|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 6 (September 15), 1999:
pp. 2151-2158
In Vivo Selection of Wild-Type Hematopoietic Stem Cells in a Murine
Model of Fanconi Anemia
By
Kevin P. Battaile,
Raynard L. Bateman,
Derik Mortimer,
Jean Mulcahy,
R. Keaney Rathbun,
Grover Bagby,
William H. Fleming, and
Markus Grompe
From the Department of Molecular and Medical Genetics and the
Division of Hematology and Medical Oncology, Oregon Health Sciences
University, Portland, OR; and the Portland Veterans Affairs Medical
Center, Portland, OR.
 |
ABSTRACT |
Fanconi anemia (FA) is an autosomal recessive disorder characterized
by birth defects, increased incidence of malignancy, and progressive
bone marrow failure. Bone marrow transplantation is therapeutic and,
therefore, FA is a candidate disease for hematopoietic gene therapy.
The frequent finding of somatic mosaicism in blood of FA patients has
raised the question of whether wild-type bone marrow may have a
selective growth advantage. To test this hypothesis, a cohort
radio-ablated wild-type mice were transplanted with a 1:1 mixture of FA
group C knockout (FACKO) and wild-type bone marrow. Analysis of
peripheral blood at 1 month posttransplantation showed only a moderate
advantage for wild-type cells, but upon serial transplantation, clear
selection was observed. Next, a cohort of FACKO mice received a
transplant of wild-type marrow cells without prior
radio-ablation. No wild-type cells were detected in peripheral blood
after transplantation, but a single injection of mitomycin C (MMC)
resulted in an increase to greater than 25% of wild-type DNA. Serial
transplantation showed that the selection occurred at the level of
hematopoietic stem cells. No systemic side effects were observed. Our
results show that in vivo selection for wild-type hematopoietic stem
cells occurs in FA and that it is enhanced by MMC administration.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
FANCONI ANEMIA (FA) is an inherited
disorder characterized clinically by pancytopenia, short stature, renal
defects, defects of the thumb and radius, and
hyperpigmentation.1 Pancytopenia is universally present,
but the other traits can be variable in their presence and
severity.2,3 On the basis of somatic cell genetic
experiments it is clear that at least 8 or more complementation groups
exist, termed A through H,4-7 with the genes for groups A,
C, and G having been cloned.8-11 The group A and C genes do not resemble any other known genes,12 whereas group G has
turned out to be XRCC9.8 The prognosis in FA is
poor, with most of the morbidity and mortality due to pancytopenia.
Affected individuals have a predisposition to leukemia13
and other tumors, with the suggestion of an increased incidence of
neoplasms in heterozygotes.14
The basic biochemical defect in FA is unknown, but FA cells are
hypersensitive to DNA damage by interstrand cross-linking agents such
as mitomycin C (MMC), diepoxybutane (DEB), or cis-diplatinum. This can
be exploited for diagnostic testing, including prenatal diagnosis, in
which these abnormalities are induced by exposure of cells to MMC or
DEB.15 During cytogenetic analysis, cells display
chromosomal aberrations at a very high frequency, including chromatid
breaks, gaps, exchange figures, and endoreduplication. The sensitivity
of FA cells to DNA cross-linking agents varies greatly between
complementation groups and families, ranging from severely sensitive to
almost normal. Bone marrow transplantation is currently the best
therapy available for FA and has been successfully performed in FA in a
number of cases.16,17 The successful use of bone marrow
transplantation makes FA an obvious candidate for somatic gene therapy
by transfer of the normal gene into hematopoietic stem
cells.18,19
Recently, an important observation relevant to bone marrow
transplantation and gene therapy in FA was reported. It was found that
up to 25% of patients with FA had evidence of somatic mosaicism in
peripheral blood lymphocytes.20 In these patients,
populations of cells that were no longer sensitive to DNA cross-linking
agents could be identified. In 1 case, the molecular mechanism by which the revertant cells arose was identified.20 An intragenic
mitotic recombination resulted in a cell containing 2 mutant FA alleles on one chromosome and a wild-type on the other. Similar somatic mosaicism has previously been observed in adenosine deaminase deficiency and Bloom's syndrome.21,22 In both cases,
genetically corrected cells were found to have a selective growth
advantage. The observation of frequent mosaicism in FA patients
suggests that in vivo growth selection also favors wild-type cells, at least in peripheral blood. Mosaicism at the level of the hematopoietic stem cell has not yet been convincingly documented in FA, and the
factor(s) that enhances selection has not been identified. The
hypothesis that the growth selection in FA occurs at the stem cell
level could best be tested directly in an animal model.
We have previously reported the generation of a mouse model with
a targeted deletion of exon 9 of the FANCC gene.23
Heterozygous FANCC knockout mice (FACKO) are normal, and mutant animals
have no obvious developmental abnormalities except sterility caused by
decreased numbers of germ cells.23 However, fibroblast
cultures from the FACKO mice exhibited the characteristic chromosome
breakage seen in human FA cells upon treatment with MMC or
DEB.23 Hematologically, FACKO mice appear almost normal and
have normal complete blood counts throughout life. In addition, the
number of hematopoietic progenitor cells is the same in mutant and
control mice as measured by in vitro culture assays23 and
spleen colony-forming units.24 However, in vitro assays
(burst-forming units-erythroid [BFU-E] and
colony-forming unit granulocyte-macrophage [CFU-GM])
have documented marked hypersensitivity to the mitotic inhibitor
interferon- . FACKO marrow is an order of magnitude more sensitive to
interferon- than heterozygote controls.25
We chose 2 experimental approaches to test for both spontaneous and
enhanced selection of wild-type hematopoietic stem cells (HSCs) in FACKO mice. First, we tested the repopulation
capacity of FACKO and wild-type marrow in lethally irradiated recipient mice in a competition assay. Second, we transplanted wild-type marrow
into nonirradiated FACKO mice and determined whether repopulation could
occur in this setting. Our results show that wild-type HSCs are
positively selected in FACKO mice and that this selection is enhanced
by serial transplantation and the administration of sublethal doses of MMC.
| |
MATERIALS AND METHODS |
Mouse strains and animal husbandry.
