtained from the Lethbridge
Cancer Centre, Lethbridge, Canada and 10 NHL samples were received from The South-Western Oncology Group (SWOG) in Tucson, AZ. The samples were
shipped on dry ice by courier to the Foothills Hospital, Pathology
Department (Calgary, Alberta, Canada) and were received frozen. The
lymphoma sample preparation in these other two centers was done
similarly to that in the Foothills Hospital. The investigator performing reverse transcriptase-polymerase chain reaction (RT-PCR) was
blinded with respect to histopathological classification until after
the experiments were completed.
3'], cycle no.): MMP-2, GGCCCTGTCACTCCTGAGAT GGCATCCAGGTTATCGGGGA, 25; MMP-9,
CAACATCACCTATTGGATCCCGGGTGTAGAGTCTCTCGCT, 25; TIMP-1,
GCGGATCCAGCGCCCAGAGAGACACCTTAAGCTTCCACTCCGGGCAGGATT, 25; IL-1
