|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 7 (October 1), 1999:
pp. 2433-2444
M-Ras, a Widely Expressed 29-kD Homologue of p21
Ras: Expression of a Constitutively Active Mutant Results in
Factor-Independent Growth of an Interleukin-3-Dependent Cell Line
By
Götz R.A. Ehrhardt,
Kevin B. Leslie,
Frances Lee,
James S. Wieler, and
John W. Schrader
From The Biomedical Research Centre, University of British Columbia,
Vancouver, BC, Canada.
 |
ABSTRACT |
M-Ras, a recently identified homologue of p21 Ras, is widely
expressed, with levels of the 29-kD protein in spleen, thymus, and NIH
3T3 fibroblasts equaling or exceeding those of p21 Ras. A G22V mutant
of M-Ras was constitutively active and its expression in an
interleukin-3 (IL-3)-dependent mast cell/megakaryocyte cell line
resulted in increased survival in the absence of IL-3, increased growth
in IL-4, and, at high expression levels, in factor-independent growth.
Expression of M-Ras G22V, however, had a negative effect on growth in
the presence of IL-3, suggesting that M-Ras has both positive and
negative effects on growth. Expression of M-Ras G22V in NIH-3T3
fibroblasts resulted in morphological transformation and growth to
higher cell densities. M-Ras G22V induced activation of the
c-fos promoter, and bound weakly to the Ras-binding domains of
Raf-1 and RalGDS. Expression of a mutant of M-Ras G22V that was no
longer membrane-bound partially inhibited (40%) activation of the
c-fos promoter by N-Ras Q61K, suggesting that M-Ras shared some, but not all, of the effectors of N-Ras. An S27N mutant of M-Ras,
like the analogous H-Ras S17N mutant, was a dominant inhibitor of
activation of the c-fos promoter by constitutively active Src Y527F, suggesting that M-Ras and p21 Ras shared guanine nucleotide exchange factors and are likely to be activated in parallel. Moreover, M-Ras was recognized by the monoclonal anti-Ras antibody Y13-259, commonly used to study the function and activity of p21 Ras. Mammalian M-Ras and a Caenorhabditis elegans orthologue
exhibit conserved structural features, and these are likely to mediate
activation of distinctive signaling paths that function in parallel to
those downstream of p21 Ras.
© 1999 by The American Society of Hematology.
 |
INTRODUCTION |
THE H-, N-, AND K-Ras proteins,
collectively termed here p21 Ras proteins, have been implicated in a
wide variety of cellular responses, ranging from proliferation and
differentiation1,2 to cell death.3 They are
encoded by 3 genes: Harvey (H), N, and Kirsten (K), which is
alternatively spliced and generates 2 proteins: K-RasA and K-RasB. The
p21 Ras proteins are attached to the inner leaflet of the plasma
membrane by carboxy-terminal lipid modifications. They function as
biological switches and, upon hydrolysis of bound guanosine
triphosphate (GTP) to guanosine diphosphate (GDP),
undergo allosteric changes in 2 adjacent, highly conserved regions of
the molecule, termed "switch I" (residues 32-38 in H-Ras) and
"switch II" (residues 60-76 in H-Ras).4,5 In their
active, GTP-bound state, the p21 Ras proteins bind a series of effector
molecules that include serine/threonine kinases such as Raf-1, A-Raf,
B-Raf,6,7 and MEKK18; the p110 catalytic
subunit of PI-3 kinase9; and
Ral-GDS.10 Interaction of p21 Ras-GTP with
all of these effectors involves its "effector loop" that extends
from residues 32-40 and encompasses switch I, although genetic and
x-ray crystallographic analyses indicate that the mechanisms through
which these different effectors interact with p21 Ras are structurally
distinct.11,12
Activating mutations of p21 Ras occur in some 20% to 30% of acute
myeloid leukemias (AML) and myelodysplastic syndromes,13 and can reach frequencies as high as 90% in pancreatic
carcinomas.14 However, in contrast to the results of
experiments in NIH-3T3 fibroblasts, where expression of activated
mutants of p21 Ras results in transformation and reduced dependence on
growth factors, expression of activated mutants of p21 Ras in cells of
hematopoietic origin, for example in AML blasts, does not in general
confer factor-independence.13 Ablation of functional K-Ras
genes in mice results in anemia and intrauterine death, indicating that p21 K-Ras proteins have a critical role in the development of the
hematopoietic system.15
Clues to the function of p21 Ras proteins in normal hematopoietic cells
have come from experiments suggesting that p21 Ras proteins are
activated by ligation of receptors for growth factors,16,17 antigen,18,19 or other ligands, and that inhibition of the activation of p21 Ras can block the growth20 or development of lymphohematopoietic cells.21,22 This evidence has
largely depended on two research tools: the monoclonal anti-Ras
antibody Y13-259, used to measure activation of p21 Ras and to inhibit its function, and dominant-negative mutants such as S17N Ras, used to
inhibit activation of p21 Ras. Y13-259 binds to p21 Ras isoforms via an
epitope in switch II,23 thus blocking their interaction
with Raf-1,24 and inhibits growth when microinjected into
cells.25 The standard assay for assessing activation of p21
Ras is based on immunoprecipitation with Y13-259 and measurement of the
ratio of GTP:GDP in the precipitate, and is the basis of reports that
have concluded that p21 Ras is activated in cells of hematopoietic
origin by hematopoietic growth factors16,17 or by ligation
of antigen receptors.18,19 Dominant negative mutants such
as p21 Ras S17N have an increased affinity for p21 Ras
GDP26 and are thought to sequestrate guanine nucleotide exchange factors (GEFs) and, thus, block activation of endogenous p21
Ras. Expression of p21 Ras S17N has been used to implicate p21 Ras in
the development of B and T lymphocytes21,22 as well as in
signaling downstream of oncogenes, growth factors, cytokines, and other
ligands.20,26-28
The p21 Ras proteins are members of a larger family that also includes
R-Ras and R-Ras2/TC21.29,30 Two recent reports describe a
new member of this family termed M-Ras,31 referring to its cloning from muscle, or R-Ras3,32 on the basis of homology
with R-Ras and R-Ras2. Mutants with decreased GTPase activity induced the formation of microspikes in Swiss 3T3 cells,31 focus
formation and anchorage-independent growth in NIH 3T3 cells, and
moderate activation of Erk (extracellular signal-regulated
kinase).32 Both groups reported that the pattern of
expression was restricted, to brain and heart,32 or to
brain and skeletal muscle.31
Here we show that in contrast to these reports, expression of M-Ras is
not restricted to brain or muscle and occurs in thymus, spleen, and
cell lines of hematopoietic origin, as well as in epithelial cells.
Expression of constitutively active M-Ras in an IL-3-dependent
hematopoietic cell line resulted in factor-independent growth.
Moreoever, M-Ras could not be distinguished from p21 Ras in functional
tests based on the monoclonal antibody Y13-259 or the dominant negative
M-Ras mutant S27N. Analysis of the protein sequences of M-Ras and other
members of the Ras-family showed that M-Ras displays distinctive motifs
that differ from those found in R-Ras and R-Ras2 on the one hand, and
p21 Ras on the other. Our data suggest that M-Ras is likely to be
activated by the same stimuli that activate p21 Ras, but that it
activates parallel pathways that regulate cellular growth.
 |
MATERIALS AND METHODS |
Materials.
Plasmids encoding the GST-fusion proteins GST-Raf-1-RBD and
GST-RalGDS-RBD were kindly provided by Dr D. Shalloway (Cornell University, New York, NY) and Dr J. Bos (Utrecht
University, Utrecht, The Netherlands), respectively, Src Y527F by Dr J. Cooper (Fred Hutchinson Center, Seattle, WA), and N-Ras Q61K by Dr R. Kay (The Terry Fox Laboratory, Vancouver, Canada). Biotinylated or
native antibodies against the HA-epitope (12CA5) were purchased from Boehringer Mannheim (Boehringer Mannheim, Laval, Quebec, Canada) and Cy
Chrome5-conjugated streptavidin from Pharminogen Canada (Mississauga,
Ontario, Canada).
Generation of antisera.