All mice used in these experiments were 6 to 12 weeks old, were derived
from the 129SvJ strain, and were either FACKO, as previously
reported,23 or heterozygous for a deletion at the hereditary tyrosinemia type 1 (HT1) locus, as previously
reported.26 The animals were housed in the Department of
Animal Care (DAC) at Oregon Health Sciences University (Portland, OR).
All experiments were performed in accordance to the guidelines of the
Institutional Animal Care and Use Committee. Rodent chow (Purina
5010) and water were given ad libitum. All experiments
were performed according to a protocol approved by the DAC.
Polymerase chain reaction (PCR) genotyping.
PCR genotyping was performed with commercially available buffers and
enzymes (PE Applied Biosystems, Foster City, CA) using a Perkin-Elmer
480 thermal cycler (Perkin-Elmer, Norwalk, CT). Primer A
(AAAGACAGAGGAGACGCCAC) hybridized to the sense strand of the genomic
DNA 5' to the knockout region. Primer B (AAGAGCAACACAAATGGTAAGG) hybridized to the antisense strand of the wild-type genomic DNA 3' to
primer A. Primer C (GCATGCTCCAGACTGCCTTG) hybridized to the antisense
strand of the neo cassette. Primer A and B in combination give
a product of 463 bp for a wild-type allele, and primers A and C give a
product of 292 bp for a mutant allele. The assay is schematically
depicted in Fig 1. PCR was conducted with a
standard mixture including all 3 primers (100 ng DNA, 1× PCR buffer,
2 mmol/L magnesium chloride, 0.2 mmol/L dNTPs, 0.2 µmol/L each
primer, 2.5 U Taq, and ddH2O to 30 µL), under
standard conditions (30 cycles of 60 seconds at 95°C, 60 seconds at
58°C, and 60 seconds at 72°C and 10 minutes at 72°C). PCR
products were visualized by agarose gel electrophoresis on a 1.5% gel
stained with ethidium bromide. Genotyping was then scored by the
presence or absence of appropriate PCR products.
View larger version (47K):
[in this window]
[in a new window]
| Fig 1.
Quantitative PCR assay. (A) Graphical representation of
primer locations relative to the genomic structure of wild-type and
transgenic knockout SV129 mice. Primers A, B, and C were used for PCR
amplification, whereas primer D is for Southern blotting. The border
for the knockout is the EcoRI restriction site. The lower panel
shows a typical PCR reaction using primers A, B, and C in FACKO mutants
(Mut) and heterozgyotes (Het). The wild-type DNA yields a 463-bp PCR
product, and the mutant gives a 292-bp PCR product. (B) Ethidium
bromide-stained gel of standard curve for quantifying DNA contribution.
Wild-type and knockout DNA was mixed in various ratios then subjected
to PCR. This gel would then be Southern-blotted and quantitated as
described.
|
|
Phenotypic analysis of bone marrow from FACKO mice.
Bone marrow was obtained from 8-week-old female mice by flushing the
long bones of mice with Hank's balanced salt solution (HBSS)
supplemented with 3% fetal bovine serum and 10 mmol/L HEPES (pH 7.2).
Five female mutants and 5 heterozygotes each were harvested. Using a
StemSep negative cell selection system (StemCell Technologies Inc,
Vancouver, British Columbia, Canada), cell preparations were enriched
for hematopoietic progenitors. Marrow cells were incubated with a
hematopoietic progenitor enrichment cocktail containing biotinylated
lineage markers for CD5, CD45R (B220), CD11b (Mac-1), Gr-1, and
TER-119, as previously described.27 Colloidal magnetic dextran iron particles were bound to labeled cells using an anti-biotin tetrameric antibody complex and a magnetic column was used to remove
labeled lineage-positive cells. Unfractionated and lineage-depleted marrow was incubated with a panel of lineage marker antibodies, including B220, CD3, Mac-1, Gr-1, and TER-119 (conjugated with either
allophycocyanin [APC] or phycoerythrin [PE]) in
combination with either CD34-APC or c-kit-fluorescein isothiocyanate
(FITC) and Sca-1-PE (Pharmingen, San Diego, CA). Cell preparations were then analyzed with 3-color flow cytometry using a FACSCalibur (Becton
Dickinson, San Jose, CA). Data analysis was performed using
Paint-a-Gate software (Becton Dickinson).
Transplantation.
Bone marrow harvesting and transplantation was performed essentially as
described.28 Mice were anesthetized with tribromoethanol where appropriate. Radioablation of recipient mice was performed by
exposing the recipient animals to 1,100 rad from a 131Cs
source in an evenly split dose 3 hours apart. Transplantation was then
performed within 5 hours on the same day as irradiation. Bone marrow
donors were killed by cervical dislocation, the fur was saturated with
70% alcohol, and the animal was moved into a sterile, laminar flow
hood. Skin and muscle were removed from the hind limbs and the femurs
were removed. The ends of the femurs were cut off and the femur shaft
contents were expelled into a collection tube using a 27-gauge needle
and RPMI 1640 supplemented with antibiotics. Unfractionated marrow
cells were counted using a hemocytometer and the concentration was
adjusted for injection. Cells were then injected into the retroorbital
plexus of anesthetized recipient mice.
Transplant analysis.
Transplanted mice were bled periodically after transplantation and at
treatment. Animals were bled from the retroorbital plexus into heparinized capillary tubes. Blood was then prepared for PCR using
Chelex resin (Bio-Rad Laboratories, Hercules, CA).29 Six
microliters of blood was combined with 1 mL of ddH2O and
incubated at room temperature for 30 minutes. After 2 minutes of
centrifugation, the supernatant was discarded and 200 µL of 5%
Chelex 100 resin was added. The mixture was incubated for 30 minutes at
56°C, vortexed for 10 seconds, boiled for 8 minutes, vortexed again,
and centrifuged to collect the resin at the bottom of the tube. PCR was
performed on 10 µL of samples as described above. After
electrophoresis, the PCR products were bound to Hybond-N+ membrane
(Amersham Life Science Inc, Arlington Heights, IL) by overnight
alkaline capillary transfer. Two picomoles of primer D
(AGTTGGCACCTATGG) was end-labeled (2 pmol primer; 150 µCi -ATP;
2.5 µL 700 mmol/L Tris, pH 7.5, 100 mmol/L MgCl2, 50 mmol/L dithiothreitol [DTT], 1 mmol/L spermidine-HCl, 1 mmol/L EDTA; 10 U T4 polynucleotide kinase; water to 25 µL; incubated
for 60 minutes at 37°C) and used as a probe in a 40% formamide
hybridization buffer. Hybridization was allowed to run a minimum of 6 hours at 42°C; the filter was then washed once in 2×
SSPE, 0.1% sodium dodecyl sulfate (SDS) at room
temperature for 10 minutes. Primer D hybridizes 3' to primer A in a
region of wild-type genomic DNA. The Southern blot was visualized using a Molecular Dynamics Phosphorimager SI (Molecular Dynamics, Sunnyvale, CA) and the intensity of the bands was quantitated using the software IPLab Gel (Signal Analytics Corp, Vienna, VA). The band intensity was
then compared with a standard curve to determine the percentage of
contribution of each allele. Figure 1B is an example of a standard curve. Figures 2D and 4B show examples of electrophoresis
and phosphorimaging data typical of this analysis.
Spleen colony analysis.
A cohort of mice were serially transplanted using original nonablated
recipients as donors. Some animals were killed 12 days posttransplant;
the spleen colonies were excised as closely as possible to the colony
margin, and DNA was isolated. These colonies were then analyzed by
quantitative PCR, as described.
Progenitor culture and analysis.
Unfractionated bone marrow cells (1 × 105) were
cultured in 1 mL of MethoCult H4230 (Stem Cell Technologies),
penicillin-streptomycin (Life Technologies, Rockville,
MD), and 3 recombinant growth factors: human
erythropoietin (2 U/mL; Amgen, Thousand Oaks, CA), murine Steel factor
(10 ng/mL; R&D Systems, Minneapolis, MN), and murine interleukin-3 (10 ng/mL; R&D Systems). CFU-GM and BFU-E were cultured in 35-mm tissue
culture dishes at 37°C in 5% CO2 in air. The colonies in
each dish were counted. Colonies were then picked from the plate, the
cells were pooled and DNA was prepared with Chelex as described, and
quantitative PCR was performed as described.
| |
RESULTS |
To compare the repopulation capacity of wild-type and FACKO bone marrow
cells, we performed 2 sets of experiments. The first set of experiments
was to inject mixes of wild-type and FACKO bone marrow into lethally
irradiated HT1 heterozygote hosts. The second set of experiments
involved injection of wild-type marrow into nonablated FACKO
recipients. In both cases, we also tested the effects of MMC
administration and serial transplantation on the repopulation process.
Competitive repopulation of radio-ablated HT1 heterozygotes.
To test the hypothesis that wild-type cells have a selective advantage
of Fanconi cells, cohorts of 5 mice heterozygous for an HT1 knockout
were irradiated as described and transplanted with a mixture of
wild-type and FACKO marrow in a 1:1 ratio for a total of
106 unfractionated cells. The use of a genetically marked
(HT1 knockout) recipient allowed the unambiguous distinction of all 3 populations of hematopoietic cells in the transplanted mice by simple
PCR genotyping assays. These were the original recipient (HT1
heterozygous, FANCC wild-type), wild-type donors (HT1 wild-type, FANCC
wild-type), and Fanconi donors (HT1 wild-type, FANCC mutant). The mice
were allowed to recover for 3 weeks when they were bled and
subsequently injected intraperitonealy with 10 µg of MMC. The treated
animals were bled subsequently 1 and 2 months after MMC treatment. The relative contribution of the genotypes to peripheral blood DNA was
determined by PCR analysis as described above and the data are shown in
Fig 1. The PCR assay for the HT1 knockout allele was negative in all
cases (data not shown), indicating that only transplanted donor cells
contributed significantly to peripheral blood DNA and that the
irradiation dose had been sufficient for complete bone marrow ablation
of the host. Figure 2A shows
the MMC-treated cohort of animals over the 3-month study. One month after transplantation, this group had an average of approximately 78%
of the peripheral blood cells containing wild-type DNA. After MMC
treatment, 3 of the 5 animals showed a decrease, whereas 2 of 5 showed
an increase in wild-type blood cells in the peripheral circulation. At
3 months posttransplantation, we saw an increase in wild-type blood
cells from the prior month in all subjects. On average, the 3-month
values are not significantly different than the 1-month values. Figure
2B shows the control cohort to Fig 2A. These animals were transplanted
in the same way and bled at the same time, but received no MMC. The
graph shows an initial 1-month value of approximately 80%, a value
very close to the treated cohort. The only difference between the
MMC-treated and untreated cohort was that 3 of the 4 animals showed a
slight decrease in wild-type contribution over the 3-month period of
the experiment. These data indicate that wild-type bone marrow had only
a modest advantage during repopulation (increase from 50% to 80%) and
that the relative contribution of wild-type cells remained stable over 3 months.
