|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 6 (September 15), 1999:
pp. 2080-2089
Interleukin-6 Regulation of Matrix Metalloproteinase (MMP-2 and
MMP-9) and Tissue Inhibitor of Metalloproteinase (TIMP-1)
Expression in Malignant Non-Hodgkin's Lymphomas
By
Anna E. Kossakowska,
Dylan R. Edwards,
Christopher Prusinkiewicz,
Melissa C. Zhang,
Dianlin Guo,
Stefan J. Urbanski,
Thomas Grogan,
Leah A. Marquez, and
Anna Janowska-Wieczorek
From the Department of Pathology, University of Calgary, Calgary
Laboratory Services, Calgary, Alberta, Canada; School of Biological
Science, University of East Anglia, Norwich, Norfolk, UK; Department of
Epidemiology, Prevention and Screening, Alberta Cancer Board, Calgary,
Alberta, Canada; SWOG Lymphoma Lab, Tucson, AZ; Canadian Blood Services
and Department of Medicine, University of Alberta, Edmonton, Alberta,
Canada.
 |
ABSTRACT |
We showed previously that human malignant non-Hodgkin's lymphomas
(NHL) degrade extracellular matrix (ECM) components through the action
of metalloproteinases and that elevated expression of matrix
metalloproteinase-9 (MMP-9) and tissue inhibitor of metalloproteinase-1
(TIMP-1) correlated with a poor clinical outcome in patients with NHL.
In the present study we sought to investigate whether there is any
correlation between the expression of gelatinases (MMP-2 and MMP-9),
TIMP-1, and the expression of cytokines and growth factors such as
interleukin-1 (IL-1 ), IL-6, IL-10, tumor necrosis factor
(TNF- ), transforming growth factor (TGF ), and basic
fibroblast growth factor (bFGF) in human NHL. In lymphoma tissues
obtained from 32 patients, elevated expression of IL-6 correlated
significantly with elevated messenger RNA (mRNA) levels of MMP-9,
MMP-2, and TIMP-1. Moreover, in human lymphoid cell lines of B- and
T-cell origin (Raji, Jurkat, and NC-37), IL-6 stimulated production of
MMP-9 and MMP-2 but not TIMP-1. In the Matrigel invasion assay IL-6
significantly upregulated transmigration of Raji and Jurkat
cells, which in turn was inhibited by recombinant human TIMP-1
and anti-MMP-9 and MMP-2 antibodies. We postulate that IL-6 may
play a role in the clinical aggressiveness of human NHL by
stimulating MMP production.
© 1999 by The American Society of Hematology.
 |
INTRODUCTION |
HUMAN MALIGNANT non-Hodgkin's lymphomas
(NHL) represent a heterogeneous group of tumors, which vary in their
biological aggressiveness and clinical course.1 We have
shown previously that high-grade human NHL degrade extracellular matrix
(ECM) components in vitro and that metalloproteinases play an important
role in this phenomenon.2 We have also shown that matrix
metalloproteinase-9 (MMP-9, Gelatinase B) and tissue inhibitor of
metalloproteinase-1 (TIMP-1) are overexpressed in a subset of human
high-grade NHL and this overexpression is associated with a poor
clinical outcome for patients with these tumors.3-6
The MMPs are a family of zinc- and calcium-dependent proteolytic
enzymes capable of degrading most ECM components.7 Their action in tissues is inhibited by specific tissue inhibitors
(TIMPs).7 The majority of MMPs are secreted enzymes, but
membrane-type matrix metalloproteinases (MT-MMPs) have also been
described.8 Depending on their substrate specificity, MMPs
are broadly divided into collagenases, stromelysins, and
gelatinases.7 The latter group, consisting of Gelatinase A
(MMP-2) and Gelatinase B (MMP-9), degrade denatured collagens
(gelatin), native type IV and V collagens, and elastin.7
MMPs have been implicated in tumor invasion and metastasis,9,10 and their role in the dissemination of
hematologic malignancies, such as human NHL and acute myelogenous
leukemia (AML), has recently been appreciated.2-4,11-14
TIMP-1 has also been shown to be expressed by established neoplastic
B-cell lines and high-grade NHL.3-6, 11, 15 In addition to
and separately from its function as an MMP inhibitor, TIMP-1 has other
functions, eg, it promotes the growth of a variety of cells, prevents
apoptosis in B cells, and induces their
differentiation.16-18 However, the mechanisms that control
MMP and TIMP expression in human NHL are not known.
Under physiological and certain pathological conditions, regulation of
MMP and TIMP expression involves several factors including steroid
hormones, cellular oncogenes, growth factors, and
cytokines.19 Different MMPs and TIMPs are stimulated by
different factors and cell types respond differently to these various
stimuli. For example, in immunological response, cell-type specific
activation of various MMPs and TIMPs is mediated by many
proinflammatory cytokines.20 In fibroblasts and
macrophages, MMP-9 is upregulated by transforming growth factor
1 (TGF 1), tumor necrosis factor (TNF- ), basic fibroblast growth factor (bFGF), interleukin-1
(IL-1 ), and lymphotoxin (LT).20-25 In T-lymphocytes,
MMP-9 production is stimulated by IL-1, TNF- , IL-2, and
IL-4.26,27 It has also been reported that IL-2 and IL-4
stimulation of T-lymphocytes induces migration of these cells through
Matrigel (Collaborative Biomedical Products, Bedford, MA), a model
basement membrane.27 Interferon -1b (IFN -1b) inhibits
MMP-9 production and migration through Matrigel by
T-lymphocytes.28 In a plasma cell line TNF- and IL-1
(used in combination, but not alone) stimulated MMP-9 activity and had
no effect on MMP-2.29 IL-6 had no effect on MMP-9 and MMP-2
production by myeloma cells, but IL-1 , TNF- and Oncostatin M
stimulated stromal cells in this tumoral environment to produce
MMP-1.30 Expression of MMP-9 in Epstein-Barr virus
(EBV)-transformed and tonsilar B lymphocytes is also induced by a
combination of TNF- and IL-1 .29 IL-10, IFN , and
IL-4 downregulate MMP-9 production in monocytes and macrophages.31,32 In prostatic carcinoma cell lines, IL-10 and IL-4 (but not IL-6) downregulated MMP-2, but had no effect on MMP-9
production,33 whereas TGF 1 stimulated
production of MMP-9 and MMP-2 in cervical carcinoma
cells.34 TIMP-1 production in fibroblasts, hepatocytes, and
prostatic tumor cell lines was shown to be stimulated by IL-6, IL-1 ,
and IL-10.35-38 However, divergent regulation of MMP and
TIMP expression is observed in different cell
types.26,39,40 In T-lymphocytes, proinflammatory cytokines
and chemokines differentially regulated proMMP-9 secretion but had no
effect on TIMP-1 production.26 In mononuclear phagocytes, IL-10 inhibited secretion of MMP-9 and stimulated that of
TIMP-1.40 In plasma cells, TIMP-1 production was induced by
a combined treatment with TNF- and IL-1 .29
Because human NHL are composed of a variety of malignant and
non-neoplastic cells, all capable of MMP and TIMP production, the aim
of this study was to examine which growth factors and cytokines are
expressed in this complex environment and whether their overexpression
and the expression of gelatinases (MMP-2 and MMP-9) and TIMP-1 are
correlated. Finally, to establish a functional relationship, we
evaluated whether cytokines stimulate lymphoid cell lines of T- and
B-cell lineage to produce gelatinases and/or TIMP-1 and to degrade ECM
in vitro.
 |
MATERIALS AND METHODS |
Specimen collection.
Twenty-one NHL tissue samples, as well as 1 hyperplastic tonsil, were
received in the Department of Pathology at the Foothills Hospital,
Calgary, Canada. Tissue in excess of that needed for diagnostic
purposes was snap-frozen in liquid nitrogen and subsequently stored at
70°C. An assessment of the sample was done by
histopathological examination of sections adjacent to the frozen tissue
to determine whether the sample was representative of the rest of the
specimen. Additionally, 1 NHL tissue was obtained from the Lethbridge
Cancer Centre, Lethbridge, Canada and 10 NHL samples were received from The South-Western Oncology Group (SWOG) in Tucson, AZ. The samples were
shipped on dry ice by courier to the Foothills Hospital, Pathology
Department (Calgary, Alberta, Canada) and were received frozen. The
lymphoma sample preparation in these other two centers was done
similarly to that in the Foothills Hospital. The investigator performing reverse transcriptase-polymerase chain reaction (RT-PCR) was
blinded with respect to histopathological classification until after
the experiments were completed.