Rabbits were injected with peptides corresponding to residues 187-204 (KKKTKWRGDRATGTHKLQ, pep I) and 142-159 (KEMATKYNIPYIETSAKD, pep II) of
M-Ras, respectively. For immunizations both peptides were fused to the
C-terminus of the tetanus toxoid epitope QYIKANSKFIGITEL.33 For affinity purification of the polyclonal antisera, the peptides were
covalently bound to NHS-activated Sepharose (Pharmacia Biotech, Uppsala, Sweden). Antibodies bound to the affinity-purification column
were washed with 10 column volumes of phosphate-buffered saline (PBS),
eluted with 3 mL of 100 mmol/L glycine (pH 2.5), and dialyzed against 2 L of PBS overnight.
Cell culture, transfections, and retroviral infections.
All cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM),
supplemented with 2 mmol/L L-glutamine, 100 U penicillin/50 U
streptomycin (Stem Cell Technologies, Vancouver, Canada), and 10%
fetal calf serum R6-X cells (293-cells and BOSC23) or 10% calf serum
(NIH3T3). R6-X, an interleukin-3 (IL-3)-dependent bipotential, mast
cell/megakaryocyte line,34 was passaged in the presence of
medium conditioned by the cell line WEHI-3B (2% of 10-fold concentrated medium, W3) as a source of IL-3. NIH 3T3 cells were kindly
provided by Dr R. Kay. For retroviral infections, R6-X cells or NIH3T3
cells were incubated for 10 hours with retroviruses produced as
described,35 in the presence of 10 µg/mL polybrene and,
in the case of R6-X cells, 2% W3 and 2% of a 10-fold concentrate of
medium conditioned by X063 cells secreting IL-4.36 After 10 hours, the R6-X cells were washed and resuspended in medium supplemented with IL-4 alone. In the case of 3T3 cells and, in some
experiments, R6-X cells, infected clones were selected in puromycin at
1 µg/mL (Sigma, Mississauga, Ontario, Canada), and in the case of
R6-X in the presence of 2% W3 as a source of IL-3. Analysis of growth
and survival of polyclonal or clonal population of virally infected
cells R6-X cells involved cell counting, assessment of uptake of
3,4,5-dimethyltiazole-2,5-diphenyltetrazolium bromide (MTT), or clonal
growth in agar. For assessment of growth or survival using MTT, cells
were plated at varying densities as indicated, in 96-well,
flat-bottomed plates, with titrated amounts of growth factors as
indicated. MTT uptake was assessed 3 to 5 days later. Colony assays
were performed by plating cells in medium and indicated growth factors
in a final concentration of 0.3% agar (Difco, Detroit, MI).34 R6-X cells were cloned by picking colonies from
agar. In some cases, populations were enriched in enhanced green
fluorescent protein (EGFP)-expressing cells by fluorescence-activated
cell sorting using a FACSCalibur instrument (Becton Dickinson, San Jose, CA). Experiments were performed on retrovirally
infected R6-X cells derived from 2 independent infections with
consistent results.
Generation of mutations by site-directed mutagenesis.
The M-Ras cDNA was subcloned into pBluescript for site-directed
mutagenesis and sequencing. Constructs were cloned with N-terminal myc-
or HA-tags or C-terminal myc-tags into the eukaryotic expression vectors pEF-BOS or pcDNA3.1, or, for retroviral infections, into pMX-PIE (a gift of Dr Alice Mui, DNAX, San Francisco, CA). This vector
drives expression of the EGFP from an internal ribosomal entry site
(IRES) downstream of the Ras cDNA. Identities of all constructs were verified by DNA-sequencing.
Northern blot analysis and reverse transcription-polymerase chain
reaction (RT-PCR).
Northern blots were performed according to the manufacturer's
instructions (CLONTECH, Palo Alto, CA) with a probe corresponding to
the 120 carboxy-terminal amino acids of M-Ras. RT-PCR was performed on
2 µg of total RNA from the indicated cell lines. Oligonucleotides used were GTGAGTGCCGGTGGCCCTGTCTCCCTCGC (RT-reaction),
TTTGGTTGCCATTTCTTTTCCTTGGTCCC (PCR antisense),
ACCAGCGCTGTTCCAAGTGAAAAC- CTTCC (PCR sense), CACATATAAACTAGTAGTGGTGGGAGATGG (nested PCR sense),
CTTAGGTGCATCAGATCCACCTTGTTG (nested PCR antisense). As negative
control, the RT-reaction was performed on 2 µg of t-RNA. The
identities of the amplified fragments were verified by a restriction digest.
Reporter gene assays.
293-cells were cotransfected with 0.25 to 0.5 µg of the luciferase
reporter gene under control of the full-length c-fos promoter and the indicated plasmids. Cells were harvested 48 hours after transfection and lysed in 200 µL of lysis buffer (Promega, Madison, WI). Luciferase activity was determined with a luminometer (Dynex, Chantilly, VA) and the values normalized to total protein using BCA
Protein Reagent A (Pierce, Rockford, IL).
Immunoblotting, immunoprecipitation, and affinity precipitation.
Transiently transfected 293-cells were washed twice in PBS and lysed in
500 µL of 50 mmol/L Tris-HCl (pH 7.5), 150 mmol/L NaCl, 1% NP-40, 5 mmol/L EDTA, in the presence of 10 µg/mL each of leupeptin,
aprotinin, soybean trypsin inhibitor, 0.7 µg/mL pepstatin, and 40 µg/mL phenylmethyl sulfonyl fluoride (PMSF). Denatured proteins were
subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) and immunoblotted with `anti-HA' antibody 12CA5 at 0.2 µg/mL or anti-Ras antibody Y13-259 at 15 µg/mL, as
described.16 To decrease the Ig-light chain signal, we used
secondary antibodies recognizing specifically the Ig-heavy chain.
Affinity purifications to assay binding of M-Ras to the Ras-binding
domains of Raf-1 and Ral-GDS were performed as described.37 Briefly, GST-fusion proteins were affinity-purified with glutathione beads from lysates of Escherichia coli. Fifteen microliters of packed bead volume was mixed for 40 minutes with lysates of 293-cells expressing the indicated proteins in 25 mmol/L HEPES (pH 7.5), 150 mmol/L NaCl, 10% glycerol, 0.25% Na-deoxycholate, 1% NP-40, 25 mmol/L NaF, 10 mmol/L MgCl2, 1 mmol/L EDTA, 1 mmol/L Na
vanadate, 10 µg/mL leupeptin, and 10 µg/mL aprotinin. The beads
were washed with lysis buffer, boiled, and the eluted proteins resolved
on 15% denaturing polyacrylamide gels. Cell fractionations were
performed by suspending cells in homogenization-buffer (10 mmol/L
TRIS-HCl [pH 7.5], 1 mmol/L EDTA, 10 µg/mL each of leupeptin,
aprotinin, and soybean trypsin inhibitor, 0.7 µg/mL pepstatin, and 40 µg/mL PMSF). Cells were broken by brief sonication,
the nuclei were pelleted, and the supernatant subjected to
ultra-centrifugation for 20 minutes at 150,000g. The resulting
supernatant was designated as cytosolic fraction (c) and the pelleted
fraction as membrane enriched fraction (m).
 |
RESULTS |
Uniquely conserved characteristics of the C-terminus of M-Ras in
mammals and Caenorhabditis elegans.
We identified a novel member of the Ras-family in the murine expressed
sequence tag (EST) database. The cDNA encoded a small GTPase that was
also described as M-Ras31 and R-Ras3.32 We also
identified an orthologous protein in the C elegans database. M-Ras exhibits a high degree of homology with other members of the
Ras-family, with 47% identity with H-Ras and 52% with R-Ras2. Although it is identical in the switch I region (residues 42-48), it
displays only 3 conserved exchanges in the switch II region (residues
70-86). Significantly, none of the residues in switch II shown to be
involved in binding of Y13-259 to p21 Ras23 differed between H-Ras and M-Ras. Comparison of the carboxy-terminal sequences of the murine and C elegans M-Ras orthologues with those of p21 Ras, R-Ras, and R-Ras2 indicated that M-Ras had distinctive
characteristics and suggested that M-Ras was a discrete branch of this
phylogenetic tree. Figure 1 shows
alignments of the translated protein sequences of the C-termini of
M-Ras and its C elegans orthologue with those of other members
of the family of small GTPases. In contrast to R-Ras and R-Ras2, M-Ras
and its C elegans orthologue lacked the cysteine-residues
(double-underlined in Fig 1) close to the C-terminus that are necessary for palmitoylation. Moreover, murine and C elegans M-Ras lacked a proline-rich motif characteristic of the C-termini of R-Ras and R-Ras2, which we term the R-Ras box (shaded medium gray in Fig 1). Instead, M-Ras and its C elegans
orthologue exhibited a distinctive motif, rich in basic residues
(shaded dark gray in Fig 1). It included a threonine residue at
position 190 of murine M-Ras which, as noted by
Matsumoto et al,31 might serve as a target
for phosphorylation. The C-terminus of murine M-Ras displayed a stretch
of lysine residues (underlined in Fig 1) which resembles that occurring
at the C-termini of K-RasB and also Rap-1. Other residues conserved
between M-Ras and its C elegans orthologue included a
tryptophan at position 60 of M-Ras (a threonine in p21 Ras), a
hydrophobic residue at position 51 (an arginine in p21 Ras), and, at
position 159, a D/EPP motif, which is likely to alter tertiary
structure.