View larger version (33K):
[in this window]
[in a new window]
| Fig 2.
Competitive repopulation. A cohort of
mice were radio-ablated and transplanted with a 1:1 mixture of FACKO
and wild-type bone marrow for a total of 1 × 106 cells.
The lines connecting data points indicate the trend of change. (A)
Cohort of mice treated with MMC 1 month posttransplantation and
observed to 3 months posttransplantation. (B) Control mice as in (A),
except with no MMC treatment. (C) Cohort of mice serially transplanted
from an MMC-treated mouse and nontreated control in (B). A through E
and F through J represent transplant recipients from separate donors.
(D) Phosphoimager quantitative data corresponding to the datapoints
after serial transplantation in (C). The high contribution of wild-type
DNA is readily discernible.
|
|
Serial transplantation of competitively repopulated bone marrow.
Peripheral blood DNA was analyzed in the experiments described above
and, therefore, it was not possible to determine whether the observed
modest selective advantage occurred in peripheral blood cells only or
also at the level of HSCs. For this, bone marrow was harvested from a
cohort of the animals repopulated with a 1:1 mix of wild-type and FACKO
marrow and 106 marrow cells were serially transplanted into
lethally irradiated secondary recipients. The analysis is shown in Fig
2C. Serial transplantation considerably enhanced the relative
contribution of wild-type cells to peripheral blood DNA both in
MMC-treated (average, 95.2%) and nontreated animals (average, 84.8%).
This result shows that the selective repopulation advantage of
wild-type cells did indeed occur at the stem cell level and not only in peripheral blood nucleated cells.
Phenotypic analysis of hematopoietic progenitor cells in FACKO mice.
To demonstrate that the results of the competitive repopulation and
serial transplantation studies were not due to a decreased number of
stem cells/progenitor cells in the FACKO mice, we evaluated the
frequency of phenotypically defined cells in the marrow of both FACKO
and wild-type mice (Fig 3). The total bone
marrow cellularity of FACKO mice and +/+ mice was similar, with one
femur containing 2.5 × 107 and 2.1 × 107
total nucleated cells, respectively. Populations of cells that express
low or undetectable levels of lineage-specific markers are known to
contain all HSC activity in the marrow. The frequency of this
lineage-negative cell population was 6.6% in +/+ mice and 6.2% in
FACKO mice. To determine the absolute number of phenotypically defined
progenitor cells in the marrow, we enriched the lineage marker-negative
population using a negative selection technique. This approach is used
to exclude Sca-1-positive T cells and lineage-committed progenitor
cells that continue to express low levels of c-kit as they mature. The
lineage-negative fraction of the marrow from both FACKO mice and the
wild-type mice contained equivalent numbers of CD34+ cells,
Sca-1+ cells, and c-kit+ cells (Fig 3B). These
results demonstrate that the decreased competitive repopulation
activity and serial transplantation activity in the marrow of FACKO
mice is not due to a decreased frequency of phenotypically defined HSCs
or progenitor cells.
View larger version (43K):
[in this window]
[in a new window]
| Fig 3.
Phenotypic analysis of hematopoietic progenitor cells in
heterozygous and FACKO mice. The bone marrow of wild type (+/+) and
FACKO ( /) mice (n = 5 animals per group) was analyzed for the
presence of phenotypically defined HSC/progenitor cells. (A) Flow
cytometric analysis of unfractionated marrow from wild type (a) and
FACKO (b) mice. The percentage of lineage-negative cells is indicated
(black dots). The frequency of lineage-negative cells after lineage
depletion and incubation with antibodies to CD34 is shown in (c) and
(d). The percentage of lineage-negative cells is shown (black dots).
The expression of c-kit and Sca-1 on gated lineage-negative marrow
cells is indicated in (e) and (f). The percentage of
c-kit+, Sca-1+ cells is shown in the upper
right quadrant, and the percentage of c-kit+,
Sca-1 cells is shown in the lower right quadrant. (B)
The total number of phenotypically defined cells per femur in wild type
( ) and FACKO ( ) mice is indicated on a log scale.
|
|
Transplantation of wild-type marrow into nonablated FACKO mice.
The selective advantage for wild-type cells observed in the competitive
repopulation experiments described above raised the possibility that
positive selection may be achievable even in nonirradiated FACKO
recipients. Therefore, a cohort of 5 FACKO mice were used as recipients
of 106 unfractionated wild-type marrow without prior
ablation. After a 1-month recovery period, all 5 were bled to obtain
baseline values, and then 4 mice received 10 µg MMC
intraperitoneally. No adverse effects (death, weight loss, or malaise)
were observed after treatment. One month after MMC, the 4 treated
animals and 1 control were bled again and the blood was analyzed by
quantitative PCR (Fig 4A and B). The
detection limit for wild-type DNA in our quantitative assay was 1% of
total DNA, and at this level of sensitivity, no wild-type DNA could be
detected in any of the 5 animals before MMC injection. After MMC
treatment, wild-type DNA remained undetectable in the control animal,
whereas it increased to between 28% and 42% of total DNA in the
treated cohort. The degree of wild-type contribution was observed to 8 months after MMC treatment and remained stable. This experiment was
repeated independently with 10 FACKO mice (5 controls and 5 MMC
treated) and the results were the same. About 30% of peripheral blood
DNA was wild-type in MMC-treated mice (data not shown), but no
wild-type DNA was found in the controls. The animals from this repeat
experiment were used for serial transplantation as described below.
