|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, Vol. 94 No. 7 (October 1), 1999:
pp. 2310-2318
By
From The Burnham Institute, La Jolla, CA; the Department of
Immunology, The Scripps Research Institute, La Jolla, CA; Vical, Inc,
San Diego,CA; and Chiron Technologies Center for Gene Therapy, San
Diego, CA.
PU.1 is a hematopoietic cell-specific ets family transcription
factor. Gene disruption of PU.1 results in a cell autonomous defect in
hematopoietic progenitor cells that manifests as abnormal myeloid and
B-lymphoid development. Of the myeloid lineages, no mature macrophages
develop, and the neutrophils that develop are aberrantly and
incompletely matured. One of the documented abnormalities of PU.1 null
(deficient) hematopoietic cells is a failure to express receptors for
granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage (GM)-CSF, and M-CSF. To elucidate the roles of the myeloid growth factor receptors in myeloid cell differentiation, and to distinguish their role from that of PU.1, we have restored expression of the G- and
M-CSF receptors in PU.1-deficient cells using retroviral vectors. We
have similarly expressed PU.1 in these cells. Whereas expression of
growth factor receptors merely allows a PU.1-deficient cell line to
survive and grow in the relevant growth factor, expression of PU.1
enables the development of F4/80+,
Mac-1+/CD11b+ macrophages, expression of
gp91phox and generation of superoxide, and
expression of secondary granule genes for neutrophil collagenase and
gelatinase. These studies reinforce the idea that availability of PU.1
is crucial for normal myeloid development and clarify some of the
molecular events in developing neutrophils and macrophages that are
critically dependent on PU.1.
THE ETS FAMILY transcription factor PU.1
is expressed exclusively in hematopoietic cells. Evidence from PU.1
gene-disrupted mice indicates a pivotal role for PU.1 in myeloid
lineage (as well as B-lymphocyte) development. To summarize the PU.1
null phenotype, leukocytes are absent at birth in these mice, but low numbers of neutrophils eventually develop by 2 to 3 days, and T
lymphocytes by 5 to 8 days, after birth. Mature monocytes/macrophages and B cells are not detectable in these mice at any age examined, up to
2 weeks.1 The defect in PU.1 null hematopoietic progenitors is cell autonomous and may be due, at least in part, to their failure
to express receptors for the myeloid growth factors granulocyte colony-stimulating factor (G-CSF), macrophage (M)-CSF, and
GM-CSF.2 Currently there is still debate as to the specific
role of these receptors in hematopoietic cell survival, proliferation,
and differentiation, and it is not clear whether the absence of
receptors can account for the hematopoietic deficits seen in the PU.1
null mouse. It is possible and indeed likely that nonexpression or
dysregulation of other key genes that are regulated by PU.1 contributes
to the abnormal myeloid development in these gene-disrupted mice.
Because PU.1-deficient cells fail to express myeloid growth factor
receptors, they represent a useful vehicle for elucidating the distinct
functions served by these receptors in hematopoietic cell expansion and
development. Therefore, we reintroduced PU.1, G-CSF receptor, and M-CSF
receptor into an established PU.1-deficient myeloid cell line,
503.3 We observed in PU.1 restored myeloid cells the
expression of genes and acquisition of functions associated with normal
terminal neutrophil maturation that were absent from PU.1-deficient
cells. In addition, restoration of PU.1 expression in these cells
enabled the development of F4/80+, Mac-1/CD11b+
cells (monocytes and macrophages), whereas previously only
Gr-1+, CAE+ cells (neutrophils) were
generated.3 Furthermore, PU.1 transduction restored the
ability of these cells to grow in the presence of G-and M-CSF. Unlike
cells transduced with a PU.1-expressing vector, those transduced with
the G-CSF receptor showed no detectable change in surface-marker
phenotype (other than expression of G-CSF receptor), gene expression,
or functional capacity to suggest terminal differentiation or
maturation of these cells beyond the point that we have described to
occur in PU.1 null neutrophils.3 Similarly, transduction
with the M-CSF receptor allowed the cells to use M-CSF for survival and
growth with no apparent progression of differentiation along the
monocyte/macrophage pathway.
