|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 7 (October 1), 1999:
pp. 2403-2413
PTPROt: An Alternatively Spliced and Developmentally Regulated
B-Lymphoid Phosphatase That Promotes G0/G1 Arrest
By
Ricardo C.T. Aguiar,
Yoshihiro Yakushijin,
Samir Kharbanda,
Sanjay Tiwari,
Gordon J. Freeman, and
Margaret A. Shipp
From the Department of Adult Oncology, Dana-Farber Cancer Institute,
Harvard Medical School, Boston, MA.
 |
ABSTRACT |
Protein tyrosine phosphatases (PTP) regulate the
proliferation, differentiation, and viability of lymphocytes by
modulating their signaling pathways. By using the differential display
assay, we have cloned a putative receptor-type PTP, which is
predominantly expressed in B-lymphoid tissues (lymph nodes and spleen).
This PTP, termed PTPROt (truncated), is a tissue-specific
alternatively-spliced form of a human epithelial PTP, PTPRO
(PTPU2/GLEPP1). Whereas the epithelial PTPRO includes an  800-amino
acid extracellular domain, the major (3 kb) PTPROt cDNA predicts a
unique 5' untranslated region and truncated (8 amino acids)
extracellular domain with a conserved transmembrane region and single
catalytic domain. PTPROt cDNAs encode functional ~47-kD and ~43-kD
PTPs, which are most abundant in normal naive quiescent B cells and
decreased or absent in germinal center B cells and germinal
center-derived diffuse large B-cell lymphomas. Because PTPROt was
predominantly expressed in naive quiescent B cells, the enzyme's
effects on cell-cycle progression were examined. When multiple stable
PTPROt sense, antisense, and vector only B-cell transfectants were
grown in reduced serum and synchronized with nocodazole, PTPROt sense clones exhibited markedly increased G0/G1 arrest. Taken together, these
data implicate PTPROt in the growth control of specific B-cell subpopulations.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
THE DEVELOPMENT and function of the
immune system are precisely regulated to guarantee the generation of
protective immune responses while avoiding autoimmunity. This is
accomplished by the engagement of cell-surface receptors, which
transduce signals to intracellular pathways controlling cell
differentiation, proliferation, and survival. These signaling pathways
depend on the tyrosyl phosphorylation of specific cellular
proteins.1 Consequences of aberrant lymphoid tyrosyl
phosphorylation include immunodeficiency, autoimmunity, and/or
neoplasia.1
Protein tyrosine phosphatases (PTPs) regulate both the amplitude and
timing of tyrosine phosphorylation-based signaling events and modulate
protein tyrosine kinase-mediated cellular responses.2 Because tyrosyl phosphorylation pathways regulate lymphocyte growth, viability, and effector function, PTPs play critical roles in lymphoid
biology.1
By using the technique of differential display,3 we have
identified a tissue-specific lymphoid PTP that is expressed by normal
naive B cells but is decreased or absent in normal germinal center B
cells and lymphomas derived from the germinal center. This lymphoid PTP
is a putative receptor-type PTP (RPTP) and an alternatively spliced
form of a previously characterized epithelial enzyme (PTP-U2/GLEPP,
renamed PTPRO by the Human Gene Nomenclature Committee of the Human
Genome Organization [www.gene.ucl.ac.uk/nomenclature]). The
full-length (5.4 kb) epithelial PTPRO cDNA encodes an RPTP with a
single intracellular catalytic domain, a transmembrane region and an
extended extracellular domain containing 8 repeats of fibronectin type
III-like motifs.4,5
Preliminary analyses of multiple human, rabbit, and murine tissues
indicate that alternatively spliced PTPRO transcripts are expressed in
a tissue-specific manner.4-8 The previously characterized full-length (5.4 kb) PTPRO transcript is primarily expressed in the
kidney and brain.4,5 Additional 2.9-kb murine and 3.5-kb rabbit PTPRO-related transcripts encode macrophage and osteoclast enzymes (PTPØ and PTP-oc) with similar incompletely characterized truncated extracellular domains.7,8 Herein, we identify the alternatively spliced B-lymphoid PTPRO as the human homologue of murine PTPØ and elucidate the structure of the
enzyme's truncated extracellular domain and unique 5'
untranslated region. More importantly, we evaluate the enzyme's
expression in well-defined normal B-cell subpopulations and show that
this PTP, termed PTPROt (truncated), is developmentally regulated and implicated in G0/G1 arrest.
| |
MATERIALS AND METHODS |
Cell Lines, Normal B Cells, and Primary Tumor Specimens
Cell lines.
Human diffuse large B-cell lymphoma (DLB-CL) cell lines, DHL-4, DHL-7,
DHL-8, DHL-10, and HT, the small cell lung cancer cell line NCIH345,
and the Epstein-Barr virus (EBV)-transformed lymphoblastoid B-cell line
Laz 3889-11 were cultured in RPMI 1640 supplemented with
10% heat-inactivated fetal calf serum (FCS), 2 mmol/L glutamine, 1 mmol/L sodium pyruvate, 10 mmol/L HEPES buffer, and
penicillin/streptomycin.
Normal B Cells
Isolation of splenic and tonsillar B cells.
Normal spleens were obtained from patients who had no evidence of
systemic or malignant disease at the time of surgical resection. Splenic mononuclear cells were isolated by Ficoll-Hypaque density gradient centrifugation and depleted of T cells by E-rosetting. Tonsils
were obtained from children undergoing tonsillectomy and processed as
previously described.12 Tonsillar mononuclear cells were
isolated by Ficoll-Hypaque density gradient centrifugation and depleted
of non-B cells in a magnetic field after incubation with murine
anti-CD3 (Zymed, San Francisco, CA) and anti-CD11b (Coulter,
Miami, FL) and magnetic beads coated with sheep anti-mouse IgG (Coulter).12 The purity of the isolated tonsillar B
cells was greater than 95% as determined by subsequent immunostaining with anti-CD19 (Coulter).
Isolation of normal naive, germinal center, and memory B cells.
Three distinct subpopulations of normal tonsillar B cells were
identified by triple-color immunofluorescence as previously described.12 In brief, tonsillar B cells were stained with
biotin-labeled anti-IgD (Southern Biotechnology, Birmingham, AL),
streptavidin tricolor (Caltag, Burlingame, CA),
phycoerythrin-conjugated anti-CD38 (Becton Dickinson, San
Jose, CA), and fluorescein isothiocyanate-labeled anti-CD19 (Coulter).
Thereafter, naive (CD19+ sIgD+,
CD38 ), germinal center (CD19+
sIgD, CD38+), and memory B cells
(CD19+ sIgD,CD38)
were separately sorted by flow cytometry. After isolation of the
specific subpopulations, cells were washed in ice-cold
phosphate-buffered saline (PBS) and resuspended in lysis buffer.
Thereafter, cell lysates were incubated at 4°C for 1 hour,
centrifuged at 14,000g for 10 minutes, and assayed for protein
concentration (Protein Assay System, BioRad, Richmond, CA). Western
blot analysis was performed as described below.
Primary tumor specimens.
Cryopreserved primary tumor specimens were obtained from patients with
DLB-CLs.
Differential Display
Differential display was performed as previously
described.3 In brief, total RNAs from primary DLB-CLs,
DLB-CL cell lines and normal splenic B cells were reverse-transcribed
with the T12MC antisense primer. After standardization, resulting cDNAs
were amplified with T12MC and an arbitrary 10-bp sense primer
(TGCTGACCTG). 33P-labeled polymerase chain reaction (PCR)
products were subsequently size fractionated on a 6% polyacrylamide
sequencing gel. Thereafter, the differential display fragment of
interest was excised, extracted, reamplified with the above-mentioned
primers, and cloned into the pCR2.1 vector (Invitrogen, Carlsbad, CA)
for further analysis.