Diagnostic procedures and case description.
The cases were examined histopathologically and classified
independently by two pathologists according to the Working Formulation (WF).1 Assessment was also done at a later date to classify the samples according to the REAL classification.41
Assessment of lineage was done by flow cytometry and
immunohistochemistry, as well as by Southern blot analysis for the
presence of immunoglobulin heavy-chain and T-cell receptor beta gene
rearrangements. All cases but one were of B-cell lineage. One
large-cell lymphoma was of T-cell origin and was classified as a
large-cell anaplastic NHL (case 10; Fig 1).
Two cases (cases 1 and 2; Fig 1) were small lymphocytic NHL (WF and
REAL), 3 (cases 3 to 5; Fig 1) follicular NHL (1 follicular,
predominantly small cleaved cell in WF, follicular center, grade I in
REAL; 1 follicular, mixed in WF, follicular center, grade II in REAL;
and 1 follicular, predominantly large cell in WF, follicular center,
grade III in REAL), 2 (cases 6 and 7; Fig 1) diffuse, small cleaved
cell NHL in WF (marginal-zone lymphomas in REAL), 2 (cases 8 and 9 in
Fig 1) diffuse-, mixed-, small- and large-cell NHL in WF (diffuse large
B cell in REAL), 1 (case 11 in Fig 1) small, noncleaved NHL in WF
(high-grade B-cell Burkitt's-like in REAL), and 21 (cases 12 to 32 in
Fig 1) large-cell immunoblastic in WF (diffuse, large B cell in REAL).

View larger version (70K):
[in this window]
[in a new window]
| Fig 1.
RT-PCR analysis of MMP-9, MMP-2, TIMP-1, IL-6, IL-10, and
TNF- mRNA expression in NHL and tonsil (T). RNA extraction and
RT-PCR analysis were performed as described in Materials and Methods.
NHL are described (cases 1 to 32) in Materials and Methods. Each
analysis was internally controlled by inclusion of GAPDH primers for
the last 20 cycles of PCR.
|
|
RNA extraction.
Total cellular RNA was extracted from tissues and cell lines by the
acid guanidinium thiocyanate-phenol-chloroform extraction method,
described by Chomczynski and Sacchi.42 RNA concentrations were determined using a Beckman DU65 spectrophotometer (Beckman Instruments, Fullerton, CA) (absorbance at 260 nm). The
extent of protein contamination was checked by examining 260 nm/280 nm ratios.
RT reactions.
mRNA was converted to complementary DNA (cDNA) by RT reactions done in
0.5 mL tubes. Approximately 2 µg of RNA was added to each reaction
tube. A master mixture was made with the following volume of reagents
used per sample: 4 µL GIBCO-BRL (Rockville, MD) 5×
First Strand Buffer [250 mmol/L Tris-HCl (pH 8.3 at room temperature),
375 mmol/L KCl, 15 mmol/L MgCl2], 2 µL N6 random oligonucleotides (100 pmol), 2 µL dNTP mixture (containing 10 mmol/L
each of dATP, dGTP, dCTP, and dTTP at neutral pH), 2 µL GIBCO-BRL
SuperScript RT RNAse H-RT, 0.2 µL of 1 mol/L dithiolthreitol (DTT)
and 0.3 µL of ribonuclease inhibitor (RNAguard, Pharmacia). 10.5 µL
of the master mixture was added to each tube and the final volume was
made up to 20 µL with GIBCO water (ddH2O, RNAse-free). Subsequently, the samples were incubated at 42°C for 90 minutes using a Perkin Elmer-Cetus (Norwalk, CT) thermocycler. At the end of
the incubation period, the samples were heated to 95°C for 5 minutes to inactivate the RT. Finally, the RT products were cooled to
4°C and stored at that temperature until use.
PCR.
Multiplex PCR were performed using a technique modeled after Wong et
al.43 Fifty µL reaction volumes were used in PCR tubes with screw-cap lids containing volume-reducing inserts. Each reaction mixture contained 1 to 3 µL of RT product serving as template DNA.
The volume of RT product put into the reaction was dictated by the
volume of sample necessary to equalize the intensities of
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) bands visualized during agarose gel electrophoresis. From 35.8 to 38.8 µL of GIBCO water was added to each tube depending on the volume of sample already
present. Additional ingredients added to the master mixture included
(per sample) 5 µL of 10× PCR reaction buffer (500 mmol/L KCl,
15 mmol/L MgCl2, and 100 mmol/L Tris-HCl), 1 µL dNTP
mixture (10 mmol/L), and 1 µL each of the 5' and 3'
starter primers (20 mmol/L). For all of the primer pairs except for
IL-10 a "cold start" was performed. All of the reagents were kept
on ice and Taq polymerase (0.2 µL per sample; Pharmacia, Piscataway,
NJ) was added to the cold master mixture. 8.2 µL of the master
mixture was then aliquoted into each reaction tube, and thermocycling was started using a Perkin Elmer-Cetus thermocycler. At 20 cycles, 1 µL of both 5' and 3' GAPDH primers were added. For all of
the primers except IL-10, each PCR cycle consisted of a heat
denaturation step at 94°C for 1 minute, a primer-annealing step at
55°C for 1 minute, and a strand elongation step at 72°C for 1 minute. The conditions for IL-10 PCR were based on those of Voorzanger
et al.44 After a precycle at 95°C, a "hot start"
was performed for primer specificity enhancement, meaning that Taq
polymerase was not added to the master mixture, but instead was added
during the first denaturation step (0.5 µL of Taq polymerase per
tube). The denaturing step for the IL-10 reaction was conducted at
95°C for 30 seconds, with the annealing step at 60°C and an
extension step at 72°C for 2 minutes. After the final cycle, the
reaction was held at 72°C for 2 minutes. More than one PCR reaction
had to be done for each set of primers so cDNA from one hyperplastic tonsil was run with each reaction as a control for differing reaction conditions. The conditions for the reactions were such that the plateau
was not reached.
Gel electrophoresis and quantification.
Aliquots of PCR products (approximately 10 µL) were electrophoresed
through 1.8% agarose gels containing 0.1 µg/µL ethidium bromide.
Loading was equalized to the internal control mRNA (GAPDH) to give
equivalent signals. Gels were illuminated with UV light and
photographed using Polaroid film (Cambridge, MA). The intensities of
the bands were quantified by computer densitometry. The photographs were scanned using a Hewlett-Packard (Palo Alto, CA)
ScanJet Ink Scanner and DeskScan II software, then analyzed using the
National Institutes of Health (NIH) (Bethesda, MD) Image
program. Each band corresponded to a peak, the pixel density of which
was proportional to the intensity of the ethidium bromide fluorescence
signals. The final activity was defined as the ratio of specific
primer/GAPDH intensity. For comparison of gels from different PCR
reactions, but using the same primer, a control tonsil was run with
each batch and gels were standardized to this sample. Because the mRNA levels in a sample would not change between PCR reactions but slightly
different signals could result depending on the PCR conditions, different batches were adjusted to give equal target/GAPDH ratios in
the control tonsil for all the batches. For instance, if PCR batch one
had a target/GAPDH ratio of 1.8 for the control tonsil and PCR batch
two had a ratio of 2.0 for the same sample, the ratios of all the
samples in batch one would be multiplied by 1.11 to give equal tonsil
activity in both batches.
Primers.
Sequences for human MMP-2, MMP-9, TIMP-1, IL-1 , IL-6, bFGF, TNF- ,
and TGF- were obtained from GenBank (National Center for
Biotechnology Information, Bethesda, MD) and used to design primer
pairs. The primers were separated by an intron and were chosen to have
a 40% to 60% GC content. The sequence for the GAPDH primer pair was
found in Wong et al43 and that for IL-10 was taken from
Voorzanger et al.44 The optimum number of cycles for each
primer was determined to keep signal amplification in the linear range.
The primer sequences and the number of cycles used were as follows
(name, sequence [5' 3'], cycle no.): MMP-2, GGCCCTGTCACTCCTGAGAT GGCATCCAGGTTATCGGGGA, 25; MMP-9,
CAACATCACCTATTGGATCCCGGGTGTAGAGTCTCTCGCT, 25; TIMP-1,
GCGGATCCAGCGCCCAGAGAGACACCTTAAGCTTCCACTCCGGGCAGGATT, 25; IL-1
TTCCCATTAGACAGCTGCACTGTTTGGGATCCACACTCTC,
32; IL-6, AAAATCTGCTCTGGTCTTCTGGGGTTTGCCGAGTAGACCTCA,
30; IL-10,
AATGGCTCTAGAATGCACAGCTCAGCACTGAATGGCGAATTCTTTCTCAAGGGGCTGGGT, 30; bFGF, TCTTCCAATGTCTGCTAAGAGCTGTCCAGCAGTTTACACAGGACTGTT, 30; TNF- , TCGAGTGACAAGCCCGTAGCAGAGCAATGACTCCAAAGTAGAC, 28; TGF- , CCTGGACACCAACTATTGCTTCAGGACCTTGCTGTACTGCGTGTCCA 25; GAPDH,
CGGAGTCAACGGATTTGGTCGTATAGCCTTCTCCATGGTGGTGAAGAC, 20.
Cell-conditioned media and cytokines.
The human cell lines Burkitt's lymphoma (Raji), acute T-cell leukemia
(Jurkat), and peripheral blood B lymphoblasts (NC-37) were obtained
from the American Type Culture Collection (ATCC, Rockville, MD) and
grown in 90% RPMI 1640 media supplemented with 10% fetal calf serum
(GIBCO BRL Products, Burlington, Ontario, Canada). The cells were
harvested at the exponential growth phase, washed 3× in
serum-free Iscove's modified Dulbecco's medium (IMDM), aliquoted into
sterile Eppendorf tubes at a concentration of 2 × 106
cells/mL and incubated for 24 hours at 37°C and 5% CO2
in the absence (control) or presence of cytokines (IL-6, IL-10,
TNF- ). Human recombinant IL-6 (Genetics Institute, Cambridge, MA),
IL-10, and TNF- (R & D Systems Inc, Minneapolis, MN) were added at
final concentrations of 100 ng/mL, 100 ng/mL, and 10 ng/mL,
respectively. The cell-conditioned media (supernatants) were collected,
concentrated 10-fold using the Centricon concentrator (Amicon, Beverly,
MA) and analyzed by zymography and reverse zymography. Serum-free media
conditioned by KG-1 and baby hamster kidney (BHK) cell lines, which
secrete MMP-2 and MMP-9,2,12 were used as a positive control for zymographic analysis.
Zymographic analysis.
Gelatinolytic activities were assessed under nonreducing conditions
using modified sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Fifteen µL of supernatants mixed with 5 µL of loading buffer (0.16 mol/L Tris-HC1, 50% glycerol, 8% SDS,
and 0.08% bromophenol blue) were applied onto a 10% polyacrylamide gel copolymerized with 2 mg/mL gelatin (Sigma, Oakville, Ontario, Canada). Electrophoresis was performed using a mini-PROTEAN II electrophoresis system (Bio-Rad Laboratories, Mississauga, Ontario, Canada) under constant voltage (150 V) for 3 hours at 4°C. The gels
were washed 3× for 20 minutes each with 2.5% Triton X-100 (Sigma) to remove the SDS and to allow the electrophoresed enzymes to
renature, before being incubated in zymography buffer (5 mmol/L CaC12 and 50 mmol/L Tris-HC1, pH 7.5) for 18 hours at
37°C. The gels were then stained with 0.05% Coomassie brilliant
blue G-250 (Sigma) in 2.5:1:7 ethanol:acetic acid:water and destained
with 2:1:7 isopropanol:acetic acid:water. Prestained standard
high-range (47 to 201 kD) protein markers (Bio-Rad) were used to
determine the molecular weights of the gelatinases. Gels were laminated using BioDesign GelWrap (BioDesign Inc, Carmel, NY), photographed and
scanned using a ScanJet 3c scanner and DeskScan II software (Hewlett
Packard). The intensity of the bands in zymography was quantified using
Scion Image for Windows software (Scion Corp, Frederick, MD).
Reverse zymography.
TIMP activities in cell-conditioned media were analyzed using reverse
zymography as described by us previously.2 Briefly, the
samples were electrophoresed in 0.1% SDS, 12% polyacrylamide gels
containing 1 mg/mL gelatin. Conditioned medium from BHK cell line was
added as a source of MMP-2. After electrophoresis the gels were washed
overnight with 2.5% Triton X-100, incubated in 50 mmol/L Tris/HCl, pH
7.5, and 5 mmol/L CaCl2 for 16 to 18 hours at 37°C,
then stained and destained. Dark blue bands against a pale blue
background represent TIMP activity. Conditioned medium from BHK cells
was used as a positive control for TIMP activities.
Matrigel invasion assay.
In vitro cell migration was determined in the Matrigel-based assay as
described by us.45 Briefly, 13-mm polycarbonate filters of
8-µm pore size (Costar/Nucleopore, Toronto, Ontario, Canada) were
coated with 25 µg of Matrigel. The lower compartments of the modified
(blind well) Boyden chambers (Neuro Probe Inc, Gaithersburg, MD) were
filled with IMDM conditioned by bone marrow fibroblasts and
supplemented with 0.1% bovine serum albumin (BSA). Matrigel-coated filters were placed between the upper and lower compartments. Raji and
Jurkat cells were suspended in IMDM/0.1% BSA at a concentration of 1.5 × 106 cells/mL then loaded onto the upper chambers.
To assess whether cytokines modulate migration through Matrigel, cells
were also preincubated at 37°C with 100 ng/mL IL-6 or IL-10 for 3 to 18 hours at 37°C in 5% CO2. Cells that had migrated
through the Matrigel-coated filters were recovered from the lower
compartments after 3 hours and counted using a Neubauer hemocytometer
(VWR Scientific, Mississauga, Ontario, Canada). Percentage of cell
invasion was calculated from the ratio of the number of cells recovered
from the lower compartment to the total number of cells loaded in the
upper compartment. Each experiment was performed using at least five
chambers for each cell sample, and repeated at least
3×.
To further examine whether MMP-2 and/or MMP-9 are implicated in
IL-6-stimulated invasion, the cells were incubated overnight with IL-6
and then treated for 1 hour with the following MMP inhibitors: 10 µg/mL anti-MMP-2 monoclonal antibody, 10 µg/mL anti-MMP-9 antibody (both from Oncogene Research Products, Cambridge, MA) and 10 µg/mL recombinant human TIMP-1 (gift from Dr A. Docherty, Celltech
Pharmaceuticals, Slough, England) before loading onto Boyden chambers.
Statistical analysis.
Correlation between various measurements was established by Kendall's
rank correlation and Kruskal-Wallis rank sum tests. Significant
differences between means of paired samples were determined using
Student's t-test (Microsoft Excel, Redmond, WA) and a
P value < .05 was considered statistically significant.
 |
RESULTS |
Expression of cytokines, growth factors, MMPs, and TIMP-1 in NHL.
The results of RT-PCR analysis of the mRNA expressions of MMP-9, MMP-2,
TIMP-1, IL-6, IL-10, and TNF- in the group of 32 NHLs are shown in
Fig 1. In some cases two distinct IL-10 bands were detected by RT-PCR
analysis. We have established that both bands represent IL-10
transcripts (data not shown). The significance of this finding is
uncertain and will be investigated further. Statistical analysis was
based on the densitometric analysis of both bands. The data for each
MMP, TIMP-1, cytokines, and growth factors are shown in Table
1. High-grade NHL showed generally higher MMP-9,
IL-6, and IL-10 levels than low-grade tumors. Considerable variation
was, however, noted between the individual cases.
Correlation between expression of cytokines, growth factors, and of
MMPs and TIMP-1 in NHL.
The Kendall's rank correlation tau and P values are shown in
Table 2. The strongest positive correlation
was observed between RNA expression of MMP-9 and IL-6 (Fig
2), followed by correlation between TIMP-1
and IL-6. MMP-9 expression also correlated with IL-10, and a weak
correlation between MMP-9 and IL-1 was observed. MMP-2 RNA
expression also correlated with IL-6 RNA levels, as well as with TGF
and IL-1 . MMP-9, IL-6, and IL-10 expression correlated with NHL
grade and was higher in the high-grade tumors. Expression of IL-6
correlated with IL-10 expression (correlation tau = .292, P =
.019) and expression of both IL-6 and IL-10 correlated more
significantly with MMP-9 expression than expression of each of these
cytokines alone (tau=0.443, P = .0004).

View larger version (9K):
[in this window]
[in a new window]
| Fig 2.
Correlation between log(MMP-9) and IL-6 expression in
NHL. IL-6 and log(MMP-9) values represent densitometric measurements of
the intensities of PCR bands shown in Fig 1 (methodology described in
Materials and Methods).
|
|
IL-6 stimulates MMP-2 and MMP-9 secretion in lymphoma cell lines.
MMP-9 was found to be constitutively secreted into serum-free media by
Raji and NC-37 cells but not by the Jurkat cell line and none of these
cell lines secreted MMP-2 without a stimulus (Fig
3A). However, after incubation with IL-6,
both MMP-2 and MMP-9 activities were detected in supernatants of Raji,
Jurkat, and NC-37 cells by gelatin zymography. Densitometric analysis showed that MMP-9 secretion by Raji cells was stimulated by IL-6 (1.75-fold). IL-10 and TNF- did not stimulate MMP-9 or MMP-2 secretion by Raji, NC-37, or Jurkat cells.

View larger version (34K):
[in this window]
[in a new window]
| Fig 3.
Zymographic analysis of media conditioned by Raji,
Jurkat, and NC-37 cell lines stimulated with cytokines and the in vitro
invasion assay. (A) Zymograms of media conditioned by cells incubated
for 16 hours at 37°C and 5% CO2 in serum-free IMDM in
the absence (control) or presence of a cytokine. Zymography was
performed using 10% polyacrylamide gels containing 2 mg/mL gelatin as
described in Materials and Methods. The final concentrations of
cytokines were 10 ng/mL TNF- , 100 ng/mL IL-6, and 100 ng/mL IL-10.
Media conditioned by BHK and KG-1 cells were used as standards showing
the positions of the 92 kD (MMP-9) and 72 kD (MMP-2) activities in the
gels. (B) Matrigel invasion by Raji and Jurkat cells after stimulation
with IL-6 and IL-10 or without (control) as described in Materials and
Methods. The asterisks * indicate statistically significant differences
in the percentage of migration (P = .046 for Raji and P
= .0002 for Jurkat) in the presence of IL-6 versus control
(without IL-6). (C) Effect of MMP inhibitors on the percentage of
migration of IL-6-stimulated Raji and Jurkat cells. The final
concentrations of anti-MMP-9 and anti-MMP-2 antibodies and
recombinant TIMP-1, as well as the preincubation conditions are
described in Materials and Methods. The basal migration of Raji and
Jurkat cells was set at 100% (control) and the percentages of
migration in the presence of the different inhibitors are represented
as mean ± standard deviation relative to the control.
|
|
IL-6-stimulated Matrigel invasion by lymphoma cell lines is
inhibited by recombinant TIMP-1 and anti-MMP-9 and MMP-2 antibodies.
After a 16-hour incubation with IL-6, both Raji and Jurkat cells
showed increased in vitro invasion of Matrigel in comparison to the
control (Fig 3B). The percentage of Raji and Jurkat cells migrating
through the Matrigel increased significantly (P = .046 and P = .0002, respectively) after incubation with IL-6, but
not after incubation with IL-10.
Moreover, IL-6-stimulated Matrigel invasion by Raji cells was
significantly reduced by anti-MMP-9 and anti-MMP-2 antibodies and by recombinant human TIMP-1 to 42%, 45%, and 64%, respectively, relative to the control (Fig 3C). The migration of Jurkat cells was
also inhibited by these inhibitors to 31%, 38%, and 48%,
respectively, relative to the control (Fig 3C).
IL-6 induces MMP-9 and MMP-2 transcripts in lymphoid cell lines and
has no effect on TIMP-1 production by these cells.
RT-PCR analysis of RNA extracted from Raji and Jurkat cell lines showed
induction of MMP-9 and MMP-2 mRNA in cells stimulated with IL-6 (Fig
4A). Neither MMP-9 nor MMP-2 transcripts
were detected in unstimulated Raji or Jurkat cell lines, whereas both
transcripts were observed after 6 hours of IL-6 stimulation. TIMP-1
transcripts were detected in Raji and Jurkat cells, but no induction of
TIMP-1 mRNA was observed with IL-6 (Fig 4A). Reverse zymography showed TIMP-1 activity in both Raji and Jurkat cells (Fig 4B). In addition to
TIMP-1 protein, TIMP-2 was also detected in Jurkat cells and TIMP-3 was
present in both cell lines. No induction of TIMP activity was observed
after treatment with IL-6 (Fig 4B).

View larger version (21K):
[in this window]
[in a new window]
| Fig 4.
RT-PCR and reverse zymographic analyses of RNA extracted
from Raji and Jurkat cells and media conditioned by Raji and Jurkat
cell lines stimulated with IL-6. (A) RNA extracted from Raji and Jurkat
cell lines was analyzed for the expression of MMP-9, MMP-2, and TIMP-1
by RT-PCR as described in the Materials and Methods. Cells were
cultured in serum-free media with and without IL-6 (100 ng/mL). Each
analysis was internally controlled by inclusion of GAPDH primers. (B)
Reverse zymogram of conditioned media from Raji and Jurkat cell lines
stimulated 100 ng/mL IL-6. Conditioned medium (CM) from BHK cells was
used as a positive control for TIMP activities.
|
|
 |
DISCUSSION |
There is growing evidence of the complexity of the mechanisms
regulating MMP and TIMP expression and their activity. This is due not
only to the fact that different cell types respond differently to
stimulation by cytokines and growth factors, but also due to formation
of TIMP/MMP complexes, which once formed, may assume new biological
activity.46 Because MMP-9 and TIMP-1 had previously been
shown by us to be overexpressed in a subset of human high-grade NHL,
which is associated with a poor clinical outcome,3-6 in
this study we decided to evaluate NHL for the coexpression of cytokines
and growth factors. Our primary goal was to look for possible
associations between overexpression of MMP-9 and TIMP-1 in relation to
the expression of cytokines and growth factors in lymphoma tissue
obtained from NHL patients. Assessment of the expression of IL-1 ,
IL-6, IL-10, TNF- , TGF , and bFGF mRNA in the lymphoma tissue
showed the strongest positive correlation between IL-6 and MMP-9,
followed by correlations between the expression of TIMP-1 and IL-6,
MMP-9 and IL-10, and MMP-2 and IL-6. This is an important finding in
the setting of human NHL because the overexpression of both IL-6 and
IL-10 in these hematological malignancies has been postulated to
adversely affect prognosis.47-49 In this study the levels
of IL-6 transcripts also correlated with the levels of IL-10
transcripts, supporting a hypothesis that in NHL these two cytokines
may act as cooperative factors.44 IL-6 has been implicated
in the pathogenesis of many human diseases50-52; however,
its role in MMP and TIMP regulation in human malignant lymphoid cells
has not been described. Recently, it has been shown that IL-6 has no
effect on MMP-2 and MMP-9 production by myeloma cells.30
IL-10 is known to stimulate TIMP-1 and inhibit MMP production by human
mononuclear phagocytes,31, 40 but in our study no
correlation between IL-10 and TIMP-1 production in NHLs was found.
We next investigated the functional role of IL-6 and IL-10 in the
induction of gelatinases (MMP-2 and MMP-9) in cultures of human B- and
T-cell lines (Raji, NC-37, and Jurkat) and evaluated whether
stimulation with these cytokines would lead to increased ECM
degradation. We chose lymphoma cell lines that in our previous studies
showed low or undetectable secretion of MMP-2 and MMP-9 and low or no
ability to destroy ECM in vitro.2 These cells produce only
very small amounts of IL-10 and IL-6 constitutively, and Raji cells
have been shown to have a small number of IL-6 receptors.53-56 In the present study, Raji, Jurkat, and
NC-37 cell lines were stimulated with IL-6, IL-10, and TNF- , because
we have recently reported that this last cytokine greatly increases both MMP-9 and MMP-2 secretion by bone marrow CD34+
cells.57 Because plasma levels of these cytokines vary
considerably in different non-Hodgkin's lymphomas and other
hematological states47, 48, 58 the concentrations
of these cytokines for our in vitro experiments were chosen based on
this fact and according to previous reports.26,57-59 We
found that IL-6 stimulated production of both MMP-2 and MMP-9 by all
three lymphoid cell lines, indicating that this cytokine may play a
direct role in the stimulation of MMP production by malignant
lymphomas. Moreover, IL-6, but not IL-10, significantly increased
Matrigel invasion by these lymphoid cell lines and this Matrigel
invasion was significantly reduced by recombinant human TIMP-1 and
anti-MMP-9 and MMP-2 antibodies, suggesting that induction of
gelatinases leads to ECM degradation by these cells. Inhibition of
Matrigel invasion with both anti-MMP-9 and MMP-2 antibodies indicates
that both gelatinases may mediate lymphoid cell transmigration through
basement membranes.
The role of IL-6 in the pathophysiology of NHL has always been thought
to be related to its growth-factor activity. This is the first report
suggesting that in NHL IL-6 also induces MMP. In large-cell NHL, IL-6
has been shown to be produced by non-neoplastic cells, whereas the
malignant lymphocytes expressed the IL-6 receptor.60 Expression of IL-6 mRNA in the present study was measured in lymphoma tissues containing malignant lymphocytes as well as non-neoplastic cells, the latter including reactive lymphocytes, macrophages, endothelial cells, and fibroblasts. It is therefore likely that non-neoplastic cells were responsible for IL-6 production whereas the
malignant lymphocytes responded to the stimulus. This is in agreement
with our previous findings that MMP-9 is produced by large lymphoma
cells2,3 and with the current observation that after
stimulation with IL-6, gelatinase production increases in cultures of
lymphoma cell lines. Our present study suggests that in NHL, IL-6 may
have a dual function. In addition to its growth-promoting function, it
may act through the stimulation of MMP production, increasing the
ability of lymphoma cells to destroy ECM and spread throughout the
body. In consequence, human NHL that overexpress both IL-6 and MMP may
have more aggressive biological behavior.
TIMP-1 expression in NHL tissue correlated with IL-6 expression, but
IL-6 did not increase TIMP-1 production in lymphoid cell lines. It is
possible that in the NHL microenvironment IL-6 induces TIMP-1
production by cells other than lymphoid, eg, macrophages or
fibroblasts.25,35 This concept is consistent with our
previous study showing that, in lymphoma tissue, TIMP-1 is produced by stromal cells.5 Production of TIMP-1 by these cells may in turn protect B-lymphoid cells from apoptosis and induce their differentiation.17,18 These effects may explain the
association between high TIMP-1 levels and the adverse prognosis of
NHL.6 We propose that in patients with NHL, IL-6 may induce
production of both gelatinases and TIMP-1 and both may adversely affect
the clinical outcome, although they act through different mechanisms.
Taken together, these data indicate a causal relationship between
increased IL-6 production in lymphomas and expression of MMP-2, MMP-9,
and TIMP-1. The relationship between IL-10 and MMP-9 expression
observed in human NHL was not apparent in the lymphoma cell lines
studied. This likely reflects a requirement for IL-10 to act in
combination with other growth factors and cytokines in the tumor
microenvironment to induce MMP-9 transcription. In this study we
evaluated MMP and TIMP-1 in lymphoma tissues and lymphoid cell lines.
By comparison, normal human lymphoid cells such as T lymphocytes
constitutively express MMP-9, and both MMP-2 and MMP-9 are induced by
T-cell activation.61 Moreover, mixed T-lymphocytes
(isolated from human blood) were shown to transmigrate across Matrigel,
a process that is MMP-dependent and stimulated by IL-2.61
Inducible MMP production by T-lymphocytes and macrophages has been
implicated in various immunological processes; however, different
mechanisms may operate in normal lymphocytes and neoplastic lymphoid
cells.20 For example, MMP-9 and TIMP-1 production in T-cell
lymphoma was shown to be induced during T-lymphoma/endothelial cell
contact through the intercellular adhesion molecule-1/LFA-1 interaction.62 The mechanisms of MMP and TIMP regulation in normal and neoplastic cells of B origin are unknown. Based on studies
of nonlymphoid cells it has been proposed that cell-specific basal and
inducible expression of MMP and TIMP is regulated on the molecular
level by several control elements. The family of Activator Protein-1
(AP-1) transcription factors has long been thought to play a major role
in the transcriptional activation of MMP and TIMP
promoters.63,64 Transactivation by cytokines and growth
factors requires specific interactions of AP-1 with other
cis-acting elements (eg, Ets/PEA3 binding sites) and these complex interactions control the transcription of MMP and TIMP in
response to particular inducers and repressors.63,64 The molecular mechanisms of MMP-2 and MMP-9 induction by IL-6 are unknown,
and further studies are needed to elucidate the transcriptional regulatory pathways in NHL.
It is of interest that in some lymphoma cell lines, MMP-9 is induced by
EBV latent membrane protein 1, and IL-6 receptor in Burkitt's lymphoma
is upregulated by EBV infection in vitro.65, 66 Some of the
Burkitt's lymphoma cell lines were also described previously to
overexpress MMP-9.11 A common pathogenetic link may exist
between EBV infection, overexpression of IL-6 and its receptor,
induction of MMP-9, and development of lymphoid malignancies. This
would be of special importance in the lymphoproliferative disorders
occurring in an immunocompromised host (eg, post-transplantation, human
immunovirus [HIV] infection).
In conclusion, our findings imply the existence of a previously
undescribed mechanism operating in the pathogenesis of human NHL. This
may lead to new therapeutic approaches in the treatment of these disorders.
 |
ACKNOWLEDGMENT |
We acknowledge Maria Cobuhat and Adrian Dobrowsky (University of
Alberta) and Ms Anita Martin (University of Calgary) for technical
help; Lawrence S. Urbanski and Andrea L. Stabbler for assistance in
computer imaging, as well as Susan Watson for her secretarial assistance.
 |
FOOTNOTES |
Submitted December 21, 1998; accepted May 19, 1999.
Supported by a grant from the Medical Research Council of Canada to
A.E.K. (MT-12706) and a grant from Canadian Blood Services R & D to
A.J-W. D.R.E. is supported by the Norfolk and Norwich Big C Appeal.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address correspondence to Anna E. Kossakowska, MD, Department of
Histopathology, Foothills Hospital, 1403 29th St NW,
Calgary, AB, Canada T2N 2T9; e-mail:
anna.kossakowska{at}crha-health.ab.ca.
 |
REFERENCES |
1.
The Non-Hodgkin's Lymphoma Pathologic Classification Project:
National Cancer Institute sponsored study of classifications of non-Hodgkin's lymphomas. Summary and description of a Working Formulation for clinical usage.
Cancer
49:2112, 1982[Medline]
[Order article via Infotrieve].
2.
Kossakowska AE, Hinek A, Edwards DR, Lim MS, Zhang Ch-L, Breitman DR, Prusinkiewicz C, Stabbler AL, Urbanski LS, Urbanski SJ:
Proteolytic activity of human non-Hodgkin's lymphomas.
Am J Pathol
152:565, 1998[Abstract]
3.
Kossakowska AE, Urbanski SJ, Watson A, Hayden LJ, Edwards DR:
Patterns of expression of metalloproteinases and their inhibitors in human malignant lymphomas.
Oncol Res
5:19, 1993[Medline]
[Order article via Infotrieve]
4.
Kossakowska AE, Urbanski SJ, Hutchcroft SA, Edwards DR:
Relationship between the clinical aggressiveness of large cell immunoblastic lymphomas and expression of 92 kDa gelatinase (type IV Collagenase) and tissue inhibitor of metalloproteinases-1 (TIMP-1) RNAs.
Oncol Res
4:233, 1992[Medline]
[Order article via Infotrieve]
5.
Kossakowska AE, Urbanski SJ, Edwards DR:
Tissue inhibitor of metalloproteinases-1 (TIMP-1) RNA is expressed at elevated levels in malignant non-Hodgkin's lymphomas.
Blood
77:2475, 1991[Abstract/Free Full Text]
6.
Kossakowska AE, Zhang MCh-L, Brasher P, Urbanski SJ, Edwards DR:
TIMP-1 is a predictor of survival in human non-Hodgkin's lymphomas.
Mod Pathol
12:140A, 1999
7.
Murphy G:
Matrix metalloproteinases and their inhibitors [Review].
Acta Orthop Scand Suppl
266:55, 1995[Medline]
[Order article via Infotrieve]
8.
d'Ortho MP, Will H, Atkinson S, Butler G, Messent A, Gavrilovic J, Smith B, Timpl R, Zardi L, Murphy G:
Membrane-type matrix metalloproteinases 1 and 2 exhibit broad-spectrum proteolytic capacities comparable to many matrix metalloproteinases.
Eur J Biochem
250:751, 1997[Medline]
[Order article via Infotrieve]
9.
Kossakowska AE, Huchcroft SA, Urbanski SJ, Edwards DR:
Comparative analysis of the expression patterns of metalloproteinases and their inhibitors in breast neoplasia, sporadic colorectal neoplasia, pulmonary carcinomas and malignant non-Hodgkin's lymphomas in humans.
Br J Cancer
73:1401, 1996[Medline]
[Order article via Infotrieve]
10.
Stetler-Stevenson WG, Hewitt R, Corcoran M:
Matrix metalloproteinases and tumor invasion: From correlation and causality to the clinic (Review).
Semin Cancer Biol
7:147, 1996[Medline]
[Order article via Infotrieve]
11.
Stetler-Stevenson M, Mansoor A, Lim M, Fukushima P, Kehrl J, Marti G, Ptaszynski K, Wang J, Stetler-Stevenson WG:
Expression of matrix metalloproteinases and tissue inhibitors of metalloproteinases in reactive and neoplastic lymphoid cells.
Blood
89:1708, 1997[Abstract/Free Full Text]
12.
Matsuzaki A, Janowska-Wieczorek A:
Unstimulated human acute myelogenous leukemia blasts secrete matrix metalloproteinases.
J Cancer Res Clin Oncol
123:100, 1997[Medline]
[Order article via Infotrieve]
13.
Sawicki G, Matsuzaki A, Janowska-Wieczorek A:
Expression of the active form of MMP-2 on the surface of leukemic cells accounts for their in vitro invasion.
J Cancer Res Clin Oncol
124:245, 1998[Medline]
[Order article via Infotrieve]
14.
Janowska-Wieczorek A, Marquez LA, Matsuzaki A, Hashmi HR, Larratt LM, Boshkov LM, Turner AR, Zhang MC, Edwards DR, Kossakowska AE:
Expression of matrix metalloproteinases (MMP-2 and -9) and tissue inhibitors of metalloproteinases (TIMP-1 and -2) in acute myelogenous leukaemia blasts: Comparison with normal bone marrow cells.
Brit J Haematol
105:402, 1999[Medline]
[Order article via Infotrieve]
15.
Mansoor A, Birkedal-Hansen B, Lim MS, Guedez L, Stetler-Stevenson WG, Stetler-Stevenson M:
TIMP-1 expression correlates with histologic grade in B-cell lymphomas.
Mod Pathol
10:130A, 1997
16.
Hayakawa T, Yamashita K, Tanzawa E, Uchijima E, Iwata K:
Growth-promoting activity of tissue inhibitor of metalloproteinase-1 (TIMP-1) for a wide range of cells. A possible new growth factor in serum.
FEBS Lett
298:29, 1992[Medline]
[Order article via Infotrieve]
17.
Guedez L, Stetler-Stevenson WG, Wolff L, Wang J, Fukushima P, Mansoor A, Stetler-Stevenson M:
In vitro suppression of programmed cell death of B cells by tissue inhibitor of metalloproteinases-1.
J Clin Invest
102:2002, 1998[Medline]
[Order article via Infotrieve]
18.
Guedez L, Courtemanch L, Stetler-Stevenson M:
Tissue inhibitor of metalloproteinase (TIMP-1) induces differentiation and an antiapoptotic phenotype in germinal center B cells.
Blood
92:1342, 1998[Abstract/Free Full Text]
19.
Murphy G, Reynolds JJ:
Extracellular matrix degradation, in
Royce PM,
Steinmann B
(eds):
Connective Tissue and its Heritable Disorders. New York, NY, Wiley-Liss, Inc, 1993, p 287.
20.
Goetzl EJ, Banda MJ, Leppert D:
Matrix metalloproteinases in immunity [Review].
J Immunol
156:1, 1996[Abstract]
21.
Unemori EN, Hibbs MS, Amento EP:
Constitutive expression of a 92-kDa gelantinase (type IV) collagenase by rheumatoid synovial fibroblasts and its induction in normal human fibroblasts by inflammatory cytokines.
J Clin Invest
88:1656, 1991
22.
Sato T, Ito A, Ogata Y, Nagase H, Mori Y:
Tumor necrosis factor alpha (TNF alpha) induces pro-matrix metalloproteinase-9 production in human uterine cervical fibroblasts but interleukin 1 alpha antagonizes the inductive effect of TNF alpha.
FEBS Lett
392:175, 1996[Medline]
[Order article via Infotrieve]
23.
Kurogi T, Nabeshima K, Kataoka Y, Okada Y, Koono OM:
Stimulation of gelatinase B and tissue inhibitors of metalloproteinase (TIMP) production in co-culture of human osteosarcoma cells and human fibroblasts: gelatinase B production was stimulated via upregulation of fibroblast growth factor (FGF) receptor.
Int J Cancer
66:82, 1996[Medline]
[Order article via Infotrieve]
24.
Saren P, Welgus HG, Kovanen PT:
TNF-alpha and IL-1 beta selectively induce expression of 92 kDa gelatinase by human macrophages.
J Immunol
157:4159, 1996[Abstract]
25.
Guedez L, Lim MS, Stetler-Stevenson WG:
The role of metalloproteinases and their inhibitors in hematological disorders (Review).
Crit Rev Oncog
7:205, 1996[Medline]
[Order article via Infotrieve]
26.
Johnatty RN, Taub DD, Reeder SP, Turcovski-Corrales SM, Cottam DW, Stephenson TJ, Rees RC:
Cytokine and chemokine regulation of proMMP-9 and TIMP-1 production by human peripheral blood lymphocytes.
J Immunol
158:2327, 1997[Abstract]
27.
Xia M, Leppert D, Hauser SL, Sreedharan SP, Nelson PJ, Krensky AM, Goetzl EJ:
Stimulus specificity of matrix metalloproteinase dependence of human T-cell migration through a model basement membrane.
J Immunol
156:160, 1996[Abstract]
28.
Stüve O, Dooley NP, Uhm JH, Antel JP, Francis GS, Williams G, Yong VW:
Interferon beta-1b decreases the migration of T lymphocytes in vitro: Effects on matrix metalloproteinase-9.
Ann Neurol
40:853, 1996[Medline]
[Order article via Infotrieve]
29.
Di Girolamo N, Tedla N, Lloyd A, Wakefield D:
Expression of matrix metalloproteinases by human plasma cells and B lymphocytes.
Eur J Immunol
28:1773, 1998[Medline]
[Order article via Infotrieve]
30.
Barille S, Akhoundi C, Collette M, Mellerin MP, Rapp MJ, Harousseau JL, Bataille R, Amiot M:
Metalloproteinases in multiple myeloma: Production of matrix metalloproteinase-9 (MMP-9), activation of pro MMP-2, and induction of MMP-1 by myeloma cells.
Blood
90:1649, 1997[Abstract/Free Full Text]
31.
Mertz PM, DeWitt DL, Stetler-Stevenson WG, Wahl LM:
Interleukin 10 suppression of monocyte prostaglandin H synthase-2. Mechanism of inhibition of prostaglandin-dependent matrix metalloproteinase production.
J Biol Chem
269:21322, 1994[Abstract/Free Full Text]
32.
Wahl LM, Corcoran ML:
Regulation of monocyte/macrophage metalloproteinase production by cytokines.
J Periodontol
64:467, 1993[Medline]
[Order article via Infotrieve]
33.
Wang M, Fudge K, Rhim JS, Stearns ME:
Cytokine regulation of the matrix metalloproteinases and their inhibitors in human papillomavirus-18 transformed human prostatic tumor cell lines.
Oncol Res
8:303, 1996[Medline]
[Order article via Infotrieve]
34.
Nuovo GJ:
In situ detection of PCR-amplified metalloproteinase cDNAs, their inhibitors and human papillomavirus transcripts in cervical carcinoma cell lines.
Int J Cancer
71:1056, 1997[Medline]
[Order article via Infotrieve]
35.
Sato T, Ito A, Mori Y:
Interleukin 6 enhances the production of tissue inhibitor of metalloproteinases (TIMP) but not that of matrix metalloproteinases by human fibroblasts.
Biochem Biophys Res Commun
170:824, 1990[Medline]
[Order article via Infotrieve]
36.
Roeb E, Graeve L, Mullberg J, Matern S, Rose-John S:
TIMP-1 protein expression is stimulated by IL-1 beta and IL-6 in primary rat hepatocytes.
Ann N Y Acad Sci
762:462, 1995[Medline]
[Order article via Infotrieve]
37.
Roeb E, Graeve L, Hoffman R, Decker K, Edwards DR, Heinrich PC:
Regulation of tissue inhibitor of metalloproteinases-1 gene expression by cytokines and dexamethasone in rat hepatocyte primary cultures.
Hepatology
18:1437, 1993[Medline]
[Order article via Infotrieve]
38.
Stearns M, Wang M, Stearns ME:
Cytokine (IL-10, IL-6) induction of tissue inhibitor of metalloproteinase 1 in primary human prostate tumor cell lines.
Oncol Res
7:173, 1995[Medline]
[Order article via Infotrieve]
39.
Fabunmi RP, Baker AH, Murray EJ, Booth RF, Newby AC:
Divergent regulation by growth factors and cytokines of 95 kDa and 72 kDa gelatinases and tissue inhibitors or metalloproteinases-1, -2, and -3 in rabbit aortic smooth muscle cells.
J Biochem
315:335, 1996
40.
Lacraz S, Nicod L, Chicheportiche R, Welgus H, Dayer JM:
IL-10 inhibits metalloproteinases and stimulates TIMP-1 production in human mononuclear phagocytes.
J Clin Invest
96:2304, 1995
41.
The International Lymphoma Study Group:
A Revised European-American Classification of Lymphoid Neoplasms: A Proposal from the International Lymphoma Study Group.
Blood
84:1361, 1994[Free Full Text]
42.
Chomczynski P, Sacchi N:
Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156, 1987[Medline]
[Order article via Infotrieve]
43.
Wong H, Anderson WD, Cheng T, Riabowol KT:
Monitoring mRNA expression by polymerase chain reaction: The "primer-dropping" method.
Anal Biochem
223:251, 1994[Medline]
[Order article via Infotrieve]
44.
Voorzanger N, Toituou R, Garcia E, Delecluse HJ, Rousset F, Joab I, Favrot M, Blay JY:
Interleukin (IL)-10 and IL-6 are produced in vivo in non-Hodgkin's lymphoma cells and act as cooperative growth factors.
Cancer Res
56:5499, 1996[Abstract/Free Full Text]
45.
Janiak M, Hashmi HR, Janowska-Wieczorek A:
Use of the Matrigel-based assay to measure the invasiveness of leukemic cells.
Exp Hematol
22:559, 1994[Medline]
[Order article via Infotrieve]
46.
Kossakowska AE, Edwards DR, Lee SS, Urbanski LS, Stabbler AL, Zhang CL, Phillips BW, Zhang Y, Urbanski SJ:
Altered balance between matrix metalloproteinases and their inhibitors in experimental biliary fibrosis.
Am J Pathol
153:1895, 1998[Abstract/Free Full Text]
47.
Seymour JF, Talpaz M, Cabanillas F, Wetzler M, Kurzock R:
Serum interleukin-6 levels correlate with prognosis in diffuse large cell lymphoma.
J Clin Oncol
13:575, 1995[Abstract/Free Full Text]
48.
Blay JY, Burdin N, Rousset F, Lenoir G, Biron P, Philip T, Banchereau J, Favrot MC:
Serum interleukin-10 in non-Hodgkin's lymphoma: A prognostic factor.
Blood
82:2169, 1993[Abstract/Free Full Text]
49.
Cortes J, Kurzrock R:
Interleukin-10 in non-Hodgkin's lymphoma [Review].
Leuk Lymphoma
26:251, 1997[Medline]
[Order article via Infotrieve]
50.
Hirano T, Akira S, Taga T, Kishimoto T:
Biological and clinical aspects of interleukin 6.
Immunol Today
11:443, 1990[Medline]
[Order article via Infotrieve]
51.
Hirano T:
Interleukin-6 and its receptor: ten years later.
Int Rev Immunol
16:249, 1998[Medline]
[Order article via Infotrieve]
52.
Treon SP, Anderson KC:
Interleukin-6 in multiple myeloma and related plasma cell dyscrasias [Review].
Curr Opin Hematol
5:42, 1998[Medline]
[Order article via Infotrieve]
53.
Benjamin D, Knobloch TJ, Dayton MA:
Human B-cell Interleukin-10: B-cell lines derived from patients with acquired immunodeficiency syndrome and Burkitt's lymphoma constitutively secrete large quantities of interleukin-10.
Blood
80:1289, 1992[Abstract/Free Full Text]
54.
Mori N, Gill PS, Mougdil T, Murakami S, Eto S, Prager D:
Interleukin-10 gene expression in adult T-cell leukemia.
Blood
88:1035, 1996[Abstract/Free Full Text]
55.
Klein SC, van Wichen DF, Golverdingen JG, Jacobse KC, Broekhuizen R, de Weger RA:
An improved, sensitive, non-radioactive in situ hybridization method for the detection of cytokine mRNAs.
APMIS
103:345, 1995[Medline]
[Order article via Infotrieve]
56.
Taga T, Kawanishi Y, Hardy RR, Hirano T, Kishimoto T:
Receptors for B-cell stimulatory factor 2. Quantitation, specificity, distribution, and regulation of their expression.
J Exp Med
166:967, 1987[Abstract/Free Full Text]
57.
Janowska-Wieczorek A, Marquez LA, Nabholtz J-M, Cabuhat ML, Montaño J, Chang H, Rozmus J, Russell JA, Edwards DR, Turner AR:
Growth factors and cytokines upregulate gelatinase expression in bone marrow CD34+ cells and their transmigration through reconstituted basement membrane.
Blood
93:3379, 1999[Abstract/Free Full Text]
58.
Matsuzaki A, Nabholtz J-M, Nahirniak S, Janowska-Wieczorek A:
Endogenous erythropoietin, tumor necrosis factor- and interleukin-6 levels after peripheral blood stem cell transplantation.
Hematology
2:151, 1997
59.
Mielcarek M, Roecklein BA, Torok-Storb B:
CD14+ cells in granulocyte colony-stimulating factor (G-CSF)-mobilized peripheral blood mononuclear cells induce secretion of interleukin-6 and G-CSF by marrow stroma.
Blood
87:574, 1996[Abstract/Free Full Text]
60.
Emilie D, Coumbaras J, Raphael M, Devergne O, Delecluse HJ, Gisselbrecht C, Michiels JF, Van Damme J, Taga T, Kishimoto T, Crevon MC, Galanaud P:
Interleukin-6 production in high-grade B lymphomas: Correlation with the presence of malignant immunoblasts in acquired immunodeficiency syndrome and in human immunodeficiency virus-seronegative patients.
Blood
80:498, 1992[Abstract/Free Full Text]
61.
Leppert D, Waubant E, Galardy R, Bunnett NW, Hauser SL:
T cell gelatinases mediate basement membrane transmigration in vitro.
J Immunol
154:4379, 1995[Abstract]
62.
Aoudjit F, Potworowski EF, St-Pierre Y:
Bi-directional induction of matrix metalloproteinase-9 and tissue inhibitor of matrix metalloproteinase-1 during T-lymphoma/endothelial cell contact: Implication of ICAM-1.
J Immunol
160:2967, 1998[Abstract/Free Full Text]
63.
Borden P, Heller RA:
Transcriptional control of matrix metalloproteinases and the tissue inhibitors of matrix metalloproteinases [Review].
Crit Rev Eukaryot Gene Expr
7:159, 1997[Medline]
[Order article via Infotrieve]
64.
Benbow U, Brinckerhoff CE:
The AP-1 site and MMP gene regulation: What is all the fuss about? [Review].
Matrix Biol
15:519, 1997[Medline]
[Order article via Infotrieve]
65.
Yoshizaki T, Sato H, Furukawa M, Pagano JS:
The expression of matrix metalloproteinase 9 is enhanced by Epstein-Barr virus latent membrane protein 1.
Proc Natl Acad Sci USA
95:3621, 1998[Abstract/Free Full Text]
66.
Tomeczkowski J, zur Stadt U, Reiter A, Welte K, Sykora KW:
Absence of IL-6 receptor expression in fresh childhood Burkitt?s lymphoma cells and induction of IL-6 receptors by Epstein-Barr virus in vitro.
Br J Haematol
97:400, 1997[Medline]
[Order article via Infotrieve]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
K. R. Chava, M. Karpurapu, D. Wang, M. Bhanoori, V. Kundumani-Sridharan, Q. Zhang, T. Ichiki, W. C. Glasgow, and G. N. Rao
CREB-Mediated IL-6 Expression Is Required for 15(S)-Hydroxyeicosatetraenoic Acid-Induced Vascular Smooth Muscle Cell Migration
Arterioscler Thromb Vasc Biol,
June 1, 2009;
29(6):
809 - 815.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
U Berg, T Gustafsson, C J Sundberg, L Kaijser, C Carlsson-Skwirut, and P Bang
Interstitial IGF-I in exercising skeletal muscle in women
Eur. J. Endocrinol.,
October 1, 2007;
157(4):
427 - 435.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Kundu, A. K. Mukhopadhyay, R. Patra, A. Banerjee, D. E. Berg, and S. Swarnakar
Cag Pathogenicity Island-independent Up-regulation of Matrix Metalloproteinases-9 and -2 Secretion and Expression in Mice by Helicobacter pylori Infection
J. Biol. Chem.,
November 10, 2006;
281(45):
34651 - 34662.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Dien, H. M. Amin, N. Chiu, W. Wong, C. Frantz, B. Chiu, J. R. Mackey, and R. Lai
Signal Transducers and Activators of Transcription-3 Up-Regulates Tissue Inhibitor of Metalloproteinase-1 Expression and Decreases Invasiveness of Breast Cancer
Am. J. Pathol.,
August 1, 2006;
169(2):
633 - 642.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Demers, T. Magnaldo, and Y. St-Pierre
A Novel Function for Galectin-7: Promoting Tumorigenesis by Up-regulating MMP-9 Gene Expression
Cancer Res.,
June 15, 2005;
65(12):
5205 - 5210.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Song, A. Zlobin, P. Ghoshal, Q. Zhang, C. Houde, S. Weijzen, Q. Jiang, E. Nacheva, D. Yagan, E. Davis, et al.
Alteration of SMRT Tumor Suppressor Function in Transformed Non-Hodgkin Lymphomas
Cancer Res.,
June 1, 2005;
65(11):
4554 - 4561.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A.H. Schoneveld, M.M. Oude Nijhuis, B. van Middelaar, J.D. Laman, D.P.V. de Kleijn, and G. Pasterkamp
Toll-like receptor 2 stimulation induces intimal hyperplasia and atherosclerotic lesion development
Cardiovasc Res,
April 1, 2005;
66(1):
162 - 169.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Tazaki, K. Minoguchi, T. Yokoe, K. T. R. Samson, H. Minoguchi, A. Tanaka, Y. Watanabe, and M. Adachi
Increased Levels and Activity of Matrix Metalloproteinase-9 in Obstructive Sleep Apnea Syndrome
Am. J. Respir. Crit. Care Med.,
December 15, 2004;
170(12):
1354 - 1359.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kitamura, Y. Nakamoto, S. Kaneko, and N. Mukaida
Pivotal roles of interleukin-6 in transmural inflammation in murine T cell transfer colitis
J. Leukoc. Biol.,
December 1, 2004;
76(6):
1111 - 1117.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. E. Baratelli, N. Heuze-Vourc'h, K. Krysan, M. Dohadwala, K. Riedl, S. Sharma, and S. M. Dubinett
Prostaglandin E2-Dependent Enhancement of Tissue Inhibitors of Metalloproteinases-1 Production Limits Dendritic Cell Migration through Extracellular Matrix
J. Immunol.,
November 1, 2004;
173(9):
5458 - 5466.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Van Themsche, T. Alain, A. E. Kossakowska, S. Urbanski, E. F. Potworowski, and Y. St-Pierre
Stromelysin-2 (Matrix Metalloproteinase 10) Is Inducible in Lymphoma Cells and Accelerates the Growth of Lymphoid Tumors In Vivo
J. Immunol.,
September 15, 2004;
173(6):
3605 - 3611.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Lai, G. Z. Rassidakis, L. J. Medeiros, L. Ramdas, A. H. Goy, C. Cutler, Y. Fujio, K. Kunisada, H. M. Amin, and F. Gilles
Signal Transducer and Activator of Transcription-3 Activation Contributes to High Tissue Inhibitor of Metalloproteinase-1 Expression in Anaplastic Lymphoma Kinase-Positive Anaplastic Large Cell Lymphoma
Am. J. Pathol.,
June 1, 2004;
164(6):
2251 - 2258.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Pertovaara, J. Hulkkonen, M. Hurme, T. Lehtimaki, and A. Pasternack
Urinary matrix metalloproteinase-9 and interleukin-6 and renal manifestations of primary Sjogren's syndrome
Rheumatology,
June 1, 2004;
43(6):
807 - 808.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Yamagami, K. Kitagawa, Y. Nagai, H. Hougaku, M. Sakaguchi, K. Kuwabara, K. Kondo, T. Masuyama, M. Matsumoto, and M. Hori
Higher Levels of Interleukin-6 Are Associated With Lower Echogenicity of Carotid Artery Plaques
Stroke,
March 1, 2004;
35(3):
677 - 681.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. Owen, V. Iragavarapu-Charyulu, Z. Gunja-Smith, L. M. Herbert, J. F. Grosso, and D. M. Lopez
Up-Regulation of Matrix Metalloproteinase-9 in T Lymphocytes of Mammary Tumor Bearers: Role of Vascular Endothelial Growth Factor
J. Immunol.,
October 15, 2003;
171(8):
4340 - 4351.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Mitola, M. Strasly, M. Prato, P. Ghia, and F. Bussolino
IL-12 Regulates an Endothelial Cell-Lymphocyte Network: Effect on Metalloproteinase-9 Production
J. Immunol.,
October 1, 2003;
171(7):
3725 - 3733.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. To, M. Dohi, K. Matsumoto, R. Tanaka, A. Sato, K. Nakagome, T. Nakamura, and K. Yamamoto
A Two-way Interaction between Hepatocyte Growth Factor and Interleukin-6 in Tissue Invasion of Lung Cancer Cell Line
Am. J. Respir. Cell Mol. Biol.,
August 1, 2002;
27(2):
220 - 226.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Gelati, E. Corsini, M. De Rossi, L. Masini, G. Bernardi, G. Massa, A. Boiardi, and A. Salmaggi
Methylprednisolone Acts on Peripheral Blood Mononuclear Cells and Endothelium in Inhibiting Migration Phenomena in Patients With Multiple Sclerosis
Arch Neurol,
May 1, 2002;
59(5):
774 - 780.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Oelmann, H. Herbst, M. Zuhlsdorf, O. Albrecht, A. Nolte, C. Schmitmann, O. Manzke, V. Diehl, H. Stein, and W. E. Berdel
Tissue inhibitor of metalloproteinases 1 is an autocrine and paracrine survival factor, with additional immune-regulatory functions, expressed by Hodgkin/Reed-Sternberg cells
Blood,
January 1, 2002;
99(1):
258 - 267.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. De Benedetti, C. Meazza, M. Oliveri, P. Pignatti, M. Vivarelli, T. Alonzi, E. Fattori, S. Garrone, A. Barreca, and A. Martini
Effect of IL-6 on IGF Binding Protein-3: A Study in IL-6 Transgenic Mice and in Patients with Systemic Juvenile Idiopathic Arthritis
Endocrinology,
November 1, 2001;
142(11):
4818 - 4826.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|