These results support the concept of a permissive but not an inductive
or instructive role for growth factor receptors in myeloid cell
development. In contrast, PU.1 can regulate the expression of molecules
associated with cell differentiation. The results obtained from these
studies suggest that normal components of myeloid cells and neutrophils
can be restored and distinct differentiation pathways enabled even when
PU.1 is reintroduced at a relatively late stage of myeloid development,
as shown by the PU.1 null cell line that was used in these experiments.
The PU.1 null cell line 503.
The myeloid cell line 503 was originally derived from PU.1 null
neonatal liver as described3 and was used for PU.1 and G-
and M-CSF receptor restoration studies. These cells are maintained in
Iscove's medium supplemented with 20% fetal bovine serum with 100 U/mL recombinant mouse (rm) interleukin-3 (IL-3), 5 ng/mL rmGM-CSF, 5 ng/mL rmG-CSF, and 5,000 U/mL recombinant human (rh) M-CSF. Previous
work has shown that the cells will only respond to IL-3,2,3
but they are maintained in all factors for experimental consistency and
comparison with normal cells.
Construction of retroviral plasmids.
Pfu polymerase (Stratagene, San Diego, CA) was used for high-fidelity
polymerase chain reaction (PCR) amplification of cDNAs encoding PU.1
and the G-CSF receptor. The complete coding region of PU.1 (nucleotides
132 to 1000, GenBank accession no. M32370) and the G-CSF receptor
coding region (nucleotides 180 to 2691, GenBank accession no. M58288)
was amplified from a mixed population of mouse bone marrow myeloid
cells obtained after activation in IL-3, G-, and GM-CSF. The 5'
and 3' amplimers introduced a NotI cloning site at each
end and the 5' primer also includes a Kozak consensus
translational initiation sequence.4 PCR fragments were
cloned into pCR-script (Stratagene) and verified by sequencing. cDNAs
were excised with NotI and cloned into the SrfI site of retroviral vector pBA8b-L1 (Chiron Corp, San Diego, CA). The plasmid pBA8b-L1 was constructed in a 3-fragment ligation using the following 3 fragments: (1) The NdeI-ClaI fragment from pBA-5b
(described in Patent Cooperative Treaty [PCT]
application no. WO9742338), containing the 3' long terminal
repeat (LTR) and the pUC18 backbone; (2) the
ClaI-HindIII fragment from pCI-PLAP (the cDNA encoding human Placental Alkaline Phosphatase
[PLAP]5 inserted into the pCI cytomegalovirus (CMV)
expression plasmid (Invitrogen Inc, San Diego, CA); and (3) the
HindIII-NdeI fragment from pBA-6bL1, containing the
5' LTR and the SV40 promoter. Plasmid pBA-6bL1 is based on pBA-6b
(described in example 10 of patent application WO 9742338), where the
HIVenv/rev-coding region was deleted via XhoI-ClaI
digestion and replaced with the L1 polylinker.
Retroviral infection of PU.1-deficient cells.
The 293-based amphotropic packaging line 2A-LB (patent application WO
no. 9742338) was maintained in Dulbecco's modified Eagle's medium
(DMEM) plus 10% fetal calf serum (FCS) and 2 mmol/L L-glutamine. Vector-producing cell lines (VPCL) were made by cotransfecting the
plasmid pMLG-G encoding vesicular stomatitis virus glycoprotein (VSV-G)7 along with plasmids containing gene of interest
into 293 2-3 cells7 to generate transient VSV-G-pseudotyped
vectors that were then used to transduce the human 293-based
amphotropic packaging cell line, 2A-LB. The resulting pool of vector
producing cells were enriched for PLAP-expressing cells using anti-PLAP antibody (Sigma, St Louis, MO) and magnetic beads (Miltenyi Biotec Inc,
Auburn, CA). To produce virus-containing supernatants,
PLAP+ cells were grown to confluency, fresh medium was
added, and supernatants were collected 24 and 48 hours later. Viral
titers were determined by infection of HT1080 cells using a series of
dilutions of the vector in the presence of 8 µg/mL polybrene and
scoring the number of PLAP+ colonies 48 hours later.