Northern Analysis
Total RNAs from the Laz 388 EBV-transformed lymphoblastoid cell line
and the NCI 345 small cell lung cancer cell line were size fractionated
in 1% agarose/formaldehyde gels and transferred to nylon membranes as
described.13 These membranes and additional multiple tissue
Northern blots (Clontech, Palo Alto, CA) were hybridized
with a differential display fragment probe, a probe derived from either
the PTPROt-specific 5' UTR or the conserved PTPRO/PTPROt
catalytic domain or  -actin.
Rapid Amplification of cDNA Ends (RACE)
The 5' RACE PCR was performed as previously described with minor
modifications.14 In brief, RNA from normal splenic B cells was reverse-transcribed with antisense oligonucleotides derived from
either the original differential display product or the 3' or
5' end of the conserved PTPRO catalytic domain or the 3'
end of the extended PTPRO extracellular domain (all primer sequences available upon request). Resulting PTPRO cDNAs were homopolymer-tailed with terminal deoxynucleotidyl transferase and amplified by nested PCR.
The first round of amplification used the previously described standard
RACE 5' ROR1-TTTT and RO sense oligonucleotide
primers14 and an internal antisense oligonucleotide primer
derived from the PTPRO sequence; a second round of amplification used
the previously described RACE 5' sense R1 oligonucleotide
primer14 and a second internal antisense PTPRO
oligonucleotide primer. Resulting 5' RACE products were blotted
and hybridized with an additional internal PTPRO oligonucleotide probe.
Appropriate PCR products were shotgun cloned into the pCR2.1 cloning
vector and resulting colonies were screened by PCR with m13 primers,
size fractionated, blotted, and hybridized with an internal PTPRO
oligonucleotide probe. Clones containing the largest positive inserts
were subsequently sequenced.
cDNA and Cosmid Library Screening
A size-selected (3 to 7 kb) pCDM8 cDNA library from normal splenic B
cells15 was screened using a PCR-based strategy. In brief,
nested PCR reactions were performed with library plasmid DNA as a
template and pairs of vector and PTPRO primers. Vector primers flanked
the pCDM8 cloning site and PTPRO primers were derived from either the
original differential display product or the 3' or 5' end
of the conserved PTPRO catalytic domain or the 3' end of the
extended PTPRO extracellular domain (all primer sequences available
upon request). Resulting PCR products were blotted and hybridized with
an internal conserved PTPRO oligonucleotide probe. Thereafter, PCR
products were shotgun cloned into pCR2.1 cloning vector and resulting
colonies screened by PCR amplification with m13 primers, size
fractionated by gel electrophoresis, blotted, and hybridized with a
conserved PTPRO oligonucleotide probe. Clones containing the largest
positive inserts were subsequently sequenced. A gridded human
chromosome 12 cosmid library (LL12NCO1, UK Human Genome
Mapping Project Resource Center, Cambridge, UK) was screened according
to manufacturer's instructions with a 200-bp probe derived from the
PTPROt-specific 5' untranslated region.
DNA Sequencing
DNA sequencing was performed according to the manufacturer's
instructions (ABI Prism Dye Terminator Cycle Sequencing Ready Reaction
Kit, Perkin-Elmer Corporation, Norwalk, CT). Sequencing products were
electrophoresed on a 6% long-range gel (FMC Bioproducts, Rockland, MD)
and analyzed on an Applied Biosystems model 373A automated sequencer
(Perkin-Elmer Corporation, Norwalk, CT).
Semi-Quantitative Duplex Reverse Transcriptase-PCR (RT-PCR)
cDNAs were synthesized from primary DLB-CLs, DLB-CL cell lines and
normal splenic B-cell RNAs as previously described.16 To
control for the quantity and quality of input cDNA and the amplification efficiency in individual test tubes, PTPROT-specific 5' cDNA was coamplified with cDNA from the constitutively
expressed ABL gene. PTPROt and ABL primers (PTPROt, sense
5'AGAACCAGCTCCACCCAAAT-3' and antisense
5'-CTACAATTGTAGGCAGTGGC-3'; ABL, sense
5'-CCCAACCTTTTCGTTGCACTGT-3' and antisense
5'-CGGCTCTCGGAGGAGACGATGA-3) were derived from different exons to
avoid amplification of contaminating genomic DNA. Optimal conditions
for the coamplification of PTPROt and ABL cDNAs included 1 µmol/L
PTPROt and 0.07 µmol/L ABL sense and antisense primers, 200 µmol/L
dNTPs, and 1.5 mmol/L MgCl2 in 20-µL volume
and 25 cycles. Duplex PCR products were electrophoresed in 2% agarose gels, blotted, and hybridized to internal PTPROt and ABL
oligonucleotide probes.
The abundance of PTPROt in a given sample was determined by comparing
the intensity of coamplified PTPROt and ABL PCR products with scanning
densitometry. The sensitivity of the duplex PCR was initially
determined by adding fixed amounts of (PTPROt ) DLB-CL cell line
cDNA to (PTPROt+) normal B-cell cDNA to mimic PTPROt losses
of 10% to 100%. When the ratio of PTPROt/ABL signals was plotted
against the percentage of PTPROt "lost" in a given sample, the
data yielded a straight line and r2 value of .97, confirming the sensitivity of the assay.
PCR and Southern Blot Analysis of YAC and Cosmid Clones
YAC clones 952a2, 746a12, 762b12, 802c3, 868c7, 964c10, 916d8, 929e11,
847f2, 826f3, 954g10, and 931h4 were obtained from the Foundation Jean
Dausset-CEPH (Paris, France). Yeast containing the individual YACs were
grown in AHC medium and DNA was extracted by using the
glass bead method.17 PTPROt-containing cosmid clones (0-I14e8, 0-I14g2, 0-I17a2, 0-I81a6, 0-I82a6, 0-I101c11, 0-I153b10, 0-I154a12, 0-I220h11, and 0-I260b5) were identified by screening the
above-mentioned human chromosome 12 cosmid library. Single bacterial
colonies were grown overnight and cosmid DNA was prepared with QIAprep
plasmid maxi kit (Quiagen, Santa Clarita, CA). YAC and cosmid DNAs were
analyzed by Southern blot and PCR with probes and oligonucleotide
primers derived from the common PTPROt/PTPRO 3' end, the
PTPROt-specific 5' UTR, or the unique 5' end of the PTPRO
cDNA (all primer sequences available upon request).
PTPROt Bacterial and Mammalian Expression Constructs
The PTPROt coding region was amplified from normal splenic B-cell cDNA
by RT-PCR and cloned into the pCR2.1 vector. Subsequently, pcR2.1-PTPROt clones were digested with EcoRI (flanking the
insert cloning site) and subcloned into the pGEX-5X3 (Pharmacia,
Piscataway, NJ) and pcDNA3 (Invitrogen) expression vectors. PTPROt
cDNAs were specifically synthesized for pGEX and pcDNA3 constructs by
performing the initial RT-PCR reactions with the indicated forward
primers (5' TGGTTACAGAGATGAATCCC 3' [pGEX] and 5'
TGTCCCTACGTTCATAGCCGTCT 3' [pcDNA3]) and a common reverse
primer (5' ACAATCTGGAAGCAAGGGAG 3'). This strategy allowed
for the removal of the first ATG from the PTPROt sequence and in-frame
fusion to GST in the pGEX-PTPROt construct and maintenance of the
initiation codon in the pcDNA3-PTPROt construct. pcDNA3-PTPROt
constructs were cloned in both the sense and antisense orientations.