View larger version (37K):
[in this window]
[in a new window]
| Fig 1.
Comparison of the amino acid sequence of the C-terminus
(residues 183-208) of M-Ras and a C elegans orthologue of M-Ras
(Ce) with R-Ras, R-Ras2, H-, N-, and K-RasA/B. All sequences
are murine with the exception of R-Ras2 (human). Gaps are indicated by
a hyphen (-). The CAAX-motifs are boxed. Shaded areas indicate regions
of homology between M-Ras and its C elegans orthologue (dark
gray), the proline-rich R-Ras box (medium gray), and conserved regions
in H-Ras, N-Ras, and K-RasA (light gray). Poly-lysine motifs in M-Ras
and K-RasB are underlined. Cysteine residues that might be
palmitoylated are double underlined. C elegans
sequence accession no. is CE00958.
|
|
M-Ras is widely expressed.
To assess the pattern of expression of M-Ras mRNA, RT-PCR and Northern
blot analysis was performed. Using RT-PCR, we observed expression of
M-Ras mRNA in all cell lines examined, including hematopoietic cell
lines, fibroblasts, and epithelial cells derived from breast, skin, and
kidney (Table 1). Northern Blot analysis showed 2 major transcripts of approximately 1.5 kb and 4.6 kb that were
expressed highly in brain and heart tissues with lesser but significant
levels in liver, lung, pancreas, placenta, and kidney
(Fig 2A). Thus, in contrast with the
conclusions of other reports,31,32 M-Ras was expressed
widely.



View larger version (137K):
[in this window]
[in a new window]
| Fig 2.
Tissue distribution of M-Ras. (A) Northern blots with
poly (A)+ RNAs from the indicated human tissues were
probed with the C-terminal portion of human M-Ras cDNA. (B) Lysates of
293-cells transiently expressing HA-tagged M-Ras or N-Ras were resolved
on SDS-PAGE and immunoblotted with anti-HA antibody 12CA5. The same
blot was stripped and immunoblotted with Y13-259, the M-Ras specific
pep I antibodies, and the cross-reactive pep II antibodies. (C)
Lysates of the indicated tissues and of NIH 3T3 fibroblasts were
subjected to immunoprecipitation with 15 µg Y13-259. The
immunoprecipitates were resolved on SDS-PAGE and immunoblotted with
M-Ras-specific antibodies ( pep I, top panel) or antibodies that
cross-reacted between M-Ras and p21 Ras ( pep II, bottom panel).
|
|
Relative levels of p21 and M-Ras proteins in spleen and thymus.
To examine the levels of expression of the endogenous M-Ras
protein, we generated preparations of polyclonal antibodies that were specific for M-Ras ( pep I, Fig 2B) or that recognized both M-Ras and, with approximately 3-fold less efficiency, p21 Ras ( pep
II, Fig 2B). Immunoprecipitations were performed on whole-cell lysates of spleen, thymus, and various other tissues and cell lines
using Y13-259. The immunoprecipitates were resolved on SDS-PAGE and immunoblotted either with the M-Ras-specific antibodies ( pep
I) or the antibodies recognizing both M-Ras and p21 Ras ( pep II).
M-Ras was detected as a discrete band of an apparent molecular weight
of 29 kD in all tissues and cell lines examined (Fig 2C, top panel).
Use of the cross-reactive pep II antibody permitted comparisons of
relative levels of expression of M-Ras and p21 Ras. Immunoblotting of
these immunoprecipitates showed levels of expression of M-Ras in the
spleen and thymus that respectively exceeded or equalled those of p21
Ras. M-Ras protein was also detected in heart, brain, and NIH 3T3
fibroblasts (Fig 2C, bottom panel).
M-Ras is recognized by the monoclonal anti-Ras antibody Y13-259.
The monoclonal anti-p21 Ras antibody Y13-259 has been used extensively
to monitor activation or function of p21 Ras. On the basis of the
similarity of the switch II regions of M-Ras and p21 Ras, we next
investigated the reactivity of M-Ras with the monoclonal anti-p21 Ras
antibody Y13-259. Y13-259 recognized M-Ras and N-Ras with equivalent
efficiency in immunoblotting of lysates of 293-cells expressing
HA-tagged M-Ras or N-Ras (Figs 2C and 3).
Importantly, for the interpretation of assays of the activation of p21
Ras, Y13-259 immunoprecipitated M-Ras and N-Ras from those cell lysates
with equivalent efficiency (Fig 3).

View larger version (33K):
[in this window]
[in a new window]
| Fig 3.
M-Ras is recognized by the monoclonal anti-Ras antibody
Y13-259. Lysates of 293-cells transiently expressing myc-tagged M-Ras
or HA-tagged N-Ras were subjected to immunoprecipitation with 10 µg
of Y13-259. The immunoprecipitates, in parallel with samples of the
same lysates (WCL), were resolved on SDS-PAGE and immunoblotted with
Y13-259 as described.
|
|
Polyclonal populations of an IL-3-dependent cell line expressing a
G22V mutant of M-Ras exhibit increased survival and growth in IL-4.
To investigate the oncogenic potential of M-Ras, we constructed a G22V
mutant of M-Ras (M-Ras G22V) that, by analogy with mutants of other
small GTPases, was predicted to be constitutively active. We used a
retroviral vector to express M-Ras G22V in a murine IL-3-dependent
cell-line, R6-X. The vector encoded a puromycin-resistance gene driven
by an SV40 promoter and an EGFP gene that was expressed downstream of
an IRES site, from the same mRNA as M-Ras G22V. Polyclonal populations
of R6-X cells infected with either the M-Ras G22V retrovirus or a
control virus encoding EGFP alone were derived by either selection in
the presence of IL-3 and puromycin or by fluorescence-activated cell
sorting (termed "sorted" populations). M-Ras expression was
verified by immunoblotting and 2-color flow cytometry using a
monoclonal antibody specific for the HA tag present on M-Ras G22V. The
expression of M-Ras G22V varied widely within the polyclonal
populations and on a cell-for-cell basis was correlated with expression
of EGFP.
We observed that expression of M-Ras G22V resulted in marked changes in
survival. When cultured in the absence of IL-3, polyclonal populations
of R6-X cells expressing M-Ras G22V (R6-X M-Ras G22V) exhibited
increased survival relative to the parental cells or R6-X cells
expressing only EGFP (data not shown). This ability of R6-X cells
expressing M-Ras G22V to survive in the absence of IL-3 was confirmed
in an experiment in which parental R6-X or a polyclonal population of
R6-X expressing M-Ras G22V were plated in agar in the absence of IL-3
for 4 days, after which IL-3 was added. The delayed addition of IL-3 to
cultures of parental cells did not result in any colony growth. In
contrast, R6-X cells expressing M-Ras G22V showed increased resistance
to deprivation of IL-3, and many colonies grew in response to the
delayed addition of IL-3 (data not shown). R6-X cells expressing M-Ras
G22V also differed from parental cells in their ability to grow in
IL-4. Parental R6-X cells failed to grow continuously in IL-4 alone, consistent with evidence that IL-4 is not a true growth
factor.38 In contrast, polyclonal populations of R6-X cells
expressing M-Ras G22V exhibited enhanced survival and growth in the
presence of IL-4 (Fig 4).

View larger version (17K):
[in this window]
[in a new window]
| Fig 4.
Enhancement of growth of polyclonal populations of R6-X
M-Ras G22V by IL-4. Polyclonal populations of R6-X M-Ras G22V (closed
symbols) or of parental cells (open symbols) were plated at 500 cells
per well in 96-well plates in medium alone ( , ) or medium
supplemented with decreasing amounts of synthetic IL-3 starting at 2 µg/mL ( , ) or recombinant IL-4 (10 ng/mL) ( , ). Cell
numbers were assessed at day 6 by uptake of MTT. Results are shown as
optical densities (OD) of triplicate cultures ± SEM.
|
|
High levels of expression of active M-Ras result in
factor-independent growth but reduced growth in the presence of IL-3.