Briefly, the infected HT1080 cells were fixed in phosphate-buffered
saline (PBS) containing 2% formaldehyde and 0.2% glutaraldehyde and
stained with the alkaline phosphatase substrate Fast Red TR/Napthol
AS-MX phosphate (Sigma) as directed by the manufacturer. Titer
(colony-forming units [CFU])/mL was calculated as [No. Red
Colonies/µL Vector Added] × Dilution Factor × 1,000. Typical supernatants used contained 0.5 to 1.0 × 106
CFU/mL.
Selection of transduced cells and flow cytometric analysis.
Forty-eight hours after the last transduction (5 days after
the first transduction), an aliquot of cells was removed and stained with an anti-human alkaline phosphatase (PLAP) antibody (Sigma) followed by a phycoerythrin-conjugated secondary donkey anti-mouse antibody (Jackson ImmunoResearch Laboratories, West Grove, PA) to
determine transduction efficiency. Cells were then analyzed for
alkaline phosphatase expression by flow cytometry with a Becton Dickinson FACScan and data were analyzed with CellQuest (Becton Dickinson, Franklin Lakes, NJ). For assessment of Gr-1 and
Mac-1 expression, cells were incubated with Gr-1PE and
Mac-1/CD11bFITC at concentrations recommended by the
manufacturer (Pharmingen, San Diego, CA), and washed and analyzed as
previously described.1
Isolation of RNA and reverse transcription (RT)-PCR analysis.
Total RNA was isolated and PCR was performed as described
previously.3 PCR primers used herein included the following
(listed 5' Enzyme histochemistry and immunohistochemistry.
Methods for immunostaining of cytospin slides for F4/80 and CD11b were
as described.1 Sialoadhesin antibody was obtained from
Serotec Inc (Raleigh, NC) and used at 1:25 dilution.
Modified colony-forming assays.
Cells were seeded at 500 cells/mL in Methocult 3234 (Stem Cell
Technologies, Vancouver, BC, Canada) which was supplemented with either
10 ng/mL rmG-CSF (R&D Systems, Minneapolis, MN) or 5,000 U/mL rhM-CSF
(gift of Dr David Hume, University of Queensland, Brisbane,
Australia). Colony formation (50 or more cells) was scored
after 7 days.
Western blotting.
Detection of proteins by Western blot was performed as
described.3 Polyclonal anti-PU.1 and anti-G-CSF receptor
antibodies and secondary antibody were obtained from Santa Cruz
Biotechnology (Santa Cruz, CA).
Cytochrome c reduction assay for superoxide generation.
Cells were assayed for their ability to reduce cytochrome c exactly as
described.3
Expression of PU.1 in PU.1-deficient cells restores expression of G-
and M-CSF receptors and restores response to G- and M-CSF.
PU.1 regulation of the G- and M-CSF receptor promoters in transfection
assays has previously been reported,10,11 and we have shown
that PU.1-deficient cells fail to express receptors for G- and
M-CSF.2 PU.1-deficient hematopoietic cells will grow in the
presence of IL-3 but not in G-CSF or M-CSF, further confirming the
absence of selective receptor function.2 The PU.1 null
myeloid cell line 503 was originally derived from PU.1 null neonatal
liver as described.3 The phenotype of this cell line is
very similar to cells that can be expanded in short-term (<1 month)
cultures of PU.1 null neonatal liver. Most cells are CAE+
(90%) and CD18+ (80%), with approximately 40% to 60%
Gr-1+, and <3% CD11b+ 1,3 (and
data not shown). Our previous work has shown that these cells express
markers consistent with developing neutrophils, but fail to express
markers and functions of terminally differentiated neutrophils.3 503 cells exhibit a 10% frequency of colony
formation in semisolid media containing IL-3; thus, these cultures
consist of a progenitor-type cell in addition to more differentiated, neutrophil-like progeny. Therefore, 503 cells should be useful for the
investigation of PU.1-mediated growth factor regulation and myeloid differentiation.
Gene expression consistent with neutrophil terminal differentiation
is seen after restoration of PU.1 expression to PU.1-deficient myeloid
cells.
The late stages of neutrophil differentiation are characterized by the
appearance of secondary or specific granule gene products. These genes
are believed to be coordinately regulated, and are transcribed in a
stage-specific manner at the myelocyte stage of
development.12-14 We have shown that the PU.1 null
neutrophil-like cells that develop, both in vivo and in vitro, do not
express detectable mRNA for secondary granule components.3
When PLAP+ 503-PU cells were examined using RT-PCR, we were
able to detect mRNA for the secondary granule genes neutrophil
collagenase and neutrophil gelatinase, whereas no mRNA was found in the
parental cell line (Fig 3) or in G-CSF
receptor-transduced 503 cells (503-GR) (Fig 3 and data not shown).
PU.1 transduction restores gp91phox expression and
superoxide production in PU.1-deficient 503 cells.
We previously documented that PU.1 null myeloid cells failed to
transcribe the gp91phox gene, which encodes a major
subunit of the enzyme NADPH oxidase, and also failed to generate the
metabolite superoxide (O2
G-CSF receptor expression enables PU.1-deficient myeloid cells to
survive and proliferate without further differentiation in G-CSF.
Our previous studies have shown that neutrophil development proceeds in
the absence of PU.1 and the accompanying lack of detectable G-CSF
receptor expression. The number of neutrophils that develop in vivo is
severely reduced, however, and the cells that develop in vivo and in
vitro are abnormal in their surface marker and functional
profile.1-3 As shown above, PU.1 restoration in 503 cells
leads to the expression of genes and functions associated with mature
neutrophils. To attempt to distinguish the contribution of the G-CSF
receptor to neutrophil development from the contribution of PU.1, we
transduced PU.1-deficient 503 cells with the retroviral vector
pBA8b-L1.GR as discussed above. PLAP+ cells were isolated
after transduction and shown to express G-CSF receptor protein (Fig
2A). By plating equal numbers of cells initially and counting live
versus dead cells on the basis of trypan blue exclusion over the course
of 7 days, we were able to document enhanced survival and growth in
G-CSF of PLAP+ G-CSF receptor-expressing 503 cells compared
to PLAP
Macrophage differentiation is partially restored by transduction with
a PU.1-expressing retrovirus.
As we have previously reported,3 cell line 503 was derived
from the liver of a PU.1 null neonate. Based on their expression of
Gr-1 and chloroacetate esterase, 503 cells appear to be of the
neutrophil lineage. No cells displaying specific monocyte or macrophage
characteristics such as F4/80, M-CSF receptor, scavenger receptor, or
mannose receptor expression have been detected in PU.1 null cell
cultures2,3 or in PU.1 null mice of any age examined.1 After transduction of 503 cells with PU.1,
however, Wright-Giemsa staining showed cells with typical mature
macrophage morphology (Fig 6A, compare 503 and 503-PU). Immunohistochemical staining demonstrated the expression
of F4/80 and sialoadhesin, two classic markers for this lineage (Fig 6B
and C). Flow cytometric analysis of the PU.1-transduced population
showed an overall increase in cell size (forward scatter), and both a
decrease in Gr-1 expression and an increase in Mac-1/CD11b expression
relative to the parental 503 PU.1 null cell line (data not shown). mRNA
for macrophage-specific genes including M-CSF receptor (Fig 2A),
mannose receptor, and IL-18 was detected in PU.1-transduced but not
PU.1-deficient cells (data not shown). Interestingly, scavenger
receptor mRNA was still absent from these cells. With the exception of
IL-18, the promoters of each of these genes have previously been
reported to be regulated by PU.1.11,15,16 Thus, by
retroviral delivery of PU.1 into the PU.1-deficient cell line 503, which previously expressed only markers of early myeloid or neutrophil
development, we have restored the ability of these cells to express
markers associated with mature monocyte and macrophage development.
Restoration of M-CSF receptor expression alone permits survival and
proliferation, but not macrophage differentiation, of PU.1 null cells.
We have documented that hematopoietic cells deficient in PU.1 express
neither M-CSF receptor mRNA nor protein2 (Fig 2A). Recent
studies on an independently derived PU.1 null mouse indicated that some
macrophage characteristics could be restored when fetal progenitor
cells were transduced with PU.1.17 In addition, it has
recently been shown that monocyte/macrophage progenitors may be present
in our PU.1 null mouse model.18 To determine whether restoration of signaling through the M-CSF receptor could compensate for the absence of PU.1 and allow macrophage differentiation to proceed, we transduced an M-CSF receptor-expressing retrovirus into the
PU.1 null myeloid cell line 503. We found that M-CSF receptor
expression permitted the cells to use M-CSF for survival and growth,
but did not detectably alter the differentiation status of the cells.
In contrast to PU.1-complemented 503 cells, M-CSF receptor-restored 503 cells did not express F4/80 or Mac-1/CD11b (data not shown).
PU.1-deficient cells transduced with the M-CSF receptor did not express
mRNA for macrophage-associated genes such as IL-18 or mannose receptor
or the myeloid-associated gene gp91phox, which
represented no change from the parental cell line (data not shown).
We previously established that myeloid and lymphoid commitment occurs
in the absence of PU.1.1,2 Although myeloid commitment was
evident in PU.1 null mice, monocytes and macrophages were not produced
in vivo or in vitro.1,2 In contrast, neutrophils were
produced in the mouse relatively late in development (postnatally, in
fact) and remained extremely few in number. Their surface markers, gene
expression, and functional profiles were consistent with incompletely
or aberrantly matured neutrophils. Further studies documented that
PU.1-deficient neutrophils could be expanded in vitro in the presence
of IL-3, but not G- and/or GM-CSF.2 Therefore, at least
part of the observed developmental abnormality of PU.1 null myeloid
cells could be attributable to their failure to express receptors for
G-, GM-, and M-CSF.2 The importance of the CSF receptors in
normal production and expansion of myeloid lineage-restricted cells is
well accepted, although their specific roles are less clear. To
determine the contribution of G- and M-CSF receptors and PU.1 to the
expression of characteristics associated with late stages of
myeloid/neutrophil development, G- and M-CSF receptors and PU.1 were
introduced into the PU.1 null 503 myeloid cell line.
We gratefully acknowledge the technical assistance of Giano Panzarella
and of the animal facility personnel at both the Burnham Institute and
The Scripps Research Institute, and the secretarial assistance of
Bonnie Towle. We also thank Drs Dan Tenen and Dan Link for helpful
discussions, and Dr Larry Rohrschneider for providing the
pMZen(cfms) vector and packaging line.
Submitted April 6, 1999; accepted June 2, 1999.
Supported by National Institutes of Health (NIH) Grant No. DK49886
(B.E.T.). K.L.A. was supported by an NIH Training Grant [T328HLO7195-22]. This is publication 12368-IMM from The Scripps Research Institute.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Bruce E. Torbett, PhD, Department of
Immunology, IMM-7, The Scripps Research Institute, 10550 N Torrey Pines
Rd, La Jolla, CA 92037; e-mail: betorbet{at}scripps.edu.
1.
McKercher SR, Torbett BE, Anderson KL, Henkel GW, Vestal DJ, Baribault H, Klemsz M, Feeney AJ, Wu GE, Paige CJ, Maki RA:
Targeted disruption of the PU.1 gene results in multiple hematopoietic abnormalities.
EMBO J
15:5647, 1996[Medline]
[Order article via Infotrieve]
2.
Anderson KL, Smith KA, Conners K, McKercher SR, Maki RA, Torbett BE:
Myeloid Development is selectively disrupted in PU.1 null mice.
Blood
91:3702, 1998
3.
Anderson KL, Smith KA, Pio F, Torbett BE, Maki RA:
Neutrophils deficient in PU.1 do not terminally differentiate or become functionally competent.
Blood
92:1576, 1998
4.
Kozak M:
Compilation and analysis of sequences upstream from the transcriptional start site in eukaryotic mRNAs.
Nucleic Acids Res
12:857, 1984
5.
Millán JL:
Molecular cloning and sequence analysis of human placental alkaline phosphatase [published erratum appears in J Biol Chem 266:4023, 1991].
J Biol Chem
261:3112, 1986
6.
Rohrschneider LR, Rothwell VM, Nicola NA:
Transformation of murine fibroblasts by a retrovius encoding the murine c-fms proto-oncogene.
Oncogene.
4:1015, 1989[Medline]
[Order article via Infotrieve]
7.
Burns JC, Friedmann T, Driever W, Burrascano M, Yee J-K:
Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors: Concentration to a very high titer and efficient gene transfer into mammalian and nonmammalian cells.
Proc Natl Acad Sci USA
90:8033, 1993
8.
Moritz T, Patel VP, Williams DA:
Bone marrow extracellular matrix molecules improve gene transfer into human hematopoietic cells via retroviral vectors.
J Clin Invest
93:1451, 1994
9.
Moritz T, Dutt P, Xiao X, Carstanjen D, Vik T, Hanenberg H, Williams DA:
Fibronectin improves transduction of reconstituting hematopoietic stem cells by retroviral vectors: Evidence of direct viral binding to chymotryptic carboxy-terminal fragments.
Blood
88:855, 1996
10.
Smith LT, Hohaus S, Gonzalez DA, Dziennis SE, Tenen DG:
PU.1 (Spi-1) and C/EBP alpha regulate the granulocyte colony-stimulating factor receptor promoter in myeloid cells.
Blood
88:1234, 1996
11.
Zhang D-E, Hetherington CJ, Chen H-M, Tenen DG:
The macrophage transcription factor PU.1 directs tissue-specific expression of the macrophage colony-stimulating factor receptor.
Mol Cell Biol
14:373, 1994
12.
Lawson ND, Khanna-Gupta A, Berliner N:
Isolation and characterization of the cDNA for mouse neutrophil collagenase: Demonstration of shared negative regulatory pathways for neutrophil secondary granule protein gene expression.
Blood.
91:2517, 1998
13.
Khanna-Gupta A, Zibello T, Berliner N:
Coordinate regulation of neutrophil secondary granule protein gene expression.
Curr Top Microbiol Immunol
211:136, 1996
14.
Edwards SW:
Biochemistry and Physiology of the Neutrophil. Cambridge University Press, Cambridge UK, 1994.
15.
Moulton KS, Semple K, Wu H, Glass CK:
Cell-specific expression of the macrophage scavenger receptor gene is dependent on PU.1 and a composite AP-1/ets motif.
Mol Cell Biol
14:4408, 1994
16.
Eichbaum Q, Heney D, Raveh D, Chung M, Davidson M, Epstein J, Ezekowitz RA:
Murine macrophage mannose receptor promoter is regulated by the transcription factors PU.1 and Sp1.
Blood
90:4135, 1997
17.
DeKoter RP, Walsh JC, Singh H:
PU.1 regulates both cytokine dependent proliferation and differentiation of granulocyte/macrophage progenitors.
EMBO J
17:4456, 1998[Medline]
[Order article via Infotrieve]
18.
Henkel GW, McKercher SR, Leenen P, Maki RA:
Commitment to the monocytic lineage occurs in the absence of the transcription factor PU.1.
Blood.
93:2849, 1999
19.
Avalos BR:
Molecular analysis of the granulocyte colony-stimulating factor receptor.
Blood
88:761, 1996
20.
Liu F, Wu HY, Wesselschmidt R, Komaga T, Link DC:
Impaired production and increased apoptosis of neutrophils in granulocyte colony-stimulating factor receptor-deficient mice.
Immunity
5:491, 1996[Medline]
[Order article via Infotrieve]
21.
Lieschke GJ, Grail D, Hodgson G, Metcalf D, Stanley E, Cheers C, Fowler KJ, Basu S, Zhan YF, Dunn AR:
Mice lacking granulocyte colony-stimulating factor have chroni |
TOP
ABSTRACT
INTRODUCTION
3'): 
actin 5'
GTGGGCCGCTCTAGGCACCAA, 3' CTCTTTGATGTCACGCACGTATTC; PU.1
(573-873) 5': TCTGATGGAGAAGCTGATGG, 3':
CTTGACTTTCTTCACCTCGC (these primers are located in exon 4 and
exon 5, respectively); c-fms 5': GCGATGTGTGAGCAATGGCAGT,
3': AGACCGTTTTGCGTAAGACCTG; murine neutrophil
collagenase 5': CACGATGGTTGCAGAGAAGC, 3':
TCTCCTCCAATACCTTGGCC; murine neutrophil gelatinase 5':
ACGGTTGGTACTGGAAGTTCC, 3': CCAACTTATCCAGACTCC- TGG;
gp91phox.
) that is the
exclusive product of this enzyme.
) and PLAP
) 503 cells were plated in 10 ng/mL
G-CSF and live cell (on the basis of trypan blue exclusion) counts
monitored over 7 days. Note an almost 5-fold greater number of live
PLAP+ versus PLAP
and C/EBP
, members of the basic
leucine zipper class of transcription factors.