Generation of GST-PTPROt Fusion Proteins and Analysis of Phosphatase
Activity
A pGEX-PTPROt construct was used to transform the Escherichia
coli strain, DH5 (GIBCO-BRL, Gaithersburg, MD). Thereafter, the
PTPROt-GST fusion protein was expressed and affinity-purified by using
glutathione-agarose beads according to manufacturer's protocols
(Pharmacia). The purified recombinant GST-PTPROt fusion protein was
extensively washed in the PTPase assay buffer (25 mmol/L HEPES, pH 6.0, 5 mmol/L EDTA, 10 mmol/L 2,3-dihydroxybutane-1,4dithiol). PTP activity
of the recombinant GST-PTPROt protein or GST alone was measured against
2 phosphotyrosyl substrates, END(pY)INASL and DADE(pY)LIPQQG, with the
Tyrosine Phosphatase Assay System (Promega, Madison, WI) according to
manufacturer's instructions (100 µmol/L substrate, 0 to 25 ng
PTPROt-GST or GST alone, 15-minute incubation). PTP assays were
performed in triplicate in the presence or absence of 1 mmol/L of the
nonspecific PTP inhibitor, sodium orthovanadate.
Generation and Analysis of Stable PTPROt Clones
The pcDNA3-PTPROt sense and antisense constructs and vector-only were
transfected into the DLB-CL cell line DHL4, selected with G418 (Sigma,
St Louis, MO) and cloned by limiting dilution as previously
described.18 pcDNA3-PTPROt sense and antisense clones were
initially identified by Northern analysis. pcDNA3-PTPROt sense clones
were also evaluated for expression of the PTPROt protein by Western
hybridization by using an antisera directed against the murine
homologue, PTPØ (gift from E.R. Stanley, Albert Einstein College of
Medicine, Bronx, NY). The PTPØ antisera was originally generated with
a full-length PTPØ-GST fusion protein as the immunogen.
In brief, cell lysates of pcDNA3-PTPROt sense, antisense, and
vector-only DHL4 transfectants were prepared as described above. Thereafter, 75 µg of the indicated DHL4 lysates or 3 µL of PTPROt in vitro translation products (TNT in vitro Translation System, Promega) were size fractionated by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis and transferred to PVDF
membranes (Millipore, Bedford, MA). After blocking, the
membranes were incubated with the PTPØ antiserum and horseradish
peroxidase-conjugated sheep anti-rabbit antiserum (Amersham,
Piscataway, NJ) and developed by using the Renaissance enhanced
chemiluminescence system (NEN, Boston, MA). Thereafter, membranes were
stripped and probed with an antitubulin monoclonal antibody (Sigma) to
assure equal loading.
Cell Cycle Analysis
Multiple independent stable DHL4 pcDNA3-PTPROt sense, antisense, or
vector-only transfectants were plated in duplicate at 1 × 106/mL in RPMI supplemented with 2% or 10% of FCS. The
microtubule-stabilizing agent, nocodazole (Sigma) (100 ng/mL), was
added to one of the duplicate sets of transfectants at 30 hours.19 At 48 hours (18 hours of nocodazole treatment),
cell samples were harvested, washed in PBS and fixed in 80% ethanol at
4oC for 1 hour. Thereafter, propidium iodide (Sigma)
staining was used to assess cell cycle distribution as
described.19
| |
RESULTS |
Identification of a Differentially Expressed Lymphoid PTP
The technique of differential display (see Materials and Methods) was
used to identify cDNAs of different abundance in DLB-CLs and normal
splenic B cells. In initial differential displays, the candidate gene
was expressed in normal splenic B cells but was less abundant in a
series of primary DLB-CLs and undetectable in additional DLB-CL cell
lines (data not shown). To further characterize the candidate gene, the
differential display product was isolated, sequenced, and found to be
identical to the 3' UTR of a previously characterized epithelial
PTP, PTPRO.4,5 When the differential display product was
used as a probe in Northern analysis, the previously described
5.4-kb PTPRO transcript was detected in an epithelial cell line
(Fig 1); in contrast, smaller 3-kb major and
4.1-kb minor transcripts were identified in a B-lymphoblastoid cell
line (Fig 1). These data raised the possibility that the B-lymphoid
differential display product was derived from an alternatively spliced
version of epithelial PTPRO.
View larger version (34K):
[in this window]
[in a new window]
| Fig 1.
Northern analysis of transcripts identified by the
lymphoid differential display product. Total RNAs (20 µg) from an
EBV-transformed lymphoblastoid line (Laz388) and a small cell lung
cancer cell line (NCIH345) were size fractionated, blotted, and
hybridized with the radiolabeled differential display fragment. The
major transcripts in the epithelial and lymphoid cell lines were 5.4
kb and 3 kb, respectively.
|
|
The Lymphoid PTP Is an Alternatively Spliced PTPRO With a
Truncated Extracellular Domain and a Unique 5' Untranslated
Region
To fully characterize the lymphoid PTPRO cDNA, 5' RACE was
performed by using normal splenic B-cell RNA as a template. In addition, a normal splenic B-cell cDNA library was screened for PTPRO-related cDNAs. Multiple independent cDNA clones were derived with
these complementary approaches; these clones contained a conserved
PTPRO transmembrane region (nucleotides 511 to 585, amino acid [aa] 9 to 33) and cytoplasmic domain (nucleotides 586 to 1701, aa 34 to 405)
with the characteristic signature motif (IHCSAGVGRTG, aa 323 to 333)
and 3' untranslated region (Fig 2). Approximately
50% of these cDNA clones also contained a previously characterized
alternatively spliced sequence (aa 66 to 93, nucleotides 680 to 763) in
the juxtamembrane cytoplasmic domain (Fig 2).4,8 The
3-kb PTPROt 3' UTR included only nucleotides 1702 to 1720 and
2752 to 4062, whereas the 4.1-kb PTPROt 3' UTR contained nucleotides
1702 to 4062 (Fig 2).
View larger version (85K):
[in this window]
[in a new window]
| Fig 2.
The nucleotide sequence and deduced amino acid
sequence of PTPROt. The PTPROt 5' and
3' UTRs are represented by lowercase letters. The
PTPROt- specific 5' UTR sequence (217 bp) is outlined
with a heavy border. The PTPROt putative initiation ATG is underlined
and indicated in boldface type. The conserved PTPROt transmembrane
region (aa 9 through 33) is underlined. The previously characterized,
conserved alternatively spliced juxtamembrane sequence (nucleotides 680 to 763, aa 66 to 93) and the catalytic domain signature motif
(IHCSAGVGRTG, aa 323 to 333) are outlined. The stop codon (nucleotides
1702 to 1704) is underlined and indicated in boldface type. The 1-kb
3' UTR sequence (nucleotides 1721 to 2751), which is retained in
4.1-kb PTPROt transcripts and spliced out of 3-kb PTPROt
transcripts, is also underlined. In multiple overlapping clones, 2 nucleotide differences were observed in comparison to published
PTPRO sequences. Nucleotide 717 was found to be a C rather than an A
and nucleotide 740 to be a T rather than C; resulting triplets encode
the same amino acid (proline aa 77) or leucine rather than proline (aa
85). These sequence data are available from GenBank under accession no.
AF152378.
|
|
The human lymphoid PTPRO cDNA sequence diverged from that of the human
epithelial PTPRO 293 bp upstream of the conserved transmembrane domain
(Figs 2 and 3) and contained a novel 217-bp 5'
sequence with multiple stop codons, which truncate its predicted
reading frame (Figs 2 and 3). For these reasons, the differentially
expressed lymphoid PTP was termed PTPROt (truncated). The PTPROt start
codon is likely to be the first ATG that is located 24 bp upstream of the transmembrane region and contains a good Kozak consensus start site. Therefore, the PTPROt cDNAs predict a unique 5'
untranslated region and a truncated 8 aa extracellular domain in
addition to the conserved (PTPRO) transmembrane and cytoplasmic domains
(Figs 2 and 3). The human PTPROt unique 5' UTR sequence is
homologous to the partially characterized murine PTPØ 5'
sequence,8 suggesting that PTPROt is the human homologue of
the murine enzyme.
View larger version (14K):
[in this window]
[in a new window]
| Fig 3.