Continued observation of polyclonal populations of cells expressing
M-Ras G22V cultured in the absence of IL-3 showed a subpopulation of
cells that failed to die and slowly increased in number. Plating of
polyclonal populations of R6-X M-Ras G22V in agar in the absence of
IL-3 for 7 days resulted in the growth of small colonies at a low
frequency (<0.2%) of the cells plated
(Fig 5A). This low frequency of cells
capable of forming colonies in the absence of IL-3 could have reflected
functional heterogeneity of the polyclonal population, or,
alternatively, an intrinsically low cloning efficiency of R6-X M-Ras
G22V cells in the absence of IL-3. To address this question, we cloned
cells from randomly selected colonies that had grown in medium alone,
and we cloned cells from randomly selected colonies
that had developed at high frequency (35% of plated cells) in the
presence of IL-3. Two series of clones of R6-X M-Ras G22V were expanded
in IL-3, 1 derived from colonies that had developed in medium alone
(termed the M series), and 1 derived from colonies that had developed
in IL-3 (termed the F series). These 2 series of clones were then
washed and their survival in the absence of IL-3 compared. Cells of the
M series of clones, derived from colonies grown in the absence of IL-3,
failed to die when cultured in medium alone. In contrast, with a few
notable exceptions, most of the clones derived from the F series of
colonies grown in IL-3 exhibited significant cell death when deprived
of IL-3. Inspection by fluorescent microscopy of cultures of the 2 series of clones growing optimally in IL-3 showed that cells of all of
the M series clones, derived from colonies grown in the absence of
IL-3, were bright green, whereas the F series clones, derived from the
randomly chosen colonies grown in IL-3, varied in brightness, with most
exhibiting only a low EGFP signal. There was a strong correlation
between survival in the absence of IL-3 and brightness (Fig 5B).
Similarly, when these clones were pated in agar in the absence of IL-3,
there was a clear correlation between the brightness of the EFP signal and the size and frequency of colonies (data not shown). These results
suggested that the ability to survive and grow in the absence of IL-3
correlated with levels of expression of M-Ras G22V. This was confirmed
directly by assessing levels of M-Ras G22V by immunoblotting of cell
lysates with anti-HA antibodies (Fig 5C).



View larger version (59K):
[in this window]
[in a new window]
| Fig 5.
Expression of constitutively active M-Ras G22V in an
IL-3-dependent cell line results in factor-independent growth. (A)
Polyclonal, puromycin-resistant R6-X M-Ras G22V cells ( ) or parental
R6-X cells ( ) were plated in agar in triplicate in the absence of
IL-3 at 2.5 × 104 per mL or 2.5 × 103/mL
(as indicated). Colonies were counted at day 7 using a
colony-microscope. (B) Correlation of levels of expression of M-Ras
G22V with factor-independent growth. Clones of R6-X M-Ras G22V cells
derived from colonies grown in medium alone (M series; ) or in the
presence of IL-3 (F series; ) were expanded in IL-3, washed, and
incubated in medium alone for days, when survival and growth were
assessed by uptake of MTT as described above. The uptake of MTT
(expressed as OD units) was plotted against the mean intensity of
fluorescence (MFI) of EGFP assessed by flow cytometry of the same
clones grown in the presence of IL-3. (C) Correlated expression of EGFP
and M-Ras G22V. Twenty micrograms of whole-cell
lysates of 4 of the clones shown in (B) above, 2 exhibiting high EGFP
expression (M.4, MFI 1775, and M.6, MFI 2271) and 2 with low EGFP
expression (F.1, MFI 216, and F.3, MFI 474), were immunoblotted using a
monoclonal antibody specific for the HA-tag present on the M-Ras G22V.
Also shown are lysates of parental R6-X cells and of a "sorted,"
polyclonal population of M-Ras G22V-expressing R6-X cells, selected by
fluorescence-activated cell sorting (FACS) and culture in IL-4
(sorted), and of a population of R6-X cells infected with empty vector
(vector alone).
|
|
Although there was a clear positive correlation between the levels of
expression of M-Ras G22V and the ability to grow in the absence of
IL-3, the reverse was the case for growth in the presence of IL-3. A
comparison of the growth in the presence and absence of IL-3, of
parental R6-X cells and a population of R6-X cells selected for high
levels of expression of M-Ras G22V (Fig 6),
showed that although over 10 days the M-Ras G22V expressing cells
expanded 6,000-fold in the absence of IL-3, they expanded 10-fold less
in the presence of IL-3 than did the parental cells.


View larger version (88K):
[in this window]
[in a new window]
| Fig 6.
Expression of M-Ras G22V in an IL-3-dependent line
results in factor-independent growth in the absence of IL-3, but
decreased growth in its presence. (A) Parental R6-X (open symbols) or
an FACS-sorted population expressing M-Ras G22V (closed symbols) were
cultured in triplicate at 104/mL in medium alone (circles
, ) or in the presence of IL-3 (2% W3) (squares , ). Cells
were counted at the indicated intervals and counts are shown as the
mean ± SEM. (B) Parental R6-X cells or clones expressing high (clone
F.3; MFI 474) or low (clone M.4; MFI 1775) levels of M-Ras G22V, or the
polyclonal "sorted" population expressing high levels of M-Ras
G22V cells (sorted), were plated in agar for 7 days in 2% W3 at
3 × 102 per mL. The mean ± SEM of numbers of
colonies or in the case of M.4 and St, colonies and clusters, in
triplicate cultures is shown under the images of representative plates
of each triplicate. To visualize colonies, plates were stained with
acridine orange (1 µg/mL) and the images were captured using a
Canberra Packard photodocumentation system (Alpha
Innotech Corp, San Leandro, CA).
|
|
When clones expressing different levels of M-Ras G22V were plated in
agar in the presence of IL-3, those expressing low levels of M-Ras G22V
developed colonies with the same size, morphology, and frequency as
parental cells (Fig 6B). In contrast, colonies developed from clones
expressing the highest levels of M-Ras G22V were much smaller and less
dispersed than those of the parental cells and occurred at lower
frequency, with many of the clonogenic cells forming clusters of less
than 30 cells (Fig 6B). This antagonistic effect of
activated M-Ras on IL-3-stimulated growth also depended on the
concentration of IL-3. Thus, when polyclonal populations of R6-X cells,
most of which expressed lower or medium levels of M-Ras G22V, were
plated in agar at supraoptimal concentrations of IL-3, the colonies
that grew were half as frequent and smaller and less dispersed than
those grown from parental cells. However, at 10-fold lower optimal
concentrations of IL-3, the number and size of colonies derived from
parental cells and the polyclonal population of M-Ras G22V expressing
cells were similar (data not shown).
M-Ras G22V transforms NIH 3T3 fibroblasts.
We used retroviral vectors to express wild-type M-Ras, M-Ras G22V, or
N-Ras Q61K in NIH-3T3 fibroblasts. As shown in
Fig 7A, NIH 3T3 cells expressing M-Ras
G22V, but not those expressing wild-type M-Ras, exhibited a refractile,
transformed morphology, strongly resembling that of the cells
expressing N-Ras Q61K. Cells expressing M-Ras G22V, but not those
expressing wild-type M-Ras, also resembled cells expressing N-Ras Q61K
in gaining the ability to grow to higher saturation densities
(Fig 7B).





View larger version (622K):
[in this window]
[in a new window]
| Fig 7.
Transformation of NIH 3T3 fibroblasts by constitutively
active M-Ras G22V. (A) NIH 3T3 fibroblasts were retrovirally transduced
with (a) empty vector, (b) N-Ras Q61K, (c) M-Ras wt, or (d) M-Ras G22V.
Shown are phase-contrast photomicrographs of cells grown in medium
containing 10% calf serum. (B) Cell densities reached by polyclonal
populations of NIH3T3 cells expressing vector alone ( ), M-Ras wt
( ), M-Ras G22V ( ), and N-Ras Q61K ( ). Cells were grown in 10%
calf serum and figures represent data from 2 independent experiments,
each performed in triplicate, and are shown as means ± SD.
|
|
Expression of activated M-Ras activated the c-fos
promoter.
We tested the ability of M-Ras and mutants of M-Ras to activate the
c-fos promoter using the luciferase reporter gene assay. Expression of wild-type M-Ras did not activate the c-fos
promoter (Fig 8A). However, expression of
the G22V mutant of M-Ras resulted in 3-fold activation of the
c-fos promoter. This was reproducibly less than the 9-fold
activation of the c-fos promoter induced by N-Ras Q61K (Fig
8A).


View larger version (30K):
[in this window]
[in a new window]
| Fig 8.
Activation of the c-fos promoter by M-Ras;
evidence for sharing of effectors with p21 Ras. Shown are relative
luciferase units derived from assays of lysates of 293-cells
transiently transfected with 0.25 µg of the c-fos luciferase
reporter plasmid and: (A) 3 µg of the indicated plasmids; (B) 0.25 µg of a N-Ras Q16K plasmid and the indicated amounts of M-Ras G22V
plasmids. Results represent data from 6 (A) or 3 (B) independent
experiments and are shown as mean ± SD. All transient transfections
contained equal amounts of total plasmid DNA, normalized with empty
vector containing the same promoter. The lower panel of (B) shows
results of a cell-fractionation experiment. Lysates of N-terminally
tagged M-Ras G22V or C-terminally tagged M-Ras G22V (CTm) were
subjected to ultra-centrifugation. Samples of whole-cell lysate (wcl),
the membrane-enriched fraction (m) and the cytosolic fraction (c) were
separated on SDS-PAGE and immunoblotted with anti-myc-epitope antibody
9E10.
|
|
To explore whether M-Ras also shared effector molecules with members of
the p21 Ras family, we expressed an activated M-Ras G22V that was
modified at the C-terminus so that it was no longer localized at the
plasma membrane and remained in the cytoplasm (Fig 8B, bottom panel).
Expression of this cytoplasmic form of M-Ras G22V (CTm) failed to
activate the c-fos reporter gene construct (Fig 8B, top panel).
However, expression of M-Ras G22V (CTm) inhibited activation of the
c-fos promoter induced by coexpressed N-Ras Q61K. This
inhibition was dose-dependent but partial, reaching a maximum of about
40% when the ratio of plasmid DNA encoding M-Ras G22V (CTm) to that
encoding N-Ras Q61K reached 2:1 (Fig 8B, top panel). This inhibitory
effect required that M-Ras was in the active, GTP-bound conformation,
as expression of carboxy-terminally modified M-Ras S27N failed to
inhibit activation of the c-fos promoter by N-Ras Q61K (data
not shown).
Expression of dominant negative M-Ras S27N completely inhibits
activation of the c-fos promoter by activated Src.
To investigate the possibility that M-Ras shared exchange factors with
p21 Ras proteins, we generated an S27N mutant of M-Ras, analogous to
the S17N dominant inhibitory mutants of p21 Ras. Expression of M-Ras
S27N itself failed to activate transcription of the c-fos
promoter (Fig 8A). However, when coexpressed it completely suppressed
activation of the c-fos promoter induced by expression of
constitutively active Src Y527F (Fig 9).
Thus, M-Ras S27N acted, like H-Ras S17N, as a dominant inhibitor of the
Src pathway to the c-fos promoter (Fig 9).

View larger version (12K):
[in this window]
[in a new window]
| Fig 9.
Dominant inhibitory effect of expression of M-Ras S27N on
activation of c-fos promoter by activated Src Y527F. 293-cells
were transfected as described in the legend to Fig 8 with 0.25 µg of
the c-fos luciferase reporter plasmid and 0.25 µg of a Src
Y527F plasmid and the indicated amount in micrograms of the indicated
plasmids. Shown are relative luciferase units expressed as the mean ± SD of 3 independent experiments.
|
|
Interaction of activated M-Ras with Raf-1 and Ral-GDS.
We investigated whether constitutively active M-Ras interacted directly
with two known effectors of p21 Ras, Raf-1 and Ral-GDS. The binding of
M-Ras G22V to the Ras-binding domain (RBD) of Raf-1 was readily
detectable, although the amounts of M-Ras G22V present in eluates were
significantly less than those of Q61K N-Ras observed in parallel
experiments (Fig 10). This indicated that
M-Ras G22V interacted with the Raf-1-RBD with lower affinity than did
N-Ras Q61K. Likewise, M-Ras G22V bound detectably to RalGDS-RBD. Again, comparison of the amount of M-Ras G22V bound with that of N-Ras Q61K
indicated that M-Ras G22V had a lower affinity for Ral-GDS. Nevertheless, both the binding of M-Ras G22V to the Raf-1-RBD and to
the RalGDS-RBD were inhibited by Y13-259, showing that in both cases
binding was specific (data not shown). As expected, neither the RBD of
Raf-1, nor that of RalGDS, bound to wild-type M-Ras.

View larger version (22K):
[in this window]
[in a new window]
| Fig 10.
Binding of M-Ras to the Ras binding domains (RBD) of
Raf-1 and Ral-GDS. Lysates of 293-cells transiently transfected with
HA-tagged M-Ras wt, M-Ras G22V, N-Ras Q61K, or vector alone were mixed
as indicated with GST-fusion proteins of the RBD of Raf-1 or Ral-GDS
precoupled to glutathione beads. Proteins were eluted from the beads by
boiling and, in parallel with samples of the original lysates (WCL),
were subjected to SDS-PAGE and immunoblotting with anti-HA antibody
12CA5. ( ), HA-M-Ras; ( ), HA-N-Ras.
|
|
 |
DISCUSSION |
Our data show that M-Ras is a 29-kD protein that is present in
lymphohematopoietic cells and in many other tissues and cells, including breast epithelial lines and fibroblasts. In the spleen (and
in 3T3 fibroblasts), the levels of expression of M-Ras protein exceeded
those of members of the p21 Ras family. In the thymus, this ratio was
reversed, but the levels of M-Ras protein were comparable with those in
spleen, brain, and heart. Importantly, M-Ras could not be distinguished
from p21 Ras in assays based on the use of the anti-Ras monoclonal
antibody Y13-259 and dominant negative Ras mutants. Our observations
that expression of a constitutively active mutant of M-Ras in an
IL-3-dependent mast cell/megakaryocyte cell line increased survival
and resulted in factor-independent growth and in 3T3 fibroblasts in
transformation indicate that mutants of M-Ras have a role in
oncogenesis. Collectively, these data suggest that M-Ras and p21 Ras
are activated by common exchange factors and can regulate growth via
both shared and distinctive effectors.
Comparison of the C-termini of M-Ras and those of other members of the
Ras family show that, although sharing the terminal CAAX-motif, M-Ras
lacks the cysteine residues characteristic of p21 Ras, R-Ras, and
R-Ras2, which are involved in palmitoylation. M-Ras also lacks the
proline-rich region characteristic of R-Ras and Tc21, which we term the
R-Ras box (Fig 1), or a motif found in the C-termini of the classical
p21 Ras proteins, H-, N-, and K-Ras (shaded light gray in Fig 1).
Instead, M-Ras, in both mammals and C elegans, exhibits a
conserved carboxy terminal motif (Fig 1) that is rich in basic residues
and has a conserved threonine. These features
may govern the interaction of M-Ras with other molecules or with
other stuctures, such as subregions of the membrane.
The best-characterized signaling pathway downstream of p21 Ras involves
activation of a cascade of ser/thr-kinases, Raf-1, MEK 1/2 and Erk 1/2,
which ultimately leads to transcriptional activation of genes such as
c-fos.39 We observed that constitutively active
M-Ras was able to activate transcription of a reporter gene under the
control of the c-fos promoter (Fig 8A). Membrane localization
was crucial because a constitutively active mutant that was modified at
the carboxy-terminus so that it remained in the cytoplasm (Fig 8B,
bottom panel) was no longer able to activate the c-fos promoter
(Fig 8B). The moderate degree of activation of the c-fos
promoter induced by coexpression of M-Ras G22V relative to that of
N-Ras Q61K correlated with their relative affinities for the
Ras-binding domain of Raf-1 (Fig 10) and their
relative abilities to induce activation of Erk2.32 It
remains to be established whether M-Ras activates the Raf-MAPK pathway
under physiological conditions. Our observation that coexpression of a
cytoplasmically localized, constitutively active mutant of M-Ras
partially inhibited N-Ras-mediated activation of the c-fos
promoter (Fig 8B) suggests that M-Ras shares some, but not all, of the
pathways downstream of p21 Ras. The presence of orthologues of both p21
Ras and M-Ras in C elegans suggests that these molecules are
likely to have distinctive functions and use distinctive effectors. The
assignment of functions to M-Ras, however, is complicated by the fact
that characterization of the function of p21 Ras proteins in their various physiological and pathological processes has relied heavily on
the monoclonal antibody Y13-259 and dominant inhibitory mutants such as
H-Ras S17N. As discussed below, these two experimental tools fail to
discriminate between M-Ras and p21 Ras.
Y13-259 binds to a highly conserved epitope on the switch II region of
p21 Ras23 and blocks interaction of Raf-1 both with p21 Ras
and with M-Ras (data not shown). The demonstration that Y13-259
recognizes M-Ras and N-Ras with equivalent efficiency (Figs 2C and 3)
is consistent with the overall similarities in the sequences of M-Ras
and p21 Ras in the switch II region, and the fact that those residues
known to comprise the epitope are identical. Given our evidence that
M-Ras is expressed ubiquitously, and is more abundant than p21 Ras
intissues like spleen and in cells like NIH 3T3 fibroblasts (which have
been used widely to study p21 Ras), it will be necessary to reevaluate
many published experiments to determine whether the experimental
observations reflected the function of p21 Ras, M-Ras, or both. For
example, the biological effects of micro-injection of Y13-259 into 3T3 cells expressing oncogenes,25 which have been interpreted
as reflecting interference with the function of p21 Ras, could equally reflect inhibition of M-Ras function. Moreover, experiments designed to
assess the activation of p21 Ras by measuring ratios of GTP:GDP in
Y13-259 immunoprecipitates in fibroblasts40 and in
hematopoietic cells stimulated by hematopoietic growth
factors16,17 or antigens18,19 also may have
been monitoring the activation of M-Ras.
Dominant-negative p21 Ras mutants such as H-Ras S17N26 act
by sequestrating GEFs involved in the activation of p21 Ras
proteins41,42 and have been widely used to implicate p21
Ras in paths downstream of cell-surface receptors and
oncogenes20,26-28,40 and in the development
of cells of hematopoietic origin.21-22 The demonstration that M-Ras S27N also acted as a dominant inhibitor of activation of the
c-fos promoter by an activated Src Y527F (Fig 9)
suggests that M-Ras shares GEFs with p21 Ras. One is likely to be
mSos-1, which is known to be translocated to the membrane in cells
expressing v-src.43 It is likely that M-Ras not
only binds GEFs like mSos-1, but is also activated by them. Thus, M-Ras
is likely to be activated by most stimuli that bring GEFs to the
membrane and have been thought to activate p21 Ras. This failure of
dominant negative mutants to discriminate between p21 Ras and M-Ras and
the high levels of expression of M-Ras in tissues such as the spleen
means that the conclusions of experiments based on their use for
example, concerning the role of p21 Ras in the action of hematopoietic growth factors20 or in the development of the
thymus21 or B lymphocytes22 will require reevaluation.
The demonstration that expression of a constitutively active mutant of
M-Ras in an IL-3-dependent mast cell/megakaryocyte line resulted in
enhanced survival and factor-independent growth (Figs 4 through 6)
point to the potential significance of M-Ras in leukemogenesis. The
strong correlation between the ability of cells to grow in the absence
of IL-3 and levels of expression of M-Ras G22V (Fig 5) indicates that
when expressed at high levels, active M-Ras was able to activate to
some degree all those signal transduction paths required for growth. We
looked carefully for signs of the operation of an autocrine mechanism,
because this would provide the simplest explanation of how expression
of M-Ras G22V could trigger multiple intracellular signal tranduction
paths. However, growth and survival of R6-X cells expressing M-Ras G22V in the absence of IL-3 was not density-dependent (Fig 5 and data not
shown). When expressed at lower levels, expression of M-Ras G22V
resulted in prolonged survival but did not result in continuous, factor-independent growth. These results are qualitatively similar to
those seen when activated p21 Ras is expressed in factor-dependent hematopoietic cells.13 The synergy observed between active
M-Ras and IL-4 (Fig 4) was also reminiscent of that seen between
activated p21 Ras and IL-4.38 We have shown that this role
of active p21 Ras in synergizing with IL-4 to promote the growth of
IL-3-dependent Baf/3 cells can be replaced by activated
Raf-1.38 It is thus conceivable that the observed synergy
between M-Ras G22V and IL-4 (Fig 5) reflects activation of Raf-1 by
M-Ras G22V through the weak interaction we showed (Fig
10). The enhancing effect of IL-4 is likely to reflect
its ability to upregulate levels of c-myc mRNA (J.S.W., J.W.S.,
submitted for publication) because IL-4 cannot
stimulate activation of p21 Ras16,17 or the
Erk,44 JNK,45 or p38 MAP kinases.46
Our results clearly show that active M-Ras also could, in some
circumstances, negatively influence the growth of hematopoietic cells.
Thus, although cells expressing high levels of M-Ras G22V were capable
of factor-independent growth, they also exhibited slower growth and
reduced cloning efficiency in the presence of IL-3 (Fig 6). We have
seen qualitatively similar negative effects on growth when activated
p21 Ras is expressed in hematopoietic cells (unpublished observations,
May 1999). The mechanisms may be similar to those
reported in fibroblasts which involve overactivation of
Raf-147 and consequent upregulation of p21WAF
and cell-cycle arrest.48
It will be important to determine the frequency of activating mutations
of M-Ras in leukemia and other neoplasias of lympho-hematopoietic origin. Likewise, given evidence (Fig 7A and B, ref 32) that activated
mutants of M-Ras can transform 3T3 fibroblasts, it will be important to
determine whether mutations of M-Ras occur in solid tumors,
particularly those involving tissues such as breast or prostate, where
mutations in p21 Ras occur at a relatively low
frequencies.14
In summary, we have presented evidence that M-Ras is widely expressed,
with the spleen and thymus being major sites of expression, interacts
with at least some of the GEFs acting on p21 Ras, and when
constitutively active can result in enhanced survival and factor-independent growth of a hematopoietic cell line and
transformation of 3T3 fibroblasts. Collectively, these observations
suggest that in many cells, including those of lympho-hematopoietic
origin, M-Ras and p21 Ras will be activated coordinately and will
activate parallel, distinctive signaling pathways. Future work will
determine the molecular nature and degree of overlap of these paths and their role in the growth and differentiation of the
lympho-hematopoietic system. Finally, some of the functions of the
M-Ras pathway may have been misattributed to the classical p21 Ras
pathway on the basis of the use of Y13-259 and S17N mutants of p21 Ras,
and it will be important to develop more selective reagents.
 |
ACKNOWLEDGMENT |
We thank Wendy E. Lamson for excellent technical assistance, Annette
B.I. Schallhorn for RNA-preparations, and Ruth A. Salmon and Ian N. Foltz for helpful discussions throughout the project and critical
reading of the manuscript.
 |
FOOTNOTES |
Submitted December 29, 1998; accepted May 24, 1999.
Supported by a grant from the Medical Research Council, Canada.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to John W. Schrader, MB, PhD, The Biomedical
Research Centre, University of British Columbia, 2222 Health Sciences
Mall, Vancouver, BC V6T 1Z3, Canada; e-mail: john{at}brc.ubc.ca.
 |
REFERENCES |
1.
Egan SE, Weinberg RA:
The pathway to signal achievement [news].
Nature
365:781, 1993[Medline]
[Order article via Infotrieve]
2.
Moodie SA, Wolfman A:
The 3Rs of life: Ras, Raf and growth regulation.
Trends Genet
10:44, 1994[Medline]
[Order article via Infotrieve]
3.
Trent JC 2nd, McConkey DJ, Loughlin SM, Harbison MT, Fernandez A, Ananthaswamy HN:
Ras signaling in tumor necrosis factor-induced apoptosis.
EMBO J
15:4497, 1996[Medline]
[Order article via Infotrieve]
4.
Boguski MS, McCormick F:
Proteins regulating Ras and its relatives.
Nature
366:24602, 1994
5.
Milburn MV, Tong L, deVos AM, Brunger A, Yamaizumi Z, Nishimura S, Kim SH:
Molecular switch for signal transduction: Structural differences between active and inactive forms of protooncogenic ras proteins.
Science
247:939, 1990[Abstract/Free Full Text]
6.
Leevers SJ, Paterson HFm, Marshall CJ:
Requirement for Ras in Raf activation is overcome by targeting Raf to the plasma membrane.
Nature
369:411, 1994[Medline]
[Order article via Infotrieve]
7.
Stokoe D, Macdonald SG, Cadwallader K, Symons M, Hancock JF:
Activation of Raf as a result of recruitment to the plasma membrane [see comments] [published erratum appears in Science 266:2792, 1994].
Science
264:1463, 1994[Abstract/Free Full Text]
8.
Russell M, Lange-Carter CA, Johnson GL:
Direct interaction between Ras and the kinase domain of mitogen-activated protein kinase kinase kinase (MEKK1).
J Biol Chem
270:11757, 1995[Abstract/Free Full Text]
9.
Rodriguez-Viciana P, Warne PH, Dhand R, Vanhaesebroeck B, Gout I, Fry MJ, Waterfield MD, Downward J:
Phosphatidylinositol-3-OH kinase as a direct target of Ras [see comments].
Nature
370:527, 1994[Medline]
[Order article via Infotrieve]
10.
Hofer F, Fields S, Schneider C, Martin GS:
Activated Ras interacts with the Ral guanine nucleotide dissociation stimulator.
Proc Natl Acad Sci USA
91:11089, 1994[Abstract/Free Full Text]
11.
Joneson T, White MA, Wigler MH, Bar-Sagi D:
Stimulation of membrane ruffling and MAP kinase activation by distinct effectors of RAS.
Science
271:810, 1996[Abstract]
12.
Scheffzek K, Ahmadian MR, Kabsch W, Wiesmuller L, Lautwein A, Schmitz F, Wittinghofer A:
The Ras-RasGAP complex: Structural basis for GTPase activation and its loss in oncogenic Ras mutants.
Science
277:333, 1997[Abstract/Free Full Text]
13.
Sweetenham JW:
Mutated genes in myeloid leukemias.
Exp Hematol
22:5, 1994[Medline]
[Order article via Infotrieve]
14.
Bos JL:
ras oncogenes in human cancer: A review [published erratum appears in Cancer Res 50:1352, 1990].
Cancer Res
49:4682, 1989[Abstract/Free Full Text]
15.
Johnson L, Greenbaum D, Cichowski K, Mercer K, Murphy E, Schmitt E, Bronson RT, Umanoff H, Edelmann W, Kucherlapati R, Jacks T:
K-ras is an essential gene in the mouse with partial functional overlap with N-ras [published erratum appears in Genes Dev 11:3277, 1997].
Genes Dev
11:2468, 1997[Abstract/Free Full Text]
16.
Duronio V, Welham MJ, Abraham S, Dryden P, Schrader JW:
p21ras activation via hemopoietin receptors and c-kit requires tyrosine kinase activity but not tyrosine phosphorylation of p21ras GTPase-activating protein.
Proc Natl Acad Sci USA
89:1589, 1992
17.
Satoh T, Nakafuku M, Miyajima A, Kaziro Y:
Involvement of ras p21 protein in signal-transduction pathways from interleukin 2, interleukin 3, and granulocyte/macrophage colony-stimulating factor, but not from interleukin 4.
Proc Natl Acad Sci USA
88:3314, 1991[Abstract/Free Full Text]
18.
Downward J, Graves JD, Warne PH, Rayter S, Cantrell DA:
Stimulation of p21ras upon T-cell activation.
Nature
346:719, 1990[Medline]
[Order article via Infotrieve]
19.
Lazarus AH, Kawauchi K, Papoport MJ, Delovitch TL:
Antigen-induced B lymphocyte activation involves the p21ras and ras.GAP signaling pathway.
J Exp Med
178:1765, 1993[Abstract/Free Full Text]
20.
Okuda K, Ernst TJ, Griffin JD:
Inhibition of p21ras activation blocks proliferation but not differentiation of interleukin-3-dependent myeloid cells.
J Biol Chem
269:24602, 1994[Abstract/Free Full Text]
21.
Swan KA, Alberola-Ila J, Gross JA, Appleby MW, Forbush KA, Thomas JF, Perlmutter RM:
Involvement of p21ras distinguishes positive and negative selection in thymocytes.
EMBO J
14:276, 1995[Medline]
[Order article via Infotrieve]
22.
Iritani BM, Forbush KA, Farrar MA, Perlmutter RM:
Control of B cell development by Ras-mediated activation of Raf.
EMBO J
16:7019, 1997[Medline]
[Order article via Infotrieve]
23.
Sigal IS, Gibbs JB, D'Alonzo JS, Scolnick EM:
Identification of effector residues and a neutralizing epitope of Ha-ras-encoded p21.
Proc Natl Acad Sci USA
83:4725, 1986[Abstract/Free Full Text]
24.
Koide H, Satoh T, Nakafuku M, Kaziro Y:
GTP-dependent association of Raf-1 with Ha-Ras: Identification of Raf as a target downstream of Ras in mammalian cells.
Proc Natl Acad Sci USA
90:8683, 1993[Abstract/Free Full Text]
25.
Mulcahy LS, Smith MR, Stacey DW:
Requirement for ras proto-oncogene function during serum-stimulated growth of NIH 3T3 cells.
Nature
313:241, 1985[Medline]
[Order article via Infotrieve]
26.
Feig LA, Cooper GM:
Inhibition of NIH 3T3 cell proliferation by a mutant ras protein with preferential affinity for GDP.
Mol Cell Biol
8:3235, 1988[Abstract/Free Full Text]
27.
de Vries-Smits AM, Burgering BM, Leevers SJ, Marshall CJ, Bos JL:
Involvement of p21ras in activation of extracellular signal-regulated kinase 2 [see comments].
Nature
357:602, 1992[Medline]
[Order article via Infotrieve]
28.
Lange-Carter CA, Johnson GL:
Ras-dependent growth factor regulation of MEK kinase in PC12 cells.
Science
265:1458, 1994[Abstract/Free Full Text]
29.
Lowe DG, Capon DJ, Delwart E, Sakaguchi AY, Naylor SL, Goeddel DV:
Structure of the human and murine R-ras genes, novel genes closely related to ras proto-oncogenes.
Cell
48:137, 1987[Medline]
[Order article via Infotrieve]
30.
Drivas GT, Shih A, Coutavas E, Rush MG, D'Eustachio P:
Characterization of four novel ras-like genes expressed in a human teratocarcinoma cell line.
Mol Cell Biol
10:1793, 1990[Abstract/Free Full Text]
31.
Matsumoto K, Asano T, Endo T:
Novel small GTPase M-Ras participates in reorganization of actin cytoskeleton.
Oncogene
15:2409, 1997[Medline]
[Order article via Infotrieve]
32.
Kimmelman A, Tolkacheva T, Lorenzi MV, Osada M, Chan AM:
Identification and characterization of R-ras3: A novel member of the RAS gene family with a non-ubiquitous pattern of tissue distribution.
Oncogene
15:2675, 1997[Medline]
[Order article via Infotrieve]
33.
Panina-Bordignon P, Tan A, Termijtelen A, Demotz S, Corradin G, Lanzavecchia A:
Universally immunogenic T cell epitopes: Promiscuous binding to human MHC class II and promiscuous recognition by T cells.
Eur J Immunol
19:2237, 1989[Medline]
[Order article via Infotrieve]
34.
Schrader JW, Crapper RM:
Autogenous production of a hemopoietic growth factor, persisting cell stimulating factor, as a mechanism for transformation of bone-marrow-derived cells.
Proc Natl Acad Sci USA
80:6892, 1983[Abstract/Free Full Text]
35.
Shaw MK, Lorens JB, Dhawan A, DalCanto R, Tse HY, Tran AB, Bonpane C, Eswaran SL, Brocke S, Sarvetnick N, Steinman L, Nolan GP, Fathman CG:
Local delivery of interleukin 4 by retrovirus-transduced T lymphocytes ameliorates experimental autoimmune encephalomyelitis.
J Exp Med
185:1711, 1997[Abstract/Free Full Text]
36.
Karasuyama H, Melchers F:
Establishment of mouse cell lines which constitutively secrete large quantities of interleukin 2, 3, 4 or 5, using modified cDNA expression vectors.
Eur J Immunol
18:97, 1988[Medline]
[Order article via Infotrieve]
37.
Taylor SJ, Shalloway D:
Cell cycle-dependent activation of Ras.
Curr Biol
6:1621, 1996[Medline]
[Order article via Infotrieve]
38.
Levings MK, Bessette DC, Schrader JW:
Interleukin-4 synergizes with Raf-1 to promote long-term proliferation and activation of c-jun N-terminal kinase.
Blood
93:3694, 1999[Abstract/Free Full Text]
39.
Hill CS, Treisman R:
Transcriptional regulation by extracellular signals: Mechanisms and specificity.
Cell
80:199, 1995[Medline]
[Order article via Infotrieve]
40.
Satoh T, Endo M, Nakafuku M, Nakamura S, Kaziro Y:
Platelet-derived growth factor stimulates formation of active p21ras.GTP complex in Swiss mouse 3T3 cells.
Proc Natl Acad Sci USA
87:5993, 1990[Abstract/Free Full Text]
41.
Stacey DW, Feig LA, Gibbs JB:
Dominant inhibitory Ras mutants selectively inhibit the activity of either cellular or oncogenic Ras.
Mol Cell Biol
11:4053, 1991[Abstract/Free Full Text]
42.
Boriack-Sjodin PA, Margarit SM, Bar-Sagi D, Kuriyan J:
The structural basis of the activation of Ras by Sos.
Nature
394:337, 1998[Medline]
[Order article via Infotrieve]
43.
Rozakis-Adcock M, McGlade J, Mbamalu G, Pelicci G, Daly R, Li W, Batzer A, Thomas S, Brugge J, Pelicci PG:
Association of the Shc and Grb2/Sem5 SH2-containing proteins is implicated in activation of the Ras pathway by tyrosine kinases.
Nature
360:689, 1992[Medline]
[Order article via Infotrieve]
44.
Welham M, Duronio V, Sanghera J, Pelech S, Schrader JW:
Multiple hemopoietic growth factors stimulate activation of MAP-kinase family members.
J Immunol
149:1683, 1992[Abstract]
45.
Foltz IN, Schrader JW:
Activation of the stress-activated protein kinases by multiple hematopoietic growth factors with the exception of Interleukin-4.
Blood
89:3092, 1997[Abstract/Free Full Text]
46.
Foltz IN, Lee JC, Young PR, Schrader JW:
Hemopoietic growth factors with the exception of interleukin-4 activate the p38 mitogen-activated protein kinase pathway.
J Biol Chem
272:1377, 1997[Abstract/Free Full Text]
47.
Woods D, Parry D, Cherwinski H, Bosch E, Lees E, McMahon M:
Raf-induced proliferation or cell cycle arrest is determined by the level of Raf activity with arrest mediated by p21Cip1.
Mol Cell Biol
17:5598, 1997[Abstract]
48.
Olson MF, Paterson HF, Marshall CJ:
Signals from Ras and Rho GTPases interact to regulate expression of p21 Waf1/Cip1.
Nature
394:295, 1998[Medline]
[Order article via Infotrieve]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
H. Kubagawa, S. Oka, Y. Kubagawa, I. Torii, E. Takayama, D.-W. Kang, G. L. Gartland, L. F. Bertoli, H. Mori, H. Takatsu, et al.
Identity of the elusive IgM Fc receptor (Fc{micro}R) in humans
J. Exp. Med.,
November 23, 2009;
206(12):
2779 - 2793.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Nunez Rodriguez, I. N. L. Lee, A. Banno, H. F. Qiao, R. F. Qiao, Z. Yao, T. Hoang, A. C. Kimmelman, and A. M.-L. Chan
Characterization of R-ras3/m-ras null mice reveals a potential role in trophic factor signaling.
Mol. Cell. Biol.,
October 1, 2006;
26(19):
7145 - 7154.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Sun, H. Watanabe, K. Takano, T. Yokoyama, J.-i. Fujisawa, and T. Endo
Sustained activation of M-Ras induced by nerve growth factor is essential for neuronal differentiation of PC12 cells.
Genes Cells,
September 1, 2006;
11(9):
1097 - 1113.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. R.A. Ehrhardt, J. T. Hsu, L. Gartland, C.-M. Leu, S. Zhang, R. S. Davis, and M. D. Cooper
Expression of the immunoregulatory molecule FcRH4 defines a distinctive tissue-based population of memory B cells
J. Exp. Med.,
September 19, 2005;
202(6):
783 - 791.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Yang, M. Chatterjee-Kishore, S. M. Staugaitis, H. Nguyen, K. Schlessinger, D. E. Levy, and G. R. Stark
Novel Roles of Unphosphorylated STAT3 in Oncogenesis and Transcriptional Regulation
Cancer Res.,
February 1, 2005;
65(3):
939 - 947.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Colicelli
Human RAS Superfamily Proteins and Related GTPases
Sci. Signal.,
September 14, 2004;
2004(250):
re13 - re13.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Ehrhardt, M. D. David, G. R. A. Ehrhardt, and J. W. Schrader
Distinct Mechanisms Determine the Patterns of Differential Activation of H-Ras, N-Ras, K-Ras 4B, and M-Ras by Receptors for Growth Factors or Antigen
Mol. Cell. Biol.,
July 15, 2004;
24(14):
6311 - 6323.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Rodriguez-Viciana, C. Sabatier, and F. McCormick
Signaling Specificity by Ras Family GTPases Is Determined by the Full Spectrum of Effectors They Regulate
Mol. Cell. Biol.,
June 1, 2004;
24(11):
4943 - 4954.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-X. Zhang, K. R. Ward, and J. W. Schrader
Multiple Aspects of the Phenotype of Mammary Epithelial Cells Transformed by Expression of Activated M-Ras Depend on an Autocrine Mechanism Mediated by Hepatocyte Growth Factor/Scatter Factor
Mol. Cancer Res.,
April 1, 2004;
2(4):
242 - 255.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Grill, G. M. Wilson, K.-X. Zhang, B. Wang, R. Doyonnas, M. Quadroni, and J. W. Schrader
Activation/Division of Lymphocytes Results in Increased Levels of Cytoplasmic Activation/Proliferation-Associated Protein-1: Prototype of a New Family of Proteins
J. Immunol.,
February 15, 2004;
172(4):
2389 - 2400.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. R. A. Ehrhardt, R. S. Davis, J. T. Hsu, C.-M. Leu, A. Ehrhardt, and M. D. Cooper
The inhibitory potential of Fc receptor homolog 4 on memory B cells
PNAS,
November 11, 2003;
100(23):
13489 - 13494.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Grill and J. W. Schrader
Activation of Rac-1, Rac-2, and Cdc42 by hemopoietic growth factors or cross-linking of the B-lymphocyte receptor for antigen
Blood,
October 16, 2002;
100(9):
3183 - 3192.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. C. Kimmelman, N. N. Rodriguez, and A. M.-L. Chan
R-Ras3/M-Ras Induces Neuronal Differentiation of PC12 Cells through Cell-Type-Specific Activation of the Mitogen-Activated Protein Kinase Cascade
Mol. Cell. Biol.,
August 15, 2002;
22(16):
5946 - 5961.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Yang, L. Li, G. W. Wong, S. A. Krilis, M. S. Madhusudhan, A. Sali, and R. L. Stevens
RasGRP4, a New Mast Cell-restricted Ras Guanine Nucleotide-releasing Protein with Calcium- and Diacylglycerol-binding Motifs. IDENTIFICATION OF DEFECTIVE VARIANTS OF THIS SIGNALING PROTEIN IN ASTHMA, MASTOCYTOSIS, AND MAST CELL LEUKEMIA PATIENTS AND DEMONSTRATION OF THE IMPORTANCE OF RasGRP4 IN MAST CELL DEVELOPMENT AND FUNCTION
J. Biol. Chem.,
July 5, 2002;
277(28):
25756 - 25774.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Ohba, N. Mochizuki, S. Yamashita, A. M. Chan, J. W. Schrader, S. Hattori, K. Nagashima, and M. Matsuda
Regulatory Proteins of R-Ras, TC21/R-Ras2, and M-Ras/R-Ras3
J. Biol. Chem.,
June 23, 2000;
275(26):
20020 - 20026.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Yamashita, N. Mochizuki, Y. Ohba, M. Tobiume, Y. Okada, H. Sawa, K. Nagashima, and M. Matsuda
CalDAG-GEFIII Activation of Ras, R-Ras, and Rap1
J. Biol. Chem.,
August 11, 2000;
275(33):
25488 - 25493.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. F. Rebhun, A. F. Castro, and L. A. Quilliam
Identification of Guanine Nucleotide Exchange Factors (GEFs) for the Rap1 GTPase. REGULATION OF MR-GEF BY M-Ras-GTP INTERACTION
J. Biol. Chem.,
November 3, 2000;
275(45):
34901 - 34908.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|