View larger version (15K):
[in this window]
[in a new window]
| Fig 4.
Repopulation in nonablated FACKO mice. (A) A cohort of
FACKO mice were injected with 1 × 106 unfractionated
wild-type cells. Mice A, B, C, and D were treated with a single
intraperitoneal injection of 10 µg MMC. Mouse E was untreated. The
lines connecting data points indicate the trend of change. (B)
Phosphoimager data corresponding the data in (A) before and after (+)
MMC treatment. (C) Wild-type recipients were radio-ablated and
transplanted with bone marrow cells from a treated nonablated
transplant recipient (1, 2, and 3) or from an untreated nonablated
transplant recipient (4, 5, 6, and 7).
|
|
Serial transplantation of marrow from FACKO mice transplanted with
wild-type cells.
Several assays were performed to show that the positive selection
observed occurred at the level of the hematopoietic stem cell. Bone
marrow from 2 randomly selected treated and nontreated transplanted
FACKO mice was serially transplanted into lethally irradiated secondary
congenic recipients. At the time of marrow harvest, an aliquot of bone
marrow was used to establish CFU-GM and BFU-E colonies. No differences
between MMC-treated mice and controls were observed in the absolute
numbers of BFU-E and CFU-GM colonies (data not shown). After 2 weeks in
culture, DNA was isolated from pooled colonies and analyzed by PCR
genotyping. In 2 independent experiments, more than 98% of BFU-E and
CFU-GM DNA was of wild-type origin in MMC-treated mice. Interestingly,
wild-type DNA was also readily detectable at approximately 25% in
colonies derived from nontreated mice. Thus, positive selection for
wild-type cells occurred not only in peripheral blood nucleated cells,
but also in early progenitors.
The secondary recipients of the serial transplants were analyzed in 2 different ways. First, day-12 spleen colonies were isolated and
genotyped from 3 secondary recipients each. Second, the peripheral blood of secondary recipients was analyzed 1 and 2 months after transplantation. Seventeen of 17 (100%) of the day-12 CFU-S from MMC-treated mice were of wild-type origin. Similarly, more than 80% of
peripheral blood DNA was wild-type derived in repopulated secondary
recipients (Fig 4C). In contrast, only 1 of 14 (7%) CFU-S colonies
from the control animals was wild-type. Taken together, these results
provide strong support for selection of the level of the hematopoietic
stem cell itself. Interestingly, after serial transplantation, positive
selection was also observed without MMC treatment. The contribution of
wild-type DNA increased from undetectable to approximately 20% (Fig
4C).
| |
DISCUSSION |
The findings described here have implications regarding the
pathophysiology of FA as well as its treatment by bone marrow transplantation and gene therapy. Our experiments show that the hematopoietic stem cells of FACKO mice have repopulation capacity only
slightly lower than those of wild-type controls. Despite the
considerable number of cell doublings required for complete marrow
repopulation with only 1 × 106 donor cells, the average
ratio of wild-type to mutant cells only increased from 0.5 to 0.78. Furthermore, this ratio remained stable for many months once
repopulation had occurred, indicating that selection for wild-type HSCs
was minimal under normal marrow turnover conditions. These results
obtained in our animal model of FA are consistent with observations in
human FA patients in which the time for development of clinical anemia
is highly variable and can be several years, even decades.3
Thus, bone marrow repopulation with healthy cells is unlikely to occur
spontaneously, even in the presence of wild-type HSCs generated by
mitotic recombination. Despite the only modest growth advantage during
normal bone marrow renewal, situations demanding many rounds of cell
doubling, such as serial transplantation, eventually lead to
significant selection for wild-type cells. It is possible that
hematopoietic cells from FACKO mice become progressively less able to
repopulate with increasing age or increasing number of cell doublings,
ie, age more rapidly. The effects of age and number of cell divisions
on the ability of FACKO HSCs to compete for marrow repopulation was not
addressed in the current study and will be the subject of future experimentation.
Whereas wild-type cells were only modestly selected under normal
conditions, the selection was strong and rapid when direct selective
pressure in the form of MMC treatment was applied. Under these
conditions, even a very small number of wild-type HSCs was able to
significantly repopulate the hematopoietic system of FACKO mice without
any prior irradiation. Direct exposure to DNA cross-linking drugs is an
unlikely occurrence and is not likely to be responsible for the gradual
decrease in bone marrow function seen in human patients with FA.
However, FA cells are known to be sensitive to other compounds as well
as DNA cross-linkers, especially the mitotic inhibitor
interferon-.23,25 Other cytokines (tumor necrosis
factor- and macrophage inflammatory protein-1
[MIP-1]) have recently been added to this
list.30 Thus, the physiologic selection agent damaging the
hematopoietic system in human FA patients may be these cytokines that
are frequently released in response to viral infections. Frequent
exposure to viral infections or other selection events may allow the
emergence of revertant hematopoietic stem cells or clones of committed
progenitors (eg, T-cell progenitors), as is seen in human FA patients.
In most genetic disorders, hematopoietic gene therapy would require
correction of a large percentage of cells to be clinically effective.
For this reason, gene transfer has been combined with bone marrow
ablation in successful animal experiments.28,31,32 An
alternative approach would be to use in vivo selection for genetically
transduced cells to avoid ablation. The strong selection for wild-type
cells under MMC selection could potentially be exploited for practical
applications in the treatment of FA, especially gene
therapy. MMC was exquisitely and selectively toxic to hematopoietic cells, and no adverse effects to other organ systems were observed. This is likely to also be true in human FA patients, as suggested by
the clinical experience with another cross-linking drug,
cyclophosphamide.33 FA patients are very sensitive to this
alkylating agent, but a dose that is selectively toxic to the bone
marrow can be found and used in preparation for bone marrow
transplantation. Thus, it is conceivable that in vivo selection could
be used to enhance gene therapy FA. After ex vivo correction by gene
therapy, a cohort of HSCs from an FA patient could be autologously
transplanted back into the patient. After this, a selective drug, such
as MMC, cytoxan, or possibly interferon-, would be used to expand
the genetically corrected HSCs to clinically meaningful levels.
Certainly the immediate enrichment to greater than 25% of peripheral
blood cells as seen in our experiments is encouraging in this regard. Others have recently reported similar levels of enrichment in preclinical gene therapy experiments using dehydrofolate reductase as a
selectable marker and, as selection, the drug trimetrexate together
with nucleoside transport inhibitor
nitrobenzylmercapto-purine riboside monophosphate.34 In FA,
the biology of the disease favors selection of corrected cells. The
lack of in vivo selection for corrected cells in the FANCC human gene
therapy trials performed at National Institutes of Health35
underscores the notion that selection occurs only very slowly or not at
all without the use of specific selective pressure. Thus, it is likely
that effective hematopoietic gene therapy for FA will not require
complete bone marrow ablation by irradiation, but would require
administration of a selective regimen. Ideally, future research in
animal models will identify nongenotoxic compounds such as cytokines
for this purpose.
The reported experiments are also interesting from the standpoint of
transplantation biology. Previous reports have shown that significant
repopulation of nonablated syngeneic recipients can be achieved with
extremely high doses of donor cells.36,37 Our experiment
demonstrated that engraftment occurs even with low numbers of donor
cells in FACKO mice and that the engrafted cells persisted for 4 weeks or more. In all cases, MMC was administered at least 4 weeks
after transplantation, and in all cases, wild-type cells were
nonetheless found after selection.
MMC selection was much less effective in the competitive repopulation
experiments than in the nonablated FACKO mice. We currently do not have
a definitive explanation for this observation, but it can be
hypothesized that selection worked better in the FACKO environment
because of indirect effects of MMC on that environment. All competitive
repopulation experiments were performed in wild-type recipients. This
hypothesis will be tested directly in future experiments comparing
FACKO and wild-type as recipients.
| |
FOOTNOTES |
Submitted January 18, 1999; accepted May 20, 1999.
Supported by NHLBI Program Project Grant No. 1PO1HL48546 to M.G. and
G.B. and by NRSA award 1F32HL09862 through the NHLBI to K.P.B.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Markus Grompe, MD, Department of Molecular
and Medical Genetics, L103, 3181 SW Sam Jackson Rd, Portland, OR 97201.
| |
REFERENCES |
1.
Fanconi G:
Familial constitutional panmyelocytopathy, Fanconi's anemia (F.A.) 1. Clinical aspects.
Semin Hematol
4:233, 1967[Medline]
[Order article via Infotrieve]
2.
Glanz A, Fraser FC:
Spectrum of anomalies in Fanconi anaemia.
J Med Genet
19:412, 1982[Abstract/Free Full Text]
3.
Alter BP:
Fanconi's anaemia and its variability.
Br J Haematol
85:9, 1993[Medline]
[Order article via Infotrieve]
4.
Joenje H, Oostra AB, Wijker M, di Summa FM, van Berkel CG, Rooimans MA, Ebell W, van Weel M, Pronk JC, Buchwald M, Arwert F:
Evidence for at least eight Fanconi anemia genes.
Am J Hum Genet
61:940, 1997[Medline]
[Order article via Infotrieve]
5.
Strathdee CA, Duncan AM, Buchwald M:
Evidence for at least four Fanconi anaemia genes including FACC on chromosome 9.
Nat Genet
1:196, 1992[Medline]
[Order article via Infotrieve]
6.
Moustacchi E, Papadopoulo D, Diatloff-Zito C, Buchwald M:
Two complementation groups of Fanconi's anemia differ in their phenotypic response to a DNA-crosslinking treatment.
Hum Genet
75:45, 1987[Medline]
[Order article via Infotrieve]
7.
Duckworth-Rysiecki G, Cornish K, Clarke CA, Buchwald M:
Identification of two complementation groups in Fanconi anemia.
Somatic Cell Mol Genet
11:35, 1985[Medline]
[Order article via Infotrieve]
8.
de Winter JP, Waisfisz Q, Rooimans MA, van Berkel CGM, Bosnoyan-Collins L, Alon N, Carreau M, Bender O, Demuth I, Schindler D, Pronk JC, Arwert F, Hoehn H, Digweek M, Buchwald M, Joenje H:
The Fanconi anaemia group G gene FANCG is identical with XRCC9.
Nat Genet
20:281, 1998[Medline]
[Order article via Infotrieve]
9.
Consortium FABC:
Positional cloning of the Fanconi anaemia group A gene.
Nat Genet
14:324, 1996[Medline]
[Order article via Infotrieve]
10.
Lo Ten Foe JR, Rooimans MA, Bosnoyan-Collins L, Alon N, Wijker M, Parker L, Lightfoot J, Carreau M, Callen DF, Savoia A, Cheng NC, van Berkel CG, Strunk MH, Gille JJ, Pals G, Kruyt FA, Pronk JC, Arwert F, Buchwald M, Joenje H:
Expression cloning of a cDNA for the major Fanconi anaemia gene, FAA.