Comparison of the cDNAs and proteins encoded by PTPROt
and PTPRO. The conserved portions of the 8-aa PTPROt and 820-aa PTPRO
extracellular domains are represented with identical shading; the
unique portion of the PTPRO extended extracellular domain is separately
noted. The sequence, which serves as the unique 5' UTR of
PTPROt and also functions as an intron which is spliced out
the larger PTPRO cDNA, is also indicated. Conserved transmembrane and
cytoplasmic domains and the 3' UTR are also noted.
|
|
Analysis of the PTPRO/PTPROt genomic clones indicated that the unique
5' UTR of PTPROt also functions as an intron, which is spliced
out of the larger PTPRO cDNA (Fig 3). This sequence contains the
requisite mammalian 3' splice site consensus sequence with a
polypyrimidine tract and the absolutely conserved AG dinucleotide (Fig
2; nucleotides 202 to 217).
The 3' UTR sequence (nucleotides 1721 to 2751), which is spliced
out of the major 3-kb PTPROt cDNAs but retained in the less abundant
4.1-kb PTPROt cDNAs, also contains requisite 5' and 3'
splice site consensus sequences (nucleotides 1721 to 1722 and 2750 to
2751, respectively). The PTPROt 3' genomic structure contains no
intronic sequences flanking nucleotides 1721 to 2751, indicating this
1-kb 3' UTR sequence is likely to represent an alternatively retained intron rather than a classical alternatively spliced exon.20
The PTPRO gene locus was previously mapped to chromosome band 12p13. To
refine the mapping of the PTPRO/ROt locus within this area, we further
analyzed a series of YAC clones assigned to this region
(www.cephb.fr/ceph-genethon-map.html). The PTPRO/ROt locus mapped to
YAC 931h4 (D12S1728), which is located approximately 37 centiMorgans (cM) from the top of the chromosome 12 linkage group and centromeric to the smallest region of overlapping
12p13 deletions in hematologic malignancies.21
PTPROt Is Primarily Expressed in B Lymphocytes
To determine whether PTPROt is transcribed in a tissue-specific manner,
probes derived from the unique PTPROt 5' untranslated region and
the conserved catalytic domain were hybridized with Northern blots
containing RNAs from lymphoid and epithelial cell lines
(Fig 4A) and multiple normal human organs
and cell types (Fig 4B). As indicated in Fig 4A, the PTPROt-specific
5' probe identifies the major 3-kb B-lymphoid PTPROt
transcript but not the larger epithelial 5.4-kb PTPRO transcript. In
contrast, the conserved catalytic domain probe identifies both the
B-lymphoid PTPROt and the larger epithelial PTPRO transcripts (Fig 4A).
View larger version (113K):
[in this window]
[in a new window]
| Fig 4.
Northern analysis of PTPROt and PTPRO transcripts in
cell lines and multiple human organs and cell types. (A) Northern
analysis of epithelial and lymphoid cell lines. Total RNA (20 µg)
from the EBV-transformed lymphoblastoid line, Laz 388, and
the small cell lung cancer cell line, NCIH345, was blotted and
hybridized with a unique PTPROt 5' UTR probe (left panel) or a
probe derived from the conserved catalytic domain (right panel). The
unique PTPROt 5' UTR probe recognizes only the lymphoid
transcript, whereas the common catalytic domain probe identifies both
isoforms. (B) Northern analysis of RNAs from multiple human organs and
cell types. Blots were hybridized with a unique PTPROt 5' UTR
probe (top panel) or a probe derived from the conserved catalytic
domain (middle panel). The major 3-kb and 4.1-kb minor
PTPROt transcripts hybridized with both the PTPROt-specific
5' probe (top panel) and the common catalytic domain probe
(middle panel). The larger (5.4 kb) epithelial PTPRO transcripts in
brain and kidney only hybridized with the common catalytic domain probe
(middle panel). The filters were also hybridized with B-actin (bottom
panel) to confirm equal loading.
|
|
The major 3-kb and minor 4.1-kb PTPROt transcripts were primarily
detected in normal organs containing large numbers of B lymphocytes,
such as spleen and lymph node (Fig 4B). Although both of these PTPROt
transcripts hybridized with the PTPROt-specific 5' probe (Fig 4B,
top panel), only the 4.1-kb PTPROt transcripts hybridized with a
probe derived from the alternatively retained 3' UTR sequences
(nucleotides 1721 to 2751 [Fig 2]; data not shown). The 3-kb and
4.1-kb PTPROt mRNAs have the same 5' UTR and encode identical
proteins; however, the 4.1-kb transcript contains additional 3' UTR sequence (nucleotides 1721 to 2751) that is not present in
the 3-kb transcript.
Although 3-kb and 4.1-kb PTPROt transcripts were readily
detectable in B-lymphoid organs such as the spleen and lymph node, little PTPROt was found in organs or specimens containing higher percentages of T lymphocytes, lymphoid progenitors, and other hematopoietic cells (thymus, peripheral blood lymphocytes, bone marrow,
and fetal liver; Fig 4B, top panel). Faint PTPROt transcripts were,
however, detected in lung and placenta (Fig 4B, top panel).
As expected, PTPROt lymphoid transcripts were also detected with a
probe derived from the common catalytic domain (Fig 4B, middle panel).
This common catalytic domain probe also identified the previously
described 5.4-kb PTPRO transcripts in normal human brain and kidney
(Fig 4B, middle panel).4,5 Taken together, these data
indicate that alternatively spliced PTPRO transcripts are expressed in
a tissue-specific manner and that PTPROt is primarily expressed in
B-lymphoid organs.
To more specifically quantify PTPROt transcripts in normal B cells and
additional DLB-CL primary tumors and cell lines, a PTPROt
semiquantitative duplex RT-PCR was developed (see Materials and
Methods). The abundance of PTPROt in a given sample was determined by
comparing the intensity of coamplified PTPROt and control (ABL) PCR
products (Fig 5). In this sensitive
semiquantitative assay, PTPROt transcripts were readily detected in
normal unsorted splenic B cells; in marked contrast, PTPROt transcripts
were undetectable in the DLB-CL cell lines and absent or decreased in
the majority of examined primary DLB-CLs (Fig 5).
View larger version (23K):
[in this window]
[in a new window]
| Fig 5.
Semiquantitative duplex RT-PCR analysis of PTPROt in
primary DLB-CLs, DLB-CL cell lines and normal splenic B cells. Five
primary DLB-CLs, 4 DLB-CL cell lines (DHL-4, DHL-7, DHL-8, and DHL-10),
and normal unsorted splenic B cells from 2 donors were analyzed for
PTPROt expression by semiquantitative duplex RT-PCR. The abundance of
PTPROt in a given sample was determined by comparing the intensity of
coamplified PTPROt and ABL PCR products.
|
|
PTPROt Encodes an Active PTP
To further characterize the proteins encoded by PTPROt, PTPROt cDNAs,
which included or lacked bp 680 to 763, from the juxtamembrane region
(PTPROtlong[L] and PTPROtshort[S], Fig 2)
were in vitro translated, immunoblotted, and analyzed with an antiserum
directed against the putative murine homologue of PTPROt,
PTPØ.8 Cell lysates from DHL-4 cells transfected with vector only, pcDNA3-PTPROt[S]sense, or
pcDNA-PTPROt[S]antisense were similarly immunoblotted and
analyzed. As indicated in Fig 6, the
predicted 47-kD and 43-kD PTPROt[L] and
PTPROt[S] proteins were readily detectable in the in
vitro translations of PTPROt sense cDNAs and absent in the in vitro
translations of PTPROt antisense cDNAs. DHL-4
PTPROt[S]sense transfectants also expressed high levels
of the expected 43-kD protein that was not detected in DHL-4
PTPROt[S]antisense and vector-only transfectants (Fig 6).
Taken together, these data confirm that PTPROt[L] and
PTPROt[S] cDNAs encode the predicted 47-kD
and 43-kD proteins and that these proteins are the human homologues of
murine PTPØ.8
View larger version (55K):
[in this window]
[in a new window]
| Fig 6.
Western analysis of PTPROt proteins, human homologues of
murine PTPØ. PTPROt cDNAs, which included or lacked bp 680 to 763 from
the juxtamembrane region (PTPROtlong[L] and
PTPROtshort[S], Fig 2) were in vitro translated,
immunoblotted and analyzed with an antiserum directed against the
putative murine homologue of PTPROt, PTPØ.8
Cell lysates from DHL-4 cells transfected with vector only,
pcDNA3-PTPROt[S]sense, or
pcDNA-PTPROt[S]antisense were similarly immunoblotted and
analyzed. As indicated, the predicted ~47-kD and 43-kD
PTPROt[L] and PTPROt[S] proteins were
readily detectable in in vitro translations of PTPROt sense cDNAs and
absent in in vitro translations of PTPROt antisense cDNAs. In the in
vitro translated products, the less intense bands running 4 kD lower
than the major proteins are likely to result from the use of a second
start codon (nucleotide 604) with a strong Kozak consensus sequence.
DHL-4 PTPROt[S]sense transfectants also expressed high
levels of the expected 43-kD protein, which was not
detected in DHL-4 PTPROt[S]antisense transfectants. (The
PTPØ antisera also identified 70-kD proteins of uncertain
significance in all [vector-only, antisense, sense] DHL-4 clones.)
The filters were also probed with an antitubulin antibody to assure
equal loading.
|
|
To assess the functional activity of the encoded PTPROt proteins, a
recombinant PTPROt-GST fusion protein was synthesized for use in a
classic phosphatase assay. As shown in Fig
7, PTPROt-GST dephosphorylated the synthetic phosphotyrosyl substrate,
END(pY)INASL in a concentration-dependent manner; this tyrosine
phosphatase activity was markedly decreased by the addition of the PTP
inhibitor, sodium orthovanadate. Similar results were obtained by using
a second synthetic phosphotyrosyl substrate, DADE(pY)LIIPQQG (data not
shown). As expected, the control GST protein had no detectable phosphatase activity (Fig 7).
View larger version (16K):
[in this window]
[in a new window]
| Fig 7.
PTPROt encodes an active tyrosine phosphatase. The
enzymatic activities of the PTPROt-GST fusion protein alone ( ),
PTPROt-GST in the presence of 1 mmol/L sodium orthovanadate ( ), and
GST alone ( ) were measured using the synthetic phosphotyrosyl
substrate, END(pY)INASL. PTPROt-GST dephosphorylated the indicated
substrate in a concentration-dependent manner; PTPROt phosphatase
activity was also markedly reduced in the presence of the PTP
inhibitor, sodium orthovanadate. The control GST protein has no
detectable phosphatase activity. The data are expressed as the mean ± SD from 3 independent assays.
|
|
PTPROt Expression Differs at Discrete Stages of B-Cell
Differentiation
After confirming that PTPROt encodes 47-kD and 43-kD proteins with
tyrosine phosphatase activity, we further examined the enzymes'
expression in functionally discrete normal B-cell subpopulations. To
accomplish this, normal tonsillar B cells were immunophenotyped with
antibodies directed against CD19, surface IgD, and CD38 and sorted into
highly purified naive (CD19+ sIgD+
CD38), germinal center (CD19+
sIgD CD38+), and memory
(CD19+ sIgD CD38)
B-cell subpopulations. Thereafter, these functionally discrete B-cell
subpopulations were immunoblotted and analyzed with the previously
described PTPØ antiserum.
As indicated in Fig 8, PTPROt was most
abundant in naive B cells with markedly reduced levels in germinal
center B cells and slightly higher levels in memory B cells (4×
naive, 1× germinal center, 1.4× memory B cells by scanning
densitometry). These marked differences in PTPROt expression indicate
that the enzyme is developmentally regulated during B-cell
differentiation. In addition, the data suggest that DLB-CLs may express
low levels of PTPROt (Fig 5) because these tumors are derived from the
germinal center.
View larger version (35K):
[in this window]
[in a new window]
| Fig 8.
PTPROt expression in normal naive quiescent, germinal
center, and memory B cells. Whole-cell lysates (75 µg) from unsorted
tonsillar B cells and highly purified naive (CD19+
sIgD+ CD38), germinal center
(CD19+ sIgD CD38+), and
memory (CD19+ sIgD CD38) B
cells were immunoblotted and analyzed with the antiserum directed
against the murine PTPROt homologue, PTPØ. The abundance of PTPROt in
naive, germinal center, and memory B cells was compared by scanning
densitometry. Autoradiograms were scanned with a CCD camera linked to a
frame grabber (Alpha Imager 2000; Alpha Innotec Corp, San Leandro, CA)
and band intensities were quantified by using Image Quant Software
(Molecular Dynamics, Sunnyvale, CA). The filters were also probed with
an antitubulin antibody to assure equal loading.
|
|
PTPROt Expression Promotes G0/G1 Growth Arrest
The fact that PTPROt was more abundant in quiescent naive B cells than
in germinal center B cells prompted us to assess the enzyme's effects
on cell cycle progression. To accomplish this, multiple independent
PTPROt sense, antisense, and vector-only DHL-4 transfectants were
plated in 2% or 10% serum; transfectants were cultured in the
presence or absence of the microtubule-stabilizing agent, nocodazole,
which synchronizes the cells in G2-M.
Figure 9 depicts a representative analysis
of 2 independent stable PTPROt sense, antisense, and vector-only
transfectants grown in 2% serum with or without nocodazole. When
PTPROt sense, antisense, and vector-only transfectants were grown in
10% serum (data not shown) or in 2% serum in the absence of
nocodazole (Fig 9, left panel), there were no significant differences
in cell cycle distribution. However, a large proportion of PTPROt
sense, antisense, and vector-only transfectants were already in G0/G1 under these conditions, making it difficult to detect changes in G0/G1
arrest.
View larger version (24K):
[in this window]
[in a new window]
| Fig 9.
Cell-cycle analysis of PTPROt sense, antisense, and
vector-only B-lymphoid transfectants. Two representative stable PTPROt
sense, antisense, and vector-only DHL-4 B-lymphoid transfectants were
cultured in 2% serum in the presence (right) or absence (left) of the
microtubule-stablizing agent, nocodazole. When PTPROt sense,
antisense and vector-only transfectants were grown in 2%
serum in the absence of nocodazole, there were no significant
differences in cell-cycle distribution (left panel). When PTPROt
antisense or vector-only transfectants were treated with nocodazole,
the G0/G1 portion of the cycle was greatly diminished and only 6% to
12% of the cells remained in G0/G1 (right panel). In marked contrast,
28% of nocodazole-treated PTPROt sense transfectants remained in
G0/G1 (right panel).
|
|
For these reasons, the sensitivity of the assay was increased by
synchronizing the cells in mitosis with nocodazole. Because nocodazole-treated cells arrest in G2-M and do not exit mitosis, changes in the G0/G1 phase of cell cycle are more obvious. When PTPROt
antisense or vector-only transfectants were treated with nocodazole,
the G0/G1 portion of the cycle was greatly diminished and only 6% to
12% of the cells remained in G0/G1 (Fig 9, right panel). In marked
contrast, ~28% of nocodazole-treated PTPROt sense transfectants
remained in G0/G1 (Fig 9, right panel). These data indicate that the
overexpression of PTPROt imposes a block in cell cycle progression at
G0/G1 (Fig 9, right panel).
| |
DISCUSSION |
By using the technique of differential display, we have identified a
tissue-specific PTP that is expressed by normal quiescent naive B cells
but is decreased or absent in normal germinal center B cells and
lymphomas derived from the germinal center. This PTP, termed PTPROt, is
an alternatively spliced form of the epithelial enzyme, PTPRO
(previously named PTPU2/GLEPP1).4,5 The 2 proteins differ
exclusively in the length of their extracellular domains. Whereas PTPRO
encodes an enzyme with a long extracellular domain rich in fibronectin
type-III-like motifs, PTPROt contains a truncated 8-aa extracellular
region. The transmembrane region and single intracellular catalytic
domain are identical in PTPRO and PTPROt. Consistent with this
observation, the truncated lymphoid isoform also encodes a fully
functional protein tyrosine phosphatase.
Detailed molecular analyses of human PTPROt cDNAs and genomic clones
indicate that the PTPROt-specific 5' UTR functions as an intron
in the epithelial PTPRO. The PTPROt-specific 5' UTR is spliced
out of the longer PTPRO cDNA; in contrast, the 3' end of this
sequence is transcribed in a tissue-specific manner in the truncated
lymphoid transcript. In addition, sequences upstream of the PTPROt
5' UTR contain a canonical TATA box and several putative
transcription factor binding sites, suggesting that this region may
include tissue-specific PTPROt regulatory elements (R. Aguiar and M. Shipp, unpublished data, January 1999).
PTPROt and PTPRO are the human members of a newly identified family of
receptor-type PTPs with tissue-specific extracellular domains and a
common transmembrane region and single catalytic domain. Homologues of
human PTPRO with extended extracellular domains have been identified in
rat,22 rabbit,6 and chicken.23 More
recently, PTPRO isoforms with incompletely characterized truncated
extracellular domains have been identified in rabbit7 and
mouse8 and termed PTP-oc and PTPØ, respectively. Our data indicate that PTPROt is the human homologue of murine PTPØ.
Of interest, murine PTPØ was originally identified as a primary
macrophage product, which was also expressed at low levels in the
spleen.8 The presumed rabbit PTPROt homologue, PTP-oc, was
isolated from osteoclasts, a specialized type of macrophage; PTP-oc was
also expressed at low levels in the spleen.7 Among human
organs and cell types analyzed to date, PTPROt transcripts are most
abundant in the spleen and lymph node, detectable in placenta and lung,
and far less abundant in other tissues. Given the tissue distribution
of the murine and rabbit homologues, it is possible that human
pulmonary PTPROt transcripts are derived from contaminating
alveolar macrophages rather than bronchial epithelium. Further studies
will be needed to characterize PTPROt expression in additional human
hematopoietic cells and in the B-lymphoid organs and cell types from
other species. Nevertheless, the PTPRO/PTPROt isoforms identified thus
far exhibit a high degree of evolutionary conservation, suggesting that
this phosphatase family has important unique functions.
The prominent expression of PTPROt in human B-lymphoid organs prompted
us to assess PTPROt levels in functionally discrete B-cell
subpopulations. PTPROt was most abundant in naive B cells with markedly
reduced levels in germinal center B cells. The relevance of this result
is 2-fold. First, because germinal center B cells include the normal
counterpart of most DLB-CLs, these lymphomas may express little PTPROt
as a consequence of their germinal center origin rather than malignant
transformation. Second, the stage-specific differences in PTPROt
expression in naive and germinal center B cells suggest that the enzyme
may have a specific role in quiescent lymphocytes. In this regard, it
is noteworthy that the murine PTPROt homologue, PTPØ, is more abundant
in quiescent macrophages than in log phase cells and that PTPØ levels
decline when macrophages are stimulated to proliferate with
CSF-1.8
To further assess a specific role for PTPROt in quiescent B cells, we
analyzed the enzyme's effects on cell cycle transit. When B cells
transfected with PTPROt sense, PTPROt antisense or vector only were
grown in low serum and synchronized with nocodazole, PTPROt sense
transfectants exhibited increased G0/G1 arrest. These data suggest that
under these conditions, PTPROt may contribute to the quiescent state of
functionally relevant B-cell subpopulations.
It is possible that PTPROt-mediated G0/G1 arrest was only detected in
reduced serum because serum-derived positive growth factors override
the enzyme's effects. Serum components may also indirectly modulate
PTPROt function by altering the phosphorylation of the enzyme itself as
reported for PTP1B24 and PP1.25 Alternatively, the malignant B-lymphoid cell line used to generate PTPROt
transfectants may have additional abnormalities that render it less
responsive to growth-arresting stimuli. In this regard, the cell-cycle
inhibitory effects of the recently identified lipid and protein
phosphatase, PTEN, require reduced serum in some, but not all, cell
lines.19,26,27
The mechanisms by which PTPROt enhances G0/G1 arrest remain to be
determined. For example, it is not yet known whether PTPROt substrates
include specific cell-cycle regulatory subunits or whether the enzyme
acts indirectly by inhibiting classical B-cell signaling pathways. Of
interest, another hematopoietic PTP, which is down-regulated in
germinal center B cells,28 SHP-1, interacts with negative
regulatory subunits such as CD2229 and PIR-B30 to inhibit B-cell responses after B-cell receptor signaling.
The functional roles of the PTPRO/PTPROt family are just beginning to
be elucidated. The longer PTPRO isoform was recently transfected into
the U937 monocytic leukemia cell line and found to promote apoptosis
after the terminal differentiation of these cells.31 Under
the conditions used in our assays, PTPROt enhanced the G0/G1 arrest,
rather than apoptosis (data not shown), of B lymphocytes. However,
apoptosis and growth arrest are thought to be largely interdependent
cellular responses. The prevailing response in a specific setting
depends on cell type, microenvironment, and expression of additional
proteins.32 Recent data suggest that other phosphatases
also block S-phase entry or induce apoptosis in specific
settings.19,26,27,33-35 For these reasons, it is not
surprising that PTPROt and PTPRO may mediate growth arrest and/or
apoptosis in distinct cell types under specific conditions.
The regulated expression of PTPROt in specific B-cell subpopulations
and the enzyme's effects on G0/G1 arrest suggest that PTPROt may have
an important role in B-cell signaling. It is possible that PTPROt
dysfunction may also lead to the abnormal proliferation of specific
B-cell subsets and attendant consequences. For these reasons, the
identification of PTPROt in vivo substrates and coassociating molecules
and the development of informative PTPROt-deficient murine models will
be of interest.
| |
ACKNOWLEDGMENT |
We thank T. Grogan for assistance in identifying appropriate primary
DLB-CLs for further analysis, R. Stanley for the gift of PTPØ
antiserum, J. Daley and H. Levine for assistance with cell sorting, M. Streuli for manuscript review, and D. Favreau for manuscript preparation.
| |
FOOTNOTES |
Submitted March 31, 1999; accepted June 4, 1999.
Funded by a National Institutes of Health (NIH) Grant (CA66996), a
Leukemia Society of America Translational Research Award, and a Larry
and Susan Marx Research Fellowship (R.C.T.A.). M.A.S. is a Leukemia
Society of America Scholar.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Margaret A. Shipp, MD, Dana-Farber Cancer
Institute, 44 Binney St, Boston, MA 02115; e-mail: margaret_shipp{at}dfci.harvard.edu.
| |
REFERENCES |
1.
Neel B:
Role of phosphatases in lymphocyte activation.
Curr Opin Immunol
9:405, 1997[Medline]
[Order article via Infotrieve]
2.
Pani G, Siminovitch K:
Short analytical review: Protein tyrosine phosphatase roles in the regulation of lymphocyte signaling.
Clin Immunol Immunopathol
84:1, 1997[Medline]
[Order article via Infotrieve]
3.
Liang P, Pardee A:
Differential display of eukaryotic messenger RNA by means of polymerase chain reaction.
Science
257:967, 1992[Abstract/Free Full Text]
4.
Seimiya H, Sawabe T, Inazawa J, Tsuruo T:
Cloning, expression and chromosomal location of a novel gene for protein tyrosine phosphatase (PTP-U2) induced by various differentiation-inducing agents.
Oncogene
10:1731, 1995[Medline]
[Order article via Infotrieve]
5.
Wiggins R, Wiggins J, Goyal M, Wharram B, Thomas P:
Molecular cloning of cDNAs encoding a human GLEPP1, a membrane protein tyrosine phosphatase: Characterization of the GLEPP1 protein distribution in human kidney and assignment of the GLEPP1 gene to human chromosome 12p12-p13.
Genomics
27:174, 1995[Medline]
[Order article via Infotrieve]
6.
Thomas P, Wharram B, Goyal M, Wiggins J, Holzman L, Wiggins R:
GLEPP1, a renal glomerular epithelial cell (podocyte) membrane protein-tyrosine phosphatase.
J Biol Chem
269:19953, 1994[Abstract/Free Full Text]
7.
Wu L, Baylink D, Lau W:
Molecular cloning and expression of a unique rabbit osteoclastic phosphotyrosyl phosphatase.
Biochem J
316:515, 1996
8.
Pixley F, Lee P, Dominguez M, Einstein D, Stanley E:
A heteromorphic protein-tyrosine phosphatase, PTPphi is regulated by CSF-1 in macrophages.
J Biol Chem
270:27339, 1995[Abstract/Free Full Text]
9.
Hecht B, Epstein A, Berger C, Kaplan H, Hecht F:
Histiocytic lymphoma cell lines: Immunologic and cytogenetic studies.
Cancer Genet Cytogenet
14:205, 1985[Medline]
[Order article via Infotrieve]
10.
Beckwith M, Urba W, Longo D:
Growth inhibition of human lymphoma cell lines by the marine products, dolastatins 10 and 15.
J Natl Cancer Inst
85:483, 1993[Abstract/Free Full Text]
11.
Shipp M, Tarr G, Chen C-Y, Switzer S, Hersh L, Stein H, Sunday M, Reinherz E:
CD10/NEP hydrolyzes bombesin-like peptides and regulates the growth of small cell carcinomas of the lung.
Proc Natl Acad Sci USA
88:10662, 1991[Abstract/Free Full Text]
12.
Ghia P, Boussiotis VA, Schultze JL, Cardoso AA, Dorfman DM, Gribben JG, Freedman AS, Nadler LM:
Unbalanced expression of Bcl-2 family proteins in follicular lymphoma: Contribution of CD40 signaling in promoting survival.
Blood
91:244, 1998[Abstract/Free Full Text]
13.
Dahia P, Aguiar R, Alberta J, Kum JB, Caron S, Sill H, Marsh DJ, Ritz J, Freedman A, Stiles C, Eng C:
PTEN is inversely correlated with the cell survival factor Akt-PKB and is inactivated via multiple mechanisms in haematological malignancies.
Hum Mol Genet
8:185, 1999[Abstract/Free Full Text]
14.
Ishimaru F, Shipp M:
Analysis of the human CD10/neutral endopeptidase 24.11 promoter region: Two separate regulatory elements.
Blood
85:3199, 1995[Abstract/Free Full Text]
15.
Freeman G, Freedman A, Segil J, Lee G, Whitman J, Nadler L:
A new member of the Ig superfamily with unique expression on activated and neoplastic B cells.
J Immunol
143:2714, 1989[Abstract]
16.
Aguiar R, Sohal J, Van Rhee F, Carapeti M, Franklin I, Goldstone A, Goldman J, Cross N:
TEL-AML1 fusion in acute lymphoblastic leukemia of adults.
Br J Haematol
95:673, 1996[Medline]
[Order article via Infotrieve]
17.
Aguiar R, Chase A, Coulthard S, Macdonald D, Carapeti M, Reiter A, Sohal J, Lennard A, Goldman J, Cross N:
Abnormalities of chromosome band 8p11 in leukemia: Two clinical syndromes can be distinguished on the basis of MOZ involvement.
Blood
90:3130, 1997[Abstract/Free Full Text]
18.
Yakushijin Y, Steckel J, Kharbanda S, Hasserjian R, Neuberg D, Jiang W-m, Anderson I, Shipp MA:
A directly spliced exon 10-containing CD44 variant promotes the metastasis and homotypic aggregation of aggressive non-Hodgkin's lymphoma.
Blood
91:4282, 1998[Abstract/Free Full Text]
19.
Furnari FB, Su Huang H-J, Cavenee WK:
The phosphoinositol phosphatase activity of PTEN mediates a serum-sensitive G1 growth arrest in glioma cells.
Cancer Res
58:5002, 1998[Abstract/Free Full Text]
20.
Dirksen W, Sun Q, Rottman F:
Multiple splicing signals control alternative intron retention of bovine growth hormone pre-mRNA.
J Biol Chem
270:5346, 1994[Abstract/Free Full Text]
21.
Aguiar R, Chase A, Oscier D, Carapeti M, Goldman J, Cross N:
Characterization of a t(10;12)(q24;p13) in a case of CML in transformation.
Genes Chromosomes Cancer
20:408, 1997[Medline]
[Order article via Infotrieve]
22.
Tagawa M, Shirasawa T, Yahag Y, Tomoda T, Kuroyanag H, Fujimura S, Sakiyama S, Maruyama N:
Identification of a receptor-type protein tyrosine phosphatase expressed in postmitotic maturing neurons: Its structure and expression in the central nervous system.
Biochem J
321:865, 1997
23.
Bodden K, Bixby JL:
CRYP-2: A receptor-type tyrosine phosphatase selectively expressed by developing vertebrate neurons.
J Neurobiol
31:309, 1996[Medline]
[Order article via Infotrieve]
24.
Flint AJ, Gebbink MF, Franza BR Jr, Hill DE, Tonks NK:
Multi-site phosphorylation of the protein tyrosine phosphatase, PTP1B: Identification of cell cycle regulated and phorbol ester stimulated sites of phosphorylation.
EMBO J
12:1937, 1993[Medline]
[Order article via Infotrieve]
25.
Dohadwala M, Da Cruz e Silva EF, Hall FL, Williams RT, Carbonaro-Hall DA, Nairn AC, Greengard P, Berndt N:
Phosphorylation and inactivation of protein phosphatase 1 by cyclin-dependent kinases.
Proc Natl Acad Sci USA
91:6408, 1994[Abstract/Free Full Text]
26.
Ramaswamy S, Kakamura N, Vazquez F, Batt DB, Perera S, Roberts TM, Sellers WR:
Regulation of G1 progression by the PTEN tumor suppressor protein is linked to inhibition of the phosphatidylinositol 3-kinase/Akt pathway.
Proc Natl Acad Sci USA
96:2110, 1999[Abstract/Free Full Text]
27.
Li D-M, Sun H:
PTEN/MMAC1/TEP suppresses the tumorigenicity and induces G1 cell cycle arrest in human glioblastoma cells.
Proc Natl Acad Sci USA
95:15406, 1998[Abstract/Free Full Text]
28.
Delibrias CC, Floettmann JE, Rowe M, Fearon DT:
Downregulated expression of SHP-1 in Burkitt lymphomas and germinal center B lymphocytes.
J Exp Med
186:1575, 1997[Abstract/Free Full Text]
29.
Neel B, Tonks N:
Protein tyrosine phosphatases in signal transduction.
Curr Opin Cell Biol
9:193, 1997[Medline]
[Order article via Infotrieve]
30.
Maeda A, Kurosaki M, Ono M, Takai T, Kurosaki T:
Requirement of SH2-containing protein tyrosine phosphatases SHP-1 and SHP-2 for paired immunoglobulin-like receptor B (PIR-B)-mediated inhibitory signal.
J Exp Med
187:1355, 1998[Abstract/Free Full Text]
31.
Seimiya H, Tsuruo T:
Functional involvement of PTP-U2L in apoptosis subsequent to terminal differentiation of monoblastoid leukemia cells.
J Biol Chem
273:21187, 1998[Abstract/Free Full Text]
32.
Evan G, Littlewood T:
A matter of life and cell death.
Science
281:1317, 1998[Abstract/Free Full Text]
33.
Li J, Simpson L, Takahashi M, Miliaresis C, Myers MP, Tonks N, Parsons R:
The PTEN/MMAC1 tumor suppressor induces cell death that is rescued by the AKT/protein kinase B oncogene.
Cancer Res
58:5667, 1998[Abstract/Free Full Text]
34.
Brondello JM, McKenzie FR, Sun H, Tonks NK, Pouyssegur J:
Constitutive MAP kinase phosphatase (MKP-1) expression blocks G1 specific gene transcription and S-phase entry in fibroblasts.
Oncogene
10:1895, 1995[Medline]
[Order article via Infotrieve]
35.
Horiuchi M, Hayashida MW, Kambe T, Yamada T, Dzau VJ:
Angiotensin type 2 receptor dephosphorylates Bcl-2 by activating mitogen-activated protein kinase phosphatase-1 and induces apoptosis.
J Biol Chem
272:19022, 1997[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
S.-W. Kim, D. Rai, M. R. McKeller, and R. C. T. Aguiar
Rational combined targeting of phosphodiesterase 4B and SYK in DLBCL
Blood,
June 11, 2009;
113(24):
6153 - 6160.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. P. Gobert, M. van den Eijnden, C. Szyndralewiez, C. Jorand-Lebrun, D. Swinnen, L. Chen, C. Gillieron, F. Pixley, P. Juillard, P. Gerber, et al.
GLEPP1/Protein-tyrosine Phosphatase {phi} Inhibitors Block Chemotaxis in Vitro and in Vivo and Improve Murine Ulcerative Colitis
J. Biol. Chem.,
April 24, 2009;
284(17):
11385 - 11395.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. H.-C. Sheng, M. Amoui, V. Stiffel, A. K. Srivastava, J. E. Wergedal, and K.-H. W. Lau
Targeted Transgenic Expression of an Osteoclastic Transmembrane Protein-tyrosine Phosphatase in Cells of Osteoclastic Lineage Increases Bone Resorption and Bone Loss in Male Young Adult Mice
J. Biol. Chem.,
April 24, 2009;
284(17):
11531 - 11545.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Motiwala, S. Majumder, K. Ghoshal, H. Kutay, J. Datta, S. Roy, D. M. Lucas, and S. T. Jacob
PTPROt Inactivates the Oncogenic Fusion Protein BCR/ABL and Suppresses Transformation of K562 Cells
J. Biol. Chem.,
January 2, 2009;
284(1):
455 - 464.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Chen, S. Monti, P. Juszczynski, J. Daley, W. Chen, T. E. Witzig, T. M. Habermann, J. L. Kutok, and M. A. Shipp
SYK-dependent tonic B-cell receptor signaling is a rational treatment target in diffuse large B-cell lymphoma
Blood,
February 15, 2008;
111(4):
2230 - 2237.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Motiwala, S. Majumder, H. Kutay, D. S. Smith, D. S. Neuberg, D. M. Lucas, J. C. Byrd, M. Grever, and S. T. Jacob
Methylation and Silencing of Protein Tyrosine Phosphatase Receptor Type O in Chronic Lymphocytic Leukemia
Clin. Cancer Res.,
June 1, 2007;
13(11):
3174 - 3181.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. M. Polo, P. Juszczynski, S. Monti, L. Cerchietti, K. Ye, J. M. Greally, M. Shipp, and A. Melnick
Transcriptional signature with differential expression of BCL6 target genes accurately identifies BCL6-dependent diffuse large B cell lymphomas
PNAS,
February 27, 2007;
104(9):
3207 - 3212.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Kapp, J. Siemens, P. Weyrich, J. B. Schulz, H.-U. Haring, and R. Lammers
Extracellular domain splice variants of a transforming protein tyrosine phosphatase alpha mutant differentially activate Src-kinase dependent focus formation.
Genes Cells,
January 1, 2007;
12(1):
63 - 73.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Lissandrini, W. Vermi, M. Vezzalini, S. Sozzani, F. Facchetti, G. Bellone, A. Mafficini, F. Gentili, M. G. Ennas, C. Tecchio, et al.
Receptor-type protein tyrosine phosphatase gamma (PTP{gamma}), a new identifier for myeloid dendritic cells and specialized macrophages
Blood,
December 15, 2006;
108(13):
4223 - 4231.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Chen, P. Juszczynski, K. Takeyama, R. C. T. Aguiar, and M. A. Shipp
Protein tyrosine phosphatase receptor-type O truncated (PTPROt) regulates SYK phosphorylation, proximal B-cell-receptor signaling, and cellular proliferation
Blood,
November 15, 2006;
108(10):
3428 - 3433.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Szoor, J. Wilson, H. McElhinney, L. Tabernero, and K. R. Matthews
Protein tyrosine phosphatase TbPTP1: a molecular switch controlling life cycle differentiation in trypanosomes
J. Cell Biol.,
October 23, 2006;
175(2):
293 - 303.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Takahashi, F. Feuerhake, J. L. Kutok, S. Monti, P. Dal Cin, D. Neuberg, J. C. Aster, and M. A. Shipp
FAS Death Domain Deletions and Cellular FADD-like Interleukin 1{beta} Converting Enzyme Inhibitory Protein (Long) Overexpression: Alternative Mechanisms for Deregulating the Extrinsic Apoptotic Pathway in Diffuse Large B-Cell Lymphoma Subtypes.
Clin. Cancer Res.,
June 1, 2006;
12(11):
3265 - 3271.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. C. T. Aguiar, K. Takeyama, C. He, K. Kreinbrink, and M. A. Shipp
B-aggressive Lymphoma Family Proteins Have Unique Domains That Modulate Transcription and Exhibit Poly(ADP-ribose) Polymerase Activity
J. Biol. Chem.,
October 7, 2005;
280(40):
33756 - 33765.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. G. Smith, F. Wang, K. N. Wilkinson, K. J. Savage, U. Klein, D. S. Neuberg, G. Bollag, M. A. Shipp, and R. C. T. Aguiar
The phosphodiesterase PDE4B limits cAMP-associated PI3K/AKT-dependent apoptosis in diffuse large B-cell lymphoma
Blood,
January 1, 2005;
105(1):
308 - 316.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Amoui, S.-M. Suhr, D. J. Baylink, and K.-H. W. Lau
An osteoclastic protein-tyrosine phosphatase may play a role in differentiation and activity of human monocytic U-937 cell-derived, osteoclast-like cells
Am J Physiol Cell Physiol,
October 1, 2004;
287(4):
C874 - C884.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Motiwala, H. Kutay, K. Ghoshal, S. Bai, H. Seimiya, T. Tsuruo, S. Suster, C. Morrison, and S. T. Jacob
Protein tyrosine phosphatase receptor-type O (PTPRO) exhibits characteristics of a candidate tumor suppressor in human lung cancer
PNAS,
September 21, 2004;
101(38):
13844 - 13849.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Wilkinson, E. R. P. Velloso, L. F. Lopes, C. Lee, J. C. Aster, M. A. Shipp, and R. C. T. Aguiar
Cloning of the t(1;5)(q23;q33) in a myeloproliferative disorder associated with eosinophilia: involvement of PDGFRB and response to imatinib
Blood,
December 1, 2003;
102(12):
4187 - 4190.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Amoui, D. J. Baylink, J. B. Tillman, and K.-H. W. Lau
Expression of a Structurally Unique Osteoclastic Protein-tyrosine Phosphatase Is Driven by an Alternative Intronic, Cell Type-specific Promoter
J. Biol. Chem.,
November 7, 2003;
278(45):
44273 - 44280.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. J. Pixley, P. S. W. Lee, J. S. Condeelis, and E. R. Stanley
Protein Tyrosine Phosphatase {phi} Regulates Paxillin Tyrosine Phosphorylation and Mediates Colony-Stimulating Factor 1-Induced Morphological Changes in Macrophages
Mol. Cell. Biol.,
March 1, 2001;
21(5):
1795 - 1809.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
R. C. T. Aguiar, Y. Yakushijin, S. Kharbanda, R. Salgia, J. A. Fletcher, and M. A. Shipp
BAL is a novel risk-related gene in diffuse large B-cell lymphomas that enhances cellular migration
Blood,
December 15, 2000;
96(13):
4328 - 4334.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION