|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, Vol. 94 No. 7 (October 1), 1999:
pp. 2433-2444
By
From The Biomedical Research Centre, University of British Columbia,
Vancouver, BC, Canada.
M-Ras, a recently identified homologue of p21 Ras, is widely
expressed, with levels of the 29-kD protein in spleen, thymus, and NIH
3T3 fibroblasts equaling or exceeding those of p21 Ras. A G22V mutant
of M-Ras was constitutively active and its expression in an
interleukin-3 (IL-3)-dependent mast cell/megakaryocyte cell line
resulted in increased survival in the absence of IL-3, increased growth
in IL-4, and, at high expression levels, in factor-independent growth.
Expression of M-Ras G22V, however, had a negative effect on growth in
the presence of IL-3, suggesting that M-Ras has both positive and
negative effects on growth. Expression of M-Ras G22V in NIH-3T3
fibroblasts resulted in morphological transformation and growth to
higher cell densities. M-Ras G22V induced activation of the
c-fos promoter, and bound weakly to the Ras-binding domains of
Raf-1 and RalGDS. Expression of a mutant of M-Ras G22V that was no
longer membrane-bound partially inhibited (40%) activation of the
c-fos promoter by N-Ras Q61K, suggesting that M-Ras shared some, but not all, of the effectors of N-Ras. An S27N mutant of M-Ras,
like the analogous H-Ras S17N mutant, was a dominant inhibitor of
activation of the c-fos promoter by constitutively active Src Y527F, suggesting that M-Ras and p21 Ras shared guanine nucleotide exchange factors and are likely to be activated in parallel. Moreover, M-Ras was recognized by the monoclonal anti-Ras antibody Y13-259, commonly used to study the function and activity of p21 Ras. Mammalian M-Ras and a Caenorhabditis elegans orthologue
exhibit conserved structural features, and these are likely to mediate
activation of distinctive signaling paths that function in parallel to
those downstream of p21 Ras.
THE H-, N-, AND K-Ras proteins,
collectively termed here p21 Ras proteins, have been implicated in a
wide variety of cellular responses, ranging from proliferation and
differentiation1,2 to cell death.3 They are
encoded by 3 genes: Harvey (H), N, and Kirsten (K), which is
alternatively spliced and generates 2 proteins: K-RasA and K-RasB. The
p21 Ras proteins are attached to the inner leaflet of the plasma
membrane by carboxy-terminal lipid modifications. They function as
biological switches and, upon hydrolysis of bound guanosine
triphosphate (GTP) to guanosine diphosphate (GDP),
undergo allosteric changes in 2 adjacent, highly conserved regions of
the molecule, termed "switch I" (residues 32-38 in H-Ras) and
"switch II" (residues 60-76 in H-Ras).4,5 In their
active, GTP-bound state, the p21 Ras proteins bind a series of effector
molecules that include serine/threonine kinases such as Raf-1, A-Raf,
B-Raf,6,7 and MEKK18; the p110 catalytic
subunit of PI-3 kinase9; and
Ral-GDS.10 Interaction of p21 Ras-GTP with
all of these effectors involves its "effector loop" that extends
from residues 32-40 and encompasses switch I, although genetic and
x-ray crystallographic analyses indicate that the mechanisms through
which these different effectors interact with p21 Ras are structurally
distinct.11,12
Activating mutations of p21 Ras occur in some 20% to 30% of acute
myeloid leukemias (AML) and myelodysplastic syndromes,13 and can reach frequencies as high as 90% in pancreatic
carcinomas.14 However, in contrast to the results of
experiments in NIH-3T3 fibroblasts, where expression of activated
mutants of p21 Ras results in transformation and reduced dependence on
growth factors, expression of activated mutants of p21 Ras in cells of
hematopoietic origin, for example in AML blasts, does not in general
confer factor-independence.13 Ablation of functional K-Ras
genes in mice results in anemia and intrauterine death, indicating that p21 K-Ras proteins have a critical role in the development of the
hematopoietic system.15
Clues to the function of p21 Ras proteins in normal hematopoietic cells
have come from experiments suggesting that p21 Ras proteins are
activated by ligation of receptors for growth factors,16,17 antigen,18,19 or other ligands, and that inhibition of the activation of p21 Ras can block the growth20 or development of lymphohematopoietic cells.21,22 This evidence has
largely depended on two research tools: the monoclonal anti-Ras
antibody Y13-259, used to measure activation of p21 Ras and to inhibit its function, and dominant-negative mutants such as S17N Ras, used to
inhibit activation of p21 Ras. Y13-259 binds to p21 Ras isoforms via an
epitope in switch II,23 thus blocking their interaction
with Raf-1,24 and inhibits growth when microinjected into
cells.25 The standard assay for assessing activation of p21
Ras is based on immunoprecipitation with Y13-259 and measurement of the
ratio of GTP:GDP in the precipitate, and is the basis of reports that
have concluded that p21 Ras is activated in cells of hematopoietic
origin by hematopoietic growth factors16,17 or by ligation
of antigen receptors.18,19 Dominant negative mutants such
as p21 Ras S17N have an increased affinity for p21 Ras
GDP26 and are thought to sequestrate guanine nucleotide exchange factors (GEFs) and, thus, block activation of endogenous p21
Ras. Expression of p21 Ras S17N has been used to implicate p21 Ras in
the development of B and T lymphocytes21,22 as well as in
signaling downstream of oncogenes, growth factors, cytokines, and other
ligands.20,26-28
The p21 Ras proteins are members of a larger family that also includes
R-Ras and R-Ras2/TC21.29,30 Two recent reports describe a
new member of this family termed M-Ras,31 referring to its cloning from muscle, or R-Ras3,32 on the basis of homology
with R-Ras and R-Ras2. Mutants with decreased GTPase activity induced the formation of microspikes in Swiss 3T3 cells,31 focus
formation and anchorage-independent growth in NIH 3T3 cells, and
moderate activation of Erk (extracellular signal-regulated
kinase).32 Both groups reported that the pattern of
expression was restricted, to brain and heart,32 or to
brain and skeletal muscle.31
Here we show that in contrast to these reports, expression of M-Ras is
not restricted to brain or muscle and occurs in thymus, spleen, and
cell lines of hematopoietic origin, as well as in epithelial cells.
Expression of constitutively active M-Ras in an IL-3-dependent
hematopoietic cell line resulted in factor-independent growth.
Moreoever, M-Ras could not be distinguished from p21 Ras in functional
tests based on the monoclonal antibody Y13-259 or the dominant negative
M-Ras mutant S27N. Analysis of the protein sequences of M-Ras and other
members of the Ras-family showed that M-Ras displays distinctive motifs
that differ from those found in R-Ras and R-Ras2 on the one hand, and
p21 Ras on the other. Our data suggest that M-Ras is likely to be
activated by the same stimuli that activate p21 Ras, but that it
activates parallel pathways that regulate cellular growth.
Materials.
Plasmids encoding the GST-fusion proteins GST-Raf-1-RBD and
GST-RalGDS-RBD were kindly provided by Dr D. Shalloway (Cornell University, New York, NY) and Dr J. Bos (Utrecht
University, Utrecht, The Netherlands), respectively, Src Y527F by Dr J. Cooper (Fred Hutchinson Center, Seattle, WA), and N-Ras Q61K by Dr R. Kay (The Terry Fox Laboratory, Vancouver, Canada). Biotinylated or
native antibodies against the HA-epitope (12CA5) were purchased from Boehringer Mannheim (Boehringer Mannheim, Laval, Quebec, Canada) and Cy
Chrome5-conjugated streptavidin from Pharminogen Canada (Mississauga,
Ontario, Canada).
Generation of antisera.
Rabbits were injected with peptides corresponding to residues 187-204 (KKKTKWRGDRATGTHKLQ, pep I) and 142-159 (KEMATKYNIPYIETSAKD, pep II) of
M-Ras, respectively. For immunizations both peptides were fused to the
C-terminus of the tetanus toxoid epitope QYIKANSKFIGITEL.33 For affinity purification of the polyclonal antisera, the peptides were
covalently bound to NHS-activated Sepharose (Pharmacia Biotech, Uppsala, Sweden). Antibodies bound to the affinity-purification column
were washed with 10 column volumes of phosphate-buffered saline (PBS),
eluted with 3 mL of 100 mmol/L glycine (pH 2.5), and dialyzed against 2 L of PBS overnight.
Cell culture, transfections, and retroviral infections.
All cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM),
supplemented with 2 mmol/L L-glutamine, 100 U penicillin/50 U
streptomycin (Stem Cell Technologies, Vancouver, Canada), and 10%
fetal calf serum R6-X cells (293-cells and BOSC23) or 10% calf serum
(NIH3T3). R6-X, an interleukin-3 (IL-3)-dependent bipotential, mast
cell/megakaryocyte line,34 was passaged in the presence of
medium conditioned by the cell line WEHI-3B (2% of 10-fold concentrated medium, W3) as a source of IL-3. NIH 3T3 cells were kindly
provided by Dr R. Kay. For retroviral infections, R6-X cells or NIH3T3
cells were incubated for 10 hours with retroviruses produced as
described,35 in the presence of 10 µg/mL polybrene and,
in the case of R6-X cells, 2% W3 and 2% of a 10-fold concentrate of
medium conditioned by X063 cells secreting IL-4.36 After 10 hours, the R6-X cells were washed and resuspended in medium supplemented with IL-4 alone. In the case of 3T3 cells and, in some
experiments, R6-X cells, infected clones were selected in puromycin at
1 µg/mL (Sigma, Mississauga, Ontario, Canada), and in the case of
R6-X in the presence of 2% W3 as a source of IL-3. Analysis of growth
and survival of polyclonal or clonal population of virally infected
cells R6-X cells involved cell counting, assessment of uptake of
3,4,5-dimethyltiazole-2,5-diphenyltetrazolium bromide (MTT), or clonal
growth in agar. For assessment of growth or survival using MTT, cells
were plated at varying densities as indicated, in 96-well,
flat-bottomed plates, with titrated amounts of growth factors as
indicated. MTT uptake was assessed 3 to 5 days later. Colony assays
were performed by plating cells in medium and indicated growth factors
in a final concentration of 0.3% agar (Difco, Detroit, MI).34 R6-X cells were cloned by picking colonies from
agar. In some cases, populations were enriched in enhanced green
fluorescent protein (EGFP)-expressing cells by fluorescence-activated
cell sorting using a FACSCalibur instrument (Becton Dickinson, San Jose, CA). Experiments were performed on retrovirally
infected R6-X cells derived from 2 independent infections with
consistent results.
Generation of mutations by site-directed mutagenesis.
The M-Ras cDNA was subcloned into pBluescript for site-directed
mutagenesis and sequencing. Constructs were cloned with N-terminal myc-
or HA-tags or C-terminal myc-tags into the eukaryotic expression vectors pEF-BOS or pcDNA3.1, or, for retroviral infections, into pMX-PIE (a gift of Dr Alice Mui, DNAX, San Francisco, CA). This vector
drives expression of the EGFP from an internal ribosomal entry site
(IRES) downstream of the Ras cDNA. Identities of all constructs were verified by DNA-sequencing.
Northern blot analysis and reverse transcription-polymerase chain
reaction (RT-PCR).
Northern blots were performed according to the manufacturer's
instructions (CLONTECH, Palo Alto, CA) with a probe corresponding to
the 120 carboxy-terminal amino acids of M-Ras. RT-PCR was performed on
2 µg of total RNA from the indicated cell lines. Oligonucleotides used were GTGAGTGCCGGTGGCCCTGTCTCCCTCGC (RT-reaction),
TTTGGTTGCCATTTCTTTTCCTTGGTCCC (PCR antisense),
ACCAGCGCTGTTCCAAGTGAAAAC- CTTCC (PCR sense), CACATATAAACTAGTAGTGGTGGGAGATGG (nested PCR sense),
CTTAGGTGCATCAGATCCACCTTGTTG (nested PCR antisense). As negative
control, the RT-reaction was performed on 2 µg of t-RNA. The
identities of the amplified fragments were verified by a restriction digest.
Reporter gene assays.
293-cells were cotransfected with 0.25 to 0.5 µg of the luciferase
reporter gene under control of the full-length c-fos promoter and the indicated plasmids. Cells were harvested 48 hours after transfection and lysed in 200 µL of lysis buffer (Promega, Madison, WI). Luciferase activity was determined with a luminometer (Dynex, Chantilly, VA) and the values normalized to total protein using BCA
Protein Reagent A (Pierce, Rockford, IL).
Immunoblotting, immunoprecipitation, and affinity precipitation.
Transiently transfected 293-cells were washed twice in PBS and lysed in
500 µL of 50 mmol/L Tris-HCl (pH 7.5), 150 mmol/L NaCl, 1% NP-40, 5 mmol/L EDTA, in the presence of 10 µg/mL each of leupeptin,
aprotinin, soybean trypsin inhibitor, 0.7 µg/mL pepstatin, and 40 µg/mL phenylmethyl sulfonyl fluoride (PMSF). Denatured proteins were
subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) and immunoblotted with `anti-HA' antibody 12CA5 at 0.2 µg/mL or anti-Ras antibody Y13-259 at 15 µg/mL, as
described.16 To decrease the Ig-light chain signal, we used
secondary antibodies recognizing specifically the Ig-heavy chain.
Affinity purifications to assay binding of M-Ras to the Ras-binding
domains of Raf-1 and Ral-GDS were performed as described.37 Briefly, GST-fusion proteins were affinity-purified with glutathione beads from lysates of Escherichia coli. Fifteen microliters of packed bead volume was mixed for 40 minutes with lysates of 293-cells expressing the indicated proteins in 25 mmol/L HEPES (pH 7.5), 150 mmol/L NaCl, 10% glycerol, 0.25% Na-deoxycholate, 1% NP-40, 25 mmol/L NaF, 10 mmol/L MgCl2, 1 mmol/L EDTA, 1 mmol/L Na
vanadate, 10 µg/mL leupeptin, and 10 µg/mL aprotinin. The beads
were washed with lysis buffer, boiled, and the eluted proteins resolved
on 15% denaturing polyacrylamide gels. Cell fractionations were
performed by suspending cells in homogenization-buffer (10 mmol/L
TRIS-HCl [pH 7.5], 1 mmol/L EDTA, 10 µg/mL each of leupeptin,
aprotinin, and soybean trypsin inhibitor, 0.7 µg/mL pepstatin, and 40 µg/mL PMSF). Cells were broken by brief sonication,
the nuclei were pelleted, and the supernatant subjected to
ultra-centrifugation for 20 minutes at 150,000g. The resulting
supernatant was designated as cytosolic fraction (c) and the pelleted
fraction as membrane enriched fraction (m).
Uniquely conserved characteristics of the C-terminus of M-Ras in
mammals and Caenorhabditis elegans.
We identified a novel member of the Ras-family in the murine expressed
sequence tag (EST) database. The cDNA encoded a small GTPase that was
also described as M-Ras31 and R-Ras3.32 We also
identified an orthologous protein in the C elegans database. M-Ras exhibits a high degree of homology with other members of the
Ras-family, with 47% identity with H-Ras and 52% with R-Ras2. Although it is identical in the switch I region (residues 42-48), it
displays only 3 conserved exchanges in the switch II region (residues
70-86). Significantly, none of the residues in switch II shown to be
involved in binding of Y13-259 to p21 Ras23 differed between H-Ras and M-Ras. Comparison of the carboxy-terminal sequences of the murine and C elegans M-Ras orthologues with those of p21 Ras, R-Ras, and R-Ras2 indicated that M-Ras had distinctive
characteristics and suggested that M-Ras was a discrete branch of this
phylogenetic tree. Figure 1 shows
alignments of the translated protein sequences of the C-termini of
M-Ras and its C elegans orthologue with those of other members
of the family of small GTPases. In contrast to R-Ras and R-Ras2, M-Ras
and its C elegans orthologue lacked the cysteine-residues
(double-underlined in Fig 1) close to the C-terminus that are necessary for palmitoylation. Moreover, murine and C elegans M-Ras lacked a proline-rich motif characteristic of the C-termini of R-Ras and R-Ras2, which we term the R-Ras box (shaded medium gray in Fig 1). Instead, M-Ras and its C elegans
orthologue exhibited a distinctive motif, rich in basic residues
(shaded dark gray in Fig 1). It included a threonine residue at
position 190 of murine M-Ras which, as noted by
Matsumoto et al,31 might serve as a target
for phosphorylation. The C-terminus of murine M-Ras displayed a stretch
of lysine residues (underlined in Fig 1) which resembles that occurring
at the C-termini of K-RasB and also Rap-1. Other residues conserved
between M-Ras and its C elegans orthologue included a
tryptophan at position 60 of M-Ras (a threonine in p21 Ras), a
hydrophobic residue at position 51 (an arginine in p21 Ras), and, at
position 159, a D/EPP motif, which is likely to alter tertiary
structure.
M-Ras is widely expressed.
To assess the pattern of expression of M-Ras mRNA, RT-PCR and Northern
blot analysis was performed. Using RT-PCR, we observed expression of
M-Ras mRNA in all cell lines examined, including hematopoietic cell
lines, fibroblasts, and epithelial cells derived from breast, skin, and
kidney (Table 1). Northern Blot analysis showed 2 major transcripts of approximately 1.5 kb and 4.6 kb that were
expressed highly in brain and heart tissues with lesser but significant
levels in liver, lung, pancreas, placenta, and kidney
(Fig 2A). Thus, in contrast with the
conclusions of other reports,31,32 M-Ras was expressed
widely.
Relative levels of p21 and M-Ras proteins in spleen and thymus.
To examine the levels of expression of the endogenous M-Ras
protein, we generated preparations of polyclonal antibodies that were specific for M-Ras ( M-Ras is recognized by the monoclonal anti-Ras antibody Y13-259.
The monoclonal anti-p21 Ras antibody Y13-259 has been used extensively
to monitor activation or function of p21 Ras. On the basis of the
similarity of the switch II regions of M-Ras and p21 Ras, we next
investigated the reactivity of M-Ras with the monoclonal anti-p21 Ras
antibody Y13-259. Y13-259 recognized M-Ras and N-Ras with equivalent
efficiency in immunoblotting of lysates of 293-cells expressing
HA-tagged M-Ras or N-Ras (Figs 2C and 3).
Importantly, for the interpretation of assays of the activation of p21
Ras, Y13-259 immunoprecipitated M-Ras and N-Ras from those cell lysates
with equivalent efficiency (Fig 3).
Polyclonal populations of an IL-3-dependent cell line expressing a
G22V mutant of M-Ras exhibit increased survival and growth in IL-4.
To investigate the oncogenic potential of M-Ras, we constructed a G22V
mutant of M-Ras (M-Ras G22V) that, by analogy with mutants of other
small GTPases, was predicted to be constitutively active. We used a
retroviral vector to express M-Ras G22V in a murine IL-3-dependent
cell-line, R6-X. The vector encoded a puromycin-resistance gene driven
by an SV40 promoter and an EGFP gene that was expressed downstream of
an IRES site, from the same mRNA as M-Ras G22V. Polyclonal populations
of R6-X cells infected with either the M-Ras G22V retrovirus or a
control virus encoding EGFP alone were derived by either selection in
the presence of IL-3 and puromycin or by fluorescence-activated cell
sorting (termed "sorted" populations). M-Ras expression was
verified by immunoblotting and 2-color flow cytometry using a
monoclonal antibody specific for the HA tag present on M-Ras G22V. The
expression of M-Ras G22V varied widely within the polyclonal
populations and on a cell-for-cell basis was correlated with expression
of EGFP.
High levels of expression of active M-Ras result in
factor-independent growth but reduced growth in the presence of IL-3.
Continued observation of polyclonal populations of cells expressing
M-Ras G22V cultured in the absence of IL-3 showed a subpopulation of
cells that failed to die and slowly increased in number. Plating of
polyclonal populations of R6-X M-Ras G22V in agar in the absence of
IL-3 for 7 days resulted in the growth of small colonies at a low
frequency (<0.2%) of the cells plated
(Fig 5A). This low frequency of cells
capable of forming colonies in the absence of IL-3 could have reflected
functional heterogeneity of the polyclonal population, or,
alternatively, an intrinsically low cloning efficiency of R6-X M-Ras
G22V cells in the absence of IL-3. To address this question, we cloned
cells from randomly selected colonies that had grown in medium alone,
and we cloned cells from randomly selected colonies
that had developed at high frequency (35% of plated cells) in the
presence of IL-3. Two series of clones of R6-X M-Ras G22V were expanded
in IL-3, 1 derived from colonies that had developed in medium alone
(termed the M series), and 1 derived from colonies that had developed
in IL-3 (termed the F series). These 2 series of clones were then
washed and their survival in the absence of IL-3 compared. Cells of the
M series of clones, derived from colonies grown in the absence of IL-3,
failed to die when cultured in medium alone. In contrast, with a few
notable exceptions, most of the clones derived from the F series of
colonies grown in IL-3 exhibited significant cell death when deprived
of IL-3. Inspection by fluorescent microscopy of cultures of the 2 series of clones growing optimally in IL-3 showed that cells of all of
the M series clones, derived from colonies grown in the absence of
IL-3, were bright green, whereas the F series clones, derived from the
randomly chosen colonies grown in IL-3, varied in brightness, with most
exhibiting only a low EGFP signal. There was a strong correlation
between survival in the absence of IL-3 and brightness (Fig 5B).
Similarly, when these clones were pated in agar in the absence of IL-3,
there was a clear correlation between the brightness of the EFP signal and the size and frequency of colonies (data not shown). These results
suggested that the ability to survive and grow in the absence of IL-3
correlated with levels of expression of M-Ras G22V. This was confirmed
directly by assessing levels of M-Ras G22V by immunoblotting of cell
lysates with anti-HA antibodies (Fig 5C).
M-Ras G22V transforms NIH 3T3 fibroblasts.
We used retroviral vectors to express wild-type M-Ras, M-Ras G22V, or
N-Ras Q61K in NIH-3T3 fibroblasts. As shown in
Fig 7A, NIH 3T3 cells expressing M-Ras
G22V, but not those expressing wild-type M-Ras, exhibited a refractile,
transformed morphology, strongly resembling that of the cells
expressing N-Ras Q61K. Cells expressing M-Ras G22V, but not those
expressing wild-type M-Ras, also resembled cells expressing N-Ras Q61K
in gaining the ability to grow to higher saturation densities
(Fig 7B).
Expression of activated M-Ras activated the c-fos
promoter.
We tested the ability of M-Ras and mutants of M-Ras to activate the
c-fos promoter using the luciferase reporter gene assay. Expression of wild-type M-Ras did not activate the c-fos
promoter (Fig 8A). However, expression of
the G22V mutant of M-Ras resulted in 3-fold activation of the
c-fos promoter. This was reproducibly less than the 9-fold
activation of the c-fos promoter induced by N-Ras Q61K (Fig
8A).
Expression of dominant negative M-Ras S27N completely inhibits
activation of the c-fos promoter by activated Src.
To investigate the possibility that M-Ras shared exchange factors with
p21 Ras proteins, we generated an S27N mutant of M-Ras, analogous to
the S17N dominant inhibitory mutants of p21 Ras. Expression of M-Ras
S27N itself failed to activate transcription of the c-fos
promoter (Fig 8A). However, when coexpressed it completely suppressed
activation of the c-fos promoter induced by expression of
constitutively active Src Y527F (Fig 9).
Thus, M-Ras S27N acted, like H-Ras S17N, as a dominant inhibitor of the
Src pathway to the c-fos promoter (Fig 9).
Interaction of activated M-Ras with Raf-1 and Ral-GDS.
We investigated whether constitutively active M-Ras interacted directly
with two known effectors of p21 Ras, Raf-1 and Ral-GDS. The binding of
M-Ras G22V to the Ras-binding domain (RBD) of Raf-1 was readily
detectable, although the amounts of M-Ras G22V present in eluates were
significantly less than those of Q61K N-Ras observed in parallel
experiments (Fig 10). This indicated that
M-Ras G22V interacted with the Raf-1-RBD with lower affinity than did
N-Ras Q61K. Likewise, M-Ras G22V bound detectably to RalGDS-RBD. Again, comparison of the amount of M-Ras G22V bound with that of N-Ras Q61K
indicated that M-Ras G22V had a lower affinity for Ral-GDS. Nevertheless, both the binding of M-Ras G22V to the Raf-1-RBD and to
the RalGDS-RBD were inhibited by Y13-259, showing that in both cases
binding was specific (data not shown). As expected, neither the RBD of
Raf-1, nor that of RalGDS, bound to wild-type M-Ras.
Our data show that M-Ras is a 29-kD protein that is present in
lymphohematopoietic cells and in many other tissues and cells, including breast epithelial lines and fibroblasts. In the spleen (and
in 3T3 fibroblasts), the levels of expression of M-Ras protein exceeded
those of members of the p21 Ras family. In the thymus, this ratio was
reversed, but the levels of M-Ras protein were comparable with those in
spleen, brain, and heart. Importantly, M-Ras could not be distinguished
from p21 Ras in assays based on the use of the anti-Ras monoclonal
antibody Y13-259 and dominant negative Ras mutants. Our observations
that expression of a constitutively active mutant of M-Ras in an
IL-3-dependent mast cell/megakaryocyte cell line increased survival
and resulted in factor-independent growth and in 3T3 fibroblasts in
transformation indicate that mutants of M-Ras have a role in
oncogenesis. Collectively, these data suggest that M-Ras and p21 Ras
are activated by common exchange factors and can regulate growth via
both shared and distinctive effectors.
We thank Wendy E. Lamson for excellent technical assistance, Annette
B.I. Schallhorn for RNA-preparations, and Ruth A. Salmon and Ian N. Foltz for helpful discussions throughout the project and critical
reading of the manuscript.
|
TOP
ABSTRACT
INTRODUCTION
pep I antibodies, and the cross-reactive 
pep I, Fig 
, 
) or medium
supplemented with decreasing amounts of synthetic IL-3 starting at 2 µg/mL (
, 
) or recombinant IL-4 (10 ng/mL) (
, 
). Cell
numbers were assessed at day 6 by uptake of MTT. Results are shown as
optical densities (OD) of triplicate cultures ± SEM.
) or in the
presence of IL-3 (F series; 
), M-Ras wt
(
), HA-M-Ras; (
), HA-N-Ras.
for
example, concerning the role of p21 Ras in the action of hematopoietic growth factors