Nat Genet
14:488, 1996[Medline]
[Order article via Infotrieve]
11.
Strathdee CA, Gavish H, Shannon WR, Buchwald M:
Cloning of cDNAs for Fanconi's anaemia by functional complementation.
Nature
356:763, 1992[Medline]
[Order article via Infotrieve] (erratum 358:434, 1992)
12.
D'Andrea AD, Grompe M:
Molecular biology of Fanconi anemia: Implications for diagnosis and therapy.
Blood
90:1725, 1997[Free Full Text]
13.
Auerbach AD, Allen RG:
Leukemia and preleukemia in Fanconi anemia patients. A review of the literature and report of the International Fanconi Anemia Registry.
Cancer Genet Cytogenet
51:1, 1991[Medline]
[Order article via Infotrieve]
14.
Swift MR, Hirschhorn K:
Fanconi anemia.
Ann Intern Med
65:496, 1971
15.
Auerbach AD, Min Z, Ghosh R, Pergament E, Verlinsky Y, Nicolas H, Boue J:
Clastogen-induced chromosomal breakage as a marker for first trimester prenatal diagnosis of Fanconi anemia.
Hum Genet
73:86, 1986[Medline]
[Order article via Infotrieve]
16.
Gluckman E, Auerbach AD, Horowitz MM, Sobocinski KA, Ash RC, Bortin MM, Butturini A, Camitta BM, Champlin RE, Friedrich W:
Bone marrow transplantation for Fanconi anemia.
Blood
86:2856, 1995[Abstract/Free Full Text]
17.
Hows JM:
Unrelated donor bone marrow transplantation for severe aplastic anaemia and Fanconi's anaemia.
Bone Marrow Transplant
4:126, 1989
18.
Liu JM, Buchwald M, Walsh CE, Young NS:
Fanconi anemia and novel strategies for therapy.
Blood
84:3995, 1994[Free Full Text]
19.
Culliton BJ:
Gene therapy begins.
Science
249:1372, 1990[Free Full Text]
20.
Lo Ten Foe JR, Kwee ML, Rooimans MA, Oostra AB, Veerman AJ, van Weel M, Pauli RM, Shahidi NT, Dokal I, Roberts I, Altay C, Gluckman E, Gibson RA, Mathew CG, Arwert F, Joenje H:
Somatic mosaicism in Fanconi anemia: Molecular basis and clinical significance.
Eur J Hum Genet
5:137, 1997[Medline]
[Order article via Infotrieve]
21.
Hirschhorn R, Yang DR, Puck JM, Huie ML, Jiang CK, Kurlandsky LE:
Spontaneous in vivo reversion to normal of an inherited mutation in a patient with adenosine deaminase deficiency.
Nat Genet
13:290, 1996[Medline]
[Order article via Infotrieve]
22.
Ellis NA, Lennon DJ, Proytcheva M, Alhadeff B, Henderson EE, German J:
Somatic intragenic recombination within the mutated locus BLM can correct the high sister-chromatid exchange phenotype of Bloom syndrome cells.
Am J Hum Genet
57:1019, 1995[Medline]
[Order article via Infotrieve]
23.
Whitney MA, Royle G, Low MJ, Kelly MA, Axthelm MK, Reifsteck C, Olson S, Braun RE, Heinrich MC, Rathbun RK, Bagby GC, Grompe M:
Germ cell defects and hematopoietic hypersensitivity to gamma-interferon in mice with a targeted disruption of the Fanconi anemia C gene.
Blood
88:49, 1996[Abstract/Free Full Text]
24.
Chen M, Tomkins DJ, Auerbach W, McKerlie C, Youssoufian H, Liu L, Gan O, Carreau M, Auerbach A, Groves T, Guidos CJ, Freedman MH, Cross J, Percy DH, Dick JE, Joyner AL, Buchwald M:
Inactivation of Fac in mice produces inducible chromosomal instability and reduced fertility reminiscent of Fanconi anaemia.
Nat Genet
12:448, 1996[Medline]
[Order article via Infotrieve]
25.
Rathbun RK, Faulkner GR, Ostroski MH, Christianson TA, Hughes G, Jones G, Cahn R, Maziarz R, Royle G, Keeble W, Heinrich MC, Grompe M, Tower PA, Bagby GC:
Inactivation of the Fanconi anemia group C gene augments interferon-gamma-induced apoptotic responses in hematopoietic cells.
Blood
90:974, 1997[Abstract/Free Full Text]
26.
Grompe M, Al-Dhalimy M, Finegold M, Ou CN, Burlingame T, Kennaway NG, Soriano P:
Loss of fumarylacetoacetate hydrolase is responsible for the neonatal hepatic dysfunction phenotype of lethal albino, mice.
Genes Dev
7:2298, 1993[Abstract/Free Full Text]
27.
Archer DR, Turner CW, Yeager AM, Fleming WH:
Sustained multilineage engraftment of allogeneic hematopoietic stem cells in NOD/SCID mice after in utero transplantation.
Blood
90:3222, 1997[Abstract/Free Full Text]
28.
Belmont JW, Jurecic R:
Methods for efficient retrovirus-mediated gene transfer to mouse hematopoietic stem cells, in
Robbins P
(ed):
Methods in Molecular Medicine, Gene Therapy Protocols. Totowa, NJ, Humana, 1996, p 223.
29.
Walsh PS, Metzger DA, Higuchi R:
Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material.
Biotechniques
10:506, 1991[Medline]
[Order article via Infotrieve]
30.
Haneline LS, Broxmeyer HE, Cooper S, Hangoc G, Carreau M, Buchwald M, Clapp DW:
Multiple inhibitory cytokines induce deregulated progenitor growth and apoptosis in hematopoietic cells from Fac/ mice.
Blood
91:4092, 1998[Abstract/Free Full Text]
31.
Kohn DB:
Gene therapy for hematopoietic and immune disorders.
Bone Marrow Transplant
18:S55, 1996 (suppl 3)
32.
Clapp DW:
Somatic gene therapy into hematopoietic cells. Current status and future implications.
Clin Perinatol
20:155, 1993[Medline]
[Order article via Infotrieve]
33.
Socie G, Gluckman E, Raynal B, Petit T, Landman J, Devergie A, Brison O:
Bone marrow transplantation for Fanconi anemia using low-dose cyclophosphamide/thoracoabdominal irradiation as conditioning regimen: Chimerism study by the polymerase chain reaction.
Blood
82:2249, 1993[Abstract/Free Full Text]
34.
Allay JA, Persons DA, Galipeau J, Riberdy JM, Ashmun RA, Blakley RL, Sorrentino BP:
In vivo selection of retrovirally transduced hematopoietic stem cells.
Nat Med
4:1136, 1998[Medline]
[Order article via Infotrieve]
35.
Liu JM, Young NS, Walsh CE, Cottler-Fox M, Carter C, Dunbar C, Barrett AJ, Emmons R:
Retroviral mediated gene transfer of the Fanconi anemia complementation group C gene to hematopoietic progenitors of group C patients.
Hum Gene Ther
8:1715, 1997[Medline]
[Order article via Infotrieve]
36.
Nilsson SK, Dooner MS, Tiarks CY, Weier HU, Quesenberry PJ:
Potential and distribution of transplanted hematopoietic stem cells in a nonablated mouse model.
Blood
89:4013, 1997[Abstract/Free Full Text]
37.
Rao SS, Peters SO, Crittenden RB, Stewart FM, Ramshaw HS, Quesenberry PJ:
Stem cell transplantation in the normal nonmyeloablated host: Relationship between cell dose, schedule, and engraftment.
Exp Hematol
25:114, 1997[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
P. Rio, N. W. Meza, A. Gonzalez-Murillo, S. Navarro, L. Alvarez, J. Surralles, M. Castella, G. Guenechea, J. C. Segovia, H. Hanenberg, et al.
In vivo proliferation advantage of genetically corrected hematopoietic stem cells in a mouse model of Fanconi anemia FA-D1
Blood,
December 15, 2008;
112(13):
4853 - 4861.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Q.-S. Zhang, L. Eaton, E. R. Snyder, S. Houghtaling, J. B. Mitchell, M. Finegold, C. Van Waes, and M. Grompe
Tempol Protects against Oxidative Damage and Delays Epithelial Tumor Onset in Fanconi Anemia Mice
Cancer Res.,
March 1, 2008;
68(5):
1601 - 1608.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Z. Rizvi, J. R. Swain, P. S. Davies, A. S. Bailey, A. D. Decker, H. Willenbring, M. Grompe, W. H. Fleming, and M. H. Wong
Bone marrow-derived cells fuse with normal and transformed intestinal stem cells
PNAS,
April 18, 2006;
103(16):
6321 - 6325.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Mankad, T. Taniguchi, B. Cox, Y. Akkari, R. K. Rathbun, L. Lucas, G. Bagby, S. Olson, A. D'Andrea, and M. Grompe
Natural gene therapy in monozygotic twins with Fanconi anemia
Blood,
April 15, 2006;
107(8):
3084 - 3090.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
X. Li, Y. Yang, J. Yuan, P. Hong, B. Freie, A. Orazi, L. S. Haneline, and D. W. Clapp
Continuous in vivo infusion of interferon-gamma (IFN-{gamma}) preferentially reduces myeloid progenitor numbers and enhances engraftment of syngeneic wild-type cells in Fancc-/- mice
Blood,
August 15, 2004;
104(4):
1204 - 1209.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. S. McCauslin, J. Wine, L. Cheng, K. D. Klarmann, F. Candotti, P. A. Clausen, S. E. Spence, and J. R. Keller
In vivo retroviral gene transfer by direct intrafemoral injection results in correction of the SCID phenotype in Jak3 knock-out animals
Blood,
August 1, 2003;
102(3):
843 - 848.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
X. Wang, S. Ge, G. McNamara, Q.-L. Hao, G. M. Crooks, and J. A. Nolta
Albumin-expressing hepatocyte-like cells develop in the livers of immune-deficient mice that received transplants of highly purified human hematopoietic stem cells
Blood,
May 15, 2003;
101(10):
4201 - 4208.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Galimi, M. Noll, Y. Kanazawa, T. Lax, C. Chen, M. Grompe, and I. M. Verma
Gene therapy of Fanconi anemia: preclinical efficacy using lentiviral vectors
Blood,
September 26, 2002;
100(8):
2732 - 2736.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Yang, Y. Kuang, R. M. De Oca, T. Hays, L. Moreau, N. Lu, B. Seed, and A. D. D'Andrea
Targeted disruption of the murine Fanconi anemia gene, Fancg/Xrcc9
Blood,
December 1, 2001;
98(12):
3435 - 3440.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. M. Croop, R. Cooper, C. Fernandez, V. Graves, S. Kreissman, H. Hanenberg, F. O. Smith, and D. A. Williams
Mobilization and collection of peripheral blood CD34+ cells from patients with Fanconi anemia
Blood,
November 15, 2001;
98(10):
2917 - 2921.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION