|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 8 (October 15), 1999:
pp. 2562-2568
A Bispecific Diabody That Mediates Natural Killer Cell Cytotoxicity
Against Xenotransplantated Human Hodgkin's Tumors
By
Michaela A.E. Arndt,
Jürgen Krauss,
Sergey M. Kipriyanov,
Michael Pfreundschuh, and
Melvyn Little
From the Recombinant Antibody Research Group (D0500), German Cancer
Research Center (DKFZ), Heidelberg, Germany; and the Department of
Internal Medicine I, University Clinic of Saarland, Homburg, Germany.
 |
ABSTRACT |
CD16/CD30 bispecific monoclonal antibodies can induce remissions of
Hodgkin's disease refractory to chemo- and radiotherapy. However, the
development of human antimouse immunoglobulin antibodies and allergic
reactions precludes repeated applications of the antibody. Moreover,
problems of producing and purifying sufficient amounts of material
limit the clinical practicability of this novel treatment approach. To
overcome these obstacles, we have constructed a bispecific antibody in
a diabody form that only employs the variable domains of the CD16/CD30
hybrid hybridoma. The diabody compared favorably with the parent
CD16/CD30 bispecific antibody in its ability to activate and target
natural killer cells in vitro. Its administration to mice bearing
xenografted Hodgkin's lymphoma resulted in a marked regression of
tumor growth, thus proving for the first time the capability of a
diabody for immune recruitment in vivo. The CD16/CD30 diabody is a
novel reagent that should considerably facilitate the immunotherapy of
patients with refractory Hodgkin's lymphoma.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
NATURAL KILLER (NK) cells represent a
potent subset of lymphocytes for targeting and lysing tumor cells. In
contrast to T lymphocytes, they do not need to be preactivated in vitro because they constitutively express cytolytic functions against a
number of different targets.1,2 Their inherent cytolytic activity can be stimulated via the Fc IIIA receptor (CD16), which is
expressed on the surface of NK cells, macrophages, and activated monocytes.3,4 Bispecific antibodies binding to both CD16 and a tumor-associated antigen are therefore of great interest as
potential reagents for cancer immunotherapy.
To target NK cells against Hodgkin's disease (HD), a mouse hybrid
hybridoma bispecific monoclonal antibody (biMoAb) was constructed with
specificities for CD16 and CD30.5 CD30 is expressed on virtually all Hodgkin and Reed-Sternberg cells and on only a small proportion of activated lymphocytes.6 The antibody was able to induce the specific lysis of CD30+ tumor cells in vitro.
Administration of the bispecific antibody in a severe-combined
immunodeficiency (SCID) mouse model resulted in the complete remission
of subcutaneously established tumors after one single
injection.5 More recently, the biMoAb was used to treat 15 patients with refractory HD in a phase-I/II trial with promising
results.7 However, human antimouse immunoglobulin (Ig)
antibodies were found in a total of 9 patients and 4 patients developed
an allergic reaction after attempted retreatment.
In addition to the problem of immunogenicity, hybrid hybridoma biMoAb
are extremely difficult to purify as a homogenous molecule from the
large number of similar molecules generated by the random L-H and H-H
associations. We therefore decided to construct a bispecific antibody
comprising only the variable domains of the hybrid hybridoma. Such
bispecific molecules, for example, have been constructed by joining two
single-chain Fv fragments (scFv) with a polypeptide
linker.8,9 Alternatively, a structurally more compact
bispecific heterodimer known as a diabody can be made by the
noncovalent association of two fusion proteins comprising the VH domain
of one antibody connected by a short linker to the VL domain of another
antibody.10-13 Their relatively small size should
facilitate a better penetration of tumor tissue. Crystallographic studies have shown that the two antigen-binding domains of diabodies are on opposite sides of the complex, such that they are able to bind
two cells.14
We chose to construct an anti-CD30/anti-CD16 diabody rather than a
single-chain bispecific scFv [(scFv)2], since in our
experience, diabodies are produced in higher amounts in bacteria and
appear to be functionally superior. This diabody was able to
specifically induce the lysis of a CD30+ Hodgkin's
lymphoma-derived cell line by NK cells. Furthermore, after
administration to mice bearing xenografted Hodgkin's lymphoma, it
induced a regression of tumor growth with an efficacy comparable to
that of the parent hybrid hybridoma. To our knowledge, this is the
first time that the immune-recruiting capacity of a bispecific diabody
on tumor growth in an animal model system has been shown.
| |
MATERIALS AND METHODS |
Plasmids, antibodies, and cell lines.
The plasmid pHOG2115 was used for expressing scFvs and the
plasmid pKID16 was used for expressing the diabody. DNA
coding for the anti-CD30 scFv fragment was kindly provided by A. Hombach, (Medical Clinic I, University of Cologne,
Germany).17 Hybridoma cell lines producing the anti-CD16
MoAb A9 (IgG1 ) and the anti-CD30 MoAb HRS-3 (IgG1 ) have been
described previously.5,18,19 The bispecific monoclonal IgG1
antibody HRS-3/A9 had been previously produced and purified under good
manufacturing practice (GMP) conditions by Biotest Pharma GmbH
(Dreieich, Germany) and comprised at least 95% intact biMoAb. The
CD30+ human Hodgkin's disease-derived cell line L540CY
has been described by von Kalle et al.20 The SW480 cell
line (ATCC-No. CCL 228) was used as a control cell line in flow
cytometric analyses and cytotoxicity assays. All hybridomas and cell
lines were cultured in RPMI 1640 medium containing 10% fetal calf
serum (FCS), 2 mmol/L L-glutamine, 100 µg/mL streptomycin, and 100 IU/mL penicillin.
Cell preparations.
CD16+ granulocytes were freshly prepared from the blood of
healthy donors by centrifugation on a discontinuous density gradient of
Histopaque-1077 and Histopaque-1119 (Sigma Diagnostics, St Louis, MO)
at 700g for 30 minutes at room temperature without braking. The
second opaque layer containing the granulocytes was aspirated and
washed three times with phosphate-buffered saline (PBS). Peripheral
blood lymphocytes (PBL) containing about 10% NK cells were isolated
from healthy donors (Bloodbank, Saarland University, Homburg, Germany)
by Ficoll Hypaque gradient centrifugation followed by plastic adherence
to remove the monocytes. To determine the percentage of NK cells, the
PBL were stained with a phycoerythrin-labeled anti-CD3 MoAb and with
fluorescein isothiocyanate (FITC)-labeled anti-CD56 and anti-CD16 MoAb
and analyzed by flow cytometry.
Construction of the anti-CD16 anti-CD30 diabody.
The complementary DNA (cDNA) sequence of the heavy- and light-chain
variable domains of the anti-CD16 MoAb A9 were amplified by polymerase
chain reaction (PCR) with individually designed 5' consensus
primers and 3' primers annealing to the C region of
the light chain and CH1 region of the heavy chain,
respectively. The following oligonucleotides containing appropriate
restriction sites for directional cloning were used: VH5',
5' CAGCCGGCCATGGCGCAGGTC(G)CAGCTGCAGC(G)AG3' (NcoI); VH3', 5'
CCAGGGGCCAGTGGATAGACAAGCTTGGGTGTTGTTTT3'
(HindIII); VL5', 5'
AGAGACGCGTACAGGCTGTTGTGACTCAGG3' (MluI); VL3',
5' GACTGCGGCCGCAGACTTGGGCTGGCC3' (NotI). The
restriction sites are underlined and named in brackets. The PCR was
performed as follows: 1 cycle, 5-minute denaturation at 94°C,
3-minute hybridization at 58°C, and 2-minute extension at 72°C,
followed by 30 cycle, 80 seconds at 94°C, 80 seconds at 58°C, 2 minutes at 72°C, and 10-minute extension in the final circle. The
PCR products were gel purified and ligated into the pCR-Script SK(+)
vector (Stratagene, La Jolla, CA) for
didesoxy-sequencing.21 For soluble scFv expression, the
heavy chain was digested with NcoI/HindIII and the light chain
was digested with MluI/NotI and successively ligated to the linearized
vector pHOG 21 15.
The heavy and the light chain of the anti CD30 scFv fragment
were extended at the ends of their framework 4 regions by PCR using primers encoding the first five amino acids of the
CH1-domain and the C-domain, respectively, and vector-compatible
restriction sites. The PCR primers used for the heavy chain were
5'ATGACCATGATTACGCCAAGC3' and 5'
AGACAAGCTTGGGTGTTGTTTTGGCTGAGGAGACGG3'
(HindIII); for the light-chain 5'
GGCGGATATCGAGCTCACTCAGTCTCC3' (EcoRV) and 5'
TATAGCGGCCGCAGCATCAGCCCGTTTGATTTCC3' (NotI). The
restriction sites are underlined and named in brackets. The heavy- and
the light-chain variable domains of the anti-CD30 scFv fragment and
anti-CD16 scFv fragment were cloned into the diabody expression plasmid
pKID for cosecretion of the fusionproteins VH16-VL30 and VH30-VL16
as previously described for the construction of an anti-CD19/anti-CD3
diabody.16 Their sequences were verified by the
didesoxynucleotide method.21
Expression and purification of scFv fragments and diabody.
The Escherichia coli K12 strain XL1-Blue (Stratagene)
transformed with the scFv expression plasmid pHOG21 or the diabody
expression plasmid pKID16-30 were grown overnight in 2YT medium (270 mmol/L NaCl, 1% Yeast Extract, 0.5% Tryptone, pH 7.0) containing 100 µg/mL ampicillin and 100 mmol/L glucose (2YTGA) at
37°C. The overnight cultures were diluted 1:20 in 2YTGA
and grown as flask cultures at 37°C with shaking at 280 rpm. After
reaching OD600 = 0.8 the bacteria were pelleted by
centrifugation at 1500g for 10 minutes and 20°C and
resuspended in the same volume of fresh 2YT medium containing 100 µg/mL ampicillin, 0.4 mol/L sucrose and 0.2 mol/L IPTG. Induction was
performed at 21°C for 18 to 20 hours. Soluble scFv fragments and
the diabody were prepared as previously described.22 Briefly, for isolation of the scFv fragments, the culture supernatant and the soluble periplasmatic extract were combined and concentrated using Amicon YM10 membranes with a 10 kD cutoff (Amicon, Witten, Germany) followed by thorough dialysis against 50 mmol/L Tris-HCl, 1 mol/L NaCl, pH 7.0. The diabody was concentrated by ammonium sulfate
precipitation with a final 70% concentration of saturation. The
protein precipitate was collected by centrifugation (30,000g, 4°C, 45 minutes) and dissolved in 1/10 of the initial volume of 50 mmol/L Tris-HCl, 1 mol/L NaCl, pH 7.0. Both, the scFv fragments and the
diabody were purified by immobilized metal affinity chromatography (IMAC) as previously described.23 The purified antibody
preparations were dialyzed against PBS.
Flow cytometry.
Flow cytometric analyses using a FACScan (Becton Dickinson, Heidelberg,
Germany) to confirm the binding ability of anti-CD16 and anti-CD30 scFv
and the anti-CD16/anti-CD30 Diabody to CD16-positive granulocytes and
CD30-positive L540Cy cells were performed as follows: 1 × 106 target cells were washed twice in ice-cold PBS-N (PBS,
0.05 % NaN3) and incubated with 100 µL of a sample
containing the scFv fragment or the diabody for 45 minutes at 4°C.
Cells were pelleted at 1200 rpm at 4°C for 5 minutes and washed
with 2 mL PBS-N. For detection the cells were resuspended in 100 µL
PBS-N containing the 9E10 antibody (10 µg/mL; ICI Chemikalien,
Ismaning, Germany) that binds to the c-myc tag and incubated for 30 minutes at 4°C. Cells were pelleted and washed as above. Finally,
the cells were resuspended with fluorescein-labeled goat antimouse IgG
(GIBCO BRL, Gaithersburg, MD) 1:100 in PBS-N and incubated for 30 minutes at 4°C in the dark. After washing again with PBS-N, the
cells were prepared for analysis with PBS-N containing 1 µg/mL
propidium iodide (Sigma, Deisenhofen, Germany) to exclude dead cells.
Background fluorescence was determined by using target cells incubated
with 9E10 antibody and FITC-labeled goat antimouse antibody under the same conditions.
Cytotoxicity assays.
The cytotoxicity assay was performed according to the
JAM-Test method described by Matzinger.24 The
assay measures DNA fragmentation and is performed similarly to a
standard 51Cr release assay. Target cells were labeled with
3H thymidine to a final concentration of 2.5 to 5 µCi/mL
for 4 to 6 hours. They were then pelleted, washed once with culture medium, and distributed in triplicates (104 cells per well)
into 96-well round-bottomed microwell plates. After adding effector
cells in serial dilutions, the plates were incubated in a humidified
atmosphere at 5% CO2 for 4 hours. The cells and medium
were than aspirated onto fiber glass filters using a cell harvester
(Betaplate; Amersham Pharmacia Biotech Europe GmBH, Freiburg,
Germany). After washing and drying the filters, they were
placed in vials containing liquid scintillation fluid and counted using
a liquid scintillation counter (LKB, Wallach, Freiburg, Germany). The
radioactivity measured corresponds to intact DNA because DNA from dead
cells is degraded into small fragments that pass through the filter.
For calculating % specific killing, the standard formula for the JAM
test is: % specific killing = (S-E)/S 100, with E = experimentally
retained DNA in the presence of effector cells (in cpm) and S = retained DNA in the absence of effector cells (spontaneous).
Animals.
Pathogen-free female mice with SCID (C.B-17 lcr scid/scid) were
obtained from Charles River (Sulzfeld, Germany). The SCID mice were
maintained under pathogen-free conditions and fed autoclaved standard
chow and water. Their functional lymphocyte deficiency was tested by
quantifiying the serum immunglobulin levels with the enzyme-linked
immunosorbent assay (ELISA) technique using the protocol of IFFA Credo
(L'Arbresle, France). Briefly, the sera of the mice were diluted 1:100
with PBS-TB (PBS, 0.05% Tween20, 1% BSA) and incubated at 37°C
for 90 minutes on ELISA plates precoated with rabbit antimouse antibody
(DAKO, Glostrup, Denmark). A standard curve was constructed using a
purified mouse IgG (ICN, Eschwege, Germany) serial diluted in PBS-TB.
In addition, the serum of a BALB/c mouse (1:40,000 with PBS-TB) was
taken as a positive control. After extensive washing with PBS-T (PBS,
0.05% Tween) murine antibodies were detected with goat antimouse
IgG+A+M antibodies conjugated to alkaline phosphatase (1:1,500; Zymed,
San Francisco, CA). Animals with antibody titers exceeding 0.05 mg/mL
were excluded from the experiment. To eradicate residual NK cells, 0.1 mL of antiasialo-GM1 antibody solution (Wako, Osaka, Japan) was
administered intraperitoneally starting 3 days before tumor-cell
grafting and every 5 days until day 17 after tumor-cell injection.
Treatment of tumor-bearing SCID mice.
Solid L540CY Hodgkin's-derived tumors were established in SCID mice as
previously described.5,25 Briefly, exponentially growing
L540CY cells (1.5 × 107) resuspended in 200 µL PBS
were injected subcutaneously into the right flank with a 26-gauge
needle. Tumor development was measured with vernier calipers every 3 days. Animals with established tumors of 4 to 6 mm in diameter were
divided randomly into different groups and received various antibody
preparations and 1 × 107 monocyte-depleted human
peripheral blood lymphocytes in 200 µL PBS intravenously through the
tail vein. The tumor volume was calculated as follows: Volume = d2 × D ×  /6, with d as the smaller and D as
the larger diameter.19 Animals were killed when the tumor
size exceeded 1 cm in diameter, corresponding to a tumor volume of
approximately 0.4 to 0.6 cm3. The data on tumor volumes and
survival times was evaluated using several widely-used statistical
methods. The result of a statistical test assumed to be statistically
significant if the P value was smaller or equal to 5%.
| |
RESULTS |
Cloning and expression of a functional anti-CD16 scFv.
A FACScan analysis of the cloned anti-CD16 scFv produced in E. coli showed minimal binding on CD16+ granulocytes (data
not shown). We therefore looked for possible errors by comparing the
sequence of the heavy- and light-chain variable domains with sequences
of other antibodies within the same subgroup. One marked difference was
the presence of a glutamic acid residue at position 6 of the
VH domain, which is invariably glutamine in the
corresponding VHIIB subgroup. We therefore exchanged this
residue for glutamine by site-directed mutagenesis. After expression in
E. coli and purification of the soluble scFv from the
periplasmic fraction by metal-chelate chromatography, a FACScan analysis showed very little difference in binding of the scFv to
CD16+ granulocytes compared with the parental MoAb (Fig
1). The cloned anti-CD30 scFv was produced
and purified in a similar fashion to that of the anti-CD16 scFv. It
bound well to CD30+ cell lines K562 and L540CY in FACScan
analysis (data not shown).
View larger version (11K):
[in this window]
[in a new window]
| Fig 1.
FACS analysis of anti-CD16 scFv binding to
CD16+ granulocytes. The granulocytes were incubated with
1 µg of parental MoAb A9 or 1 µg purified anti-CD16 scFv. The scFv
binding was detected with the anti-c-myc MoAb 9E10 and
fluorescein-conjugated goat antimouse IgG. A CD16 cell
line (SW 480) was used as a negative control.
|
|
Expression and purification of a CD16/CD30 diabody.
DNA coding for each of the variable domains of the anti-CD16 and
anti-CD30 scFv was inserted into a vector that we previously used to
express an anti-CD19/anti-CD3 diabody.16 The cloned diabody
was expressed in E. coli and isolated according to the procedure we previously described.23 Approximately 3 mg/L
of soluble diabody was isolated from the periplasmic fraction of E. coli. After purification by metal-chelate chromatography and gel-exclusion chromatography yields of 300 µg to 500 µg of
functional diabody were obtained. It appeared to be fairly pure and
contained only minor impurities as shown by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using 12% gels
(Fig 2). To test its binding properties, we
made a FACScan analysis after incubation of the diabody with
CD16+ granulocytes and the HD-derived tumor cell line
L540CY. Its binding to both cell types was comparable to that of the
parental biMoAb (Fig 3). No binding was
observed to the irrelevant human colorectal cell line SW480 (data not
shown).
View larger version (36K):
[in this window]
[in a new window]
| Fig 2.
Gel electrophoresis of the CD16/CD30 diabody. The diabody
was expressed in E. coli, purified by IMAC and analyzed on 12%
SDS-polyacrylamide gels. The protein bands were stained with Coomassie
Blue. Band 1: VH16-VL30; Band 2:
VH30-VL16.
|
|
View larger version (27K):
[in this window]
[in a new window]
| Fig 3.
FACS analysis of bispecific antibodies binding to the
CD30+ L540CY Hodgkin cell line and to CD16+
granulocytes. The tumor cells and the granulocytes were incubated with
20 µg of the parental biMoAb HRS-3/A9 or with 20 µg of the
anti-CD16/anti-CD30 diabody. The binding of the anti-CD16/anti-CD30
diabody to L540CY cells and granulocytes was detected with the
anti-c-myc immunotag antibody 9E10 and fluorescein-conjugated goat
antimouse IgG. Bound BiMoAb HRS-3/A9 was detected with
fluorescein-conjugated goat antimouse IgG. As a negative control,
target cells were incubated with 9E10 and FITC-labeled goat antimouse
IgG alone.
|
|
Cytoxicity to L540CY cells in vitro.
A JAM-test assay measuring the amount of NK cell-mediated DNA
fragmentation was performed to determine the relative cytoxicity of the
diabody compared to the biMoAb and the parental antibodies (Fig
4). A strong cytolytic activity was induced
by the diabody against CD30+ L540CY cells in the presence
of nonstimulated freshly prepared PBL from healthy donors. Its
cytotoxic effect in vitro was clearly better than that of the biMoAb,
even though the parental antibody was added in approximately 1.5 × greater amounts on a molar basis. A mixture of the parental
antibodies, each at 2 µg/mL, had no effect on cytolysis (data not
shown). This superior potency of the diabody was apparent at any
effector to target ratio. No lysis of the CD30+ cells was
observed using the diabody without PBL, and PBL without antibodies did
not induce any spontaneous lysis. Similar assays with the irrelevant
CD30 cell line SW480 showed no significant amounts
of NK cell-mediated cytotoxicity (data not shown).
View larger version (14K):
[in this window]
[in a new window]
| Fig 4.
Cytolytic activity of resting PBL containing
approximately 10% NK cells against the CD30+ cell line
L540CY at different effector:target ratios in a 5-hour JAM-test assay.
The diabody ( ) was used at concentration of 1 µg/mL and the biMoAb
( ) at a concentration of 4 µg/mL. Thus, approximately 1.5× more
biMoAb than diabody was used when calculated on a molar basis. The
diabody (1 µg/mL) without PBL ( ) and PBL alone ( ) were used as
negative controls.
|
|
Effect of diabody on xenotransplanted Hodkgin's lymphoma.
To assess the efficacy of the diabody in preclinical trials, we
compared it with the original biMoAb, which has already been successfully administered to patients in a phase-I/II clinical trial.7 Subcutaneous tumors were established in SCID mice
with a single injection of 1.5 × 107 L540CY cells
into the right flank. The mice were treated with the diabody or the
biMoAb when the tumors reached a size of 4 to 6 mm in diameter. Groups
of 10 tumor-bearing animals received a dose of 100 µg of the
anti-CD16/anti-CD30 diabody or the biMoAb per mouse together with
107 nonstimulated human PBL administered as a single
tail-vein injection. Control groups included 5 tumor-bearing mice that
were treated with the monospecific parental MoAbs and 107
human PBL, 100 µg of the diabody per mouse without PBL, human PBL in
PBS, and PBS alone.
All the animals in the control groups developed tumors larger than 1 cm
in diameter (0.4 to 0.6 cm3) within 18 days. In contrast,
the diabody and the biMoAb caused a tumor regression until day 11 (Fig
5). After this period of time, tumors were
able to be detected once again in both antibody-treated groups and a
critical tumor growth occurred within 35 days. A statistical analysis
of the tumor volumes at day 11 and day 15 using the Mann-Whitney test
and t-test, respectively, showed a highly significant diference
(P < .001) between the control groups and the group treated
with diabody. The graphical representation of the survival times was
plotted according to the method of Kaplan and Meier26 (Fig
6). A comparison of survival times using
the logrank test (Mantel-Haenszel test),27 showed that the
survival time of mice treated with the diabody was significantly
prolonged compared with control animals (P < .0001).
Comparison of the diabody-treated group with the biMoAb-treated group
using the logrank test resulted in a P value of .143 indicating
that no statistically significant difference exists between the two
therapeutic regimes.
View larger version (19K):
[in this window]
[in a new window]
| Fig 5.
Treatment of SCID mice bearing human Hodgkin's lymphoma
xenografts with bispecific antibodies. The mice were treated on day 0 by intravenous injection with 200 µL PBS (x); 1 × 107
human peripheral blood lymphocytes (PBL) in 200 µL PBS (); a
mixture of 100 µg parental MoAb HRS-3 and A9 together with human PBL
( ); 100 µg purified anti-CD16/anti-CD30 diabody with human PBL
( ) or without human PBL (); 100 µg purified biMoAb HRS-3/A9
together with human PBL (). Tumor diameters were recorded twice a
week and tumor volume was calculated as follows: volume = d2 × D × /6 with d as the smaller and D as the
larger tumor diameter.
|
|
View larger version (18K):
[in this window]
[in a new window]
| Fig 6.
Survival of SCID mice bearing xenotransplantated
Hodgkin's tumors. The survival of the groups treated with the diabody
() or biMoAb HRS-3/A9 () was significantly prolonged (P < .0001, logrank test) compared to the following control groups: PBS
alone (x); PBL in PBS (); mixture of parental MoAb HRS-3 and A9 with
PBL (); diabody without PBL (). Animals were removed from the
experiment when the tumor size exceeded 1 cm in diameter (approximatly
0.4 to 0.6 cm3).
|
|
| |
DISCUSSION |
The parental biMoAb of the CD30/CD16 diabody has been used for treating
refractory HD in a clinical phase-I/II trial with encouraging
results.7 One complete remission, 1 partial remission, 3 minor responses, and 1 mixed response were observed in a group of 15 HD
patients. These responses were achieved with a single cycle of antibody
application over a period of 2 weeks. The treatment was well tolerated
and the maximum tolerated dose (MTD) was not reached at an application
of 64 mg/m2. Further cycles of treatment and an estimate of
the MTD were not possible because of the limited amount of material
available. This was mainly due to the prohibitive cost of producing and
purifying the bispecific antibody from a hybrid hybridoma cell line, a
procedure requiring the separation of the bispecific antibody from 9 other similar molecules comprising all of the possible combinations of
heavy and light chains. In addition to the problem of obtaining enough
material, a more-extensive treatment of the patients is limited by the
development of a human antimouse antibody (HAMA) response. For example,
9 of the patients developed antimouse Ig antibodies, and 4 of these
patients developed an allergic reaction after attempted retreatment.
The diabody described in the present investigation was designed to
overcome these problems. It consists only of the variable domains of
the parental bispecific antibody, thus considerably reducing the
immunogenic potential. Recombinant dimeric antibodies have also been
produced in relatively large quantities in E. coli13,28 and are therefore expected to be much easier
to produce and purify. Previous attempts to produce (scFv)2
molecules of another specificity as recommended by Gruber et al
8 were unsatisfactory in our hands because of the small
yields of functional bispecific molecules made in E. coli. We
therefore favored the more-rigid crossover scFv dimer (diabody), which
has been shown to have two antigen-binding sites at opposite ends of
the molecule separated by 65Å, a distance sufficient to span the
distance between two cells.11,14 The anti-CD16 domains of
the diabody could only bind well after exchanging glutamic acid at
position 6 for glutamine. A similar restoration of the binding activity
and improved secretion upon substituting an amino acid at this position
with glutamine was observed for an anti-CD3 scFv.22
The results of in vitro cytoxicity assays indicated that the diabody
was more effective than the parent bispecific antibody in recruiting NK
cells for lysing the target CD30+ L540CY cell line. A
similar phenomenon was observed with a BCL-1 idiotype/CD3 diabody that
was able to induce the lysis of target cells with activated T cells
more efficiently than its parent bispecific antibody.11 The
greater potency of diabodies may be due to the closer proximity of the
target and effector cells, because the antigen binding sites are only
separated by 65 Å. For comparison, the antigen-binding sites in an IgG
molecule can span a distance of up to 150 Å.14 Another
possibility is that the Fc domains of the biMoAb may reduce the
efficiency of lysis by competing for binding to the FcIII receptor.
In animal model experiments, the CD30/CD16 diabody was able to induce a
marked regression of xenotransplanted human Hodgkin's tumors in SCID
mice similar to that obtained after administration of the parental
bispecific antibody. In a previous study using exactly the same
conditions, it was shown that just one application of the biMoAb was
able to cure nearly half of the animals.5 The fact that no
permanent cures were achieved with the biMoAb or the diabody in the
current series of experiments and that the growth rate of the Hodgkin
cell line had increased indicate the evolution of a more-aggressive
tumor cell line in the interval between these two series of
experiments. This in vivo performance of the diabody is quite
impressive considering that it was administered as a single dose and is
probably cleared much faster than the biMoAb. For example, single-chain
antibodies (29 kD) were found to have a t1/2 of
approximately 3.5 hours, 29 a diabody (50 kD) had a
t1/2 of 6.42 hours,30 and an IgG1 (150 kD)
had a t1/2 of 107 hours.31 The bispecific
CD16/CD30 diabody has a molecular weight of 59 kD. In addition to the
greater efficacy of the diabody for cell lysis shown in in vitro tests,
the small size of the diabody probably facilitates a more-extensive
tumor penetration as already shown for single-chain
antibodies.32 This will be investigated in future
pharmacokinetic studies.
These results, to our knowledge the first describing an in vivo
application of bispecific diabodies for treating experimental tumors,
suggest that the diabody can be used to replace the bispecific MoAb for
treating refractory HD. The possibility of producing and purifying the
diabody at relatively low cost and its lower immunogenicity should
facilitate larger clinical trials with more-extensive cycles of treatment.
| |
ACKNOWLEDGMENT |
We thank Dr A. Hombach (Klinik I für Innere Medizin, Labor
Tumorgenetik, Universität zu Köln, Köln, Germany) for
kindly providing the anti-CD 30 scFv fragment and A. Benner
(Biostatistics Group, German Cancer Research Center [DKF2],
Heidelberg, Germany) for statistical analyses of the animal experiments.
| |
FOOTNOTES |
Submitted March 10, 1999; accepted June 16, 1999.
M.A.E.A. and J.K. contributed equally to this work.
Supported by a grant from Deutsche Krebshilfe/Dr
Mildred-Scheel-Stiftung, No. W5/93/PF 3.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address correspondence to Professor M. Little, MD,
Recombinant Antibody Research Group (D0500), German Cancer Research
Center (DKFZ), Im Neuenheimer Feld 280, D-69120 Heidelberg, Germany;
e-mail: m.little{at}dkfz-heidelberg.de.
| |
REFERENCES |
1.
Herberman RB, Ortaldo JR:
Natural killer cells: The role in defense against disease.
Science
214:24, 1981[Abstract/Free Full Text]
2.
Gudelj L, Deniz G, Rukavina D, Johnson PM, Christmas SE:
Expression of functional molecules by human CD3-decidual granular leucocyte clones.
Immunology
87:609, 1996[Medline]
[Order article via Infotrieve]
3.
Moretta A, Tambussi G, Ciccone E, Pende D, Melioli G, Moretta L:
CD16 surface molecules regulate ths cytolytic function of CD3CD16+ human natural killer cells.
Int J Cancer
44:727, 1989[Medline]
[Order article via Infotrieve]
4.
Fanger MW, Morganelli PM, Guyre PM:
Use of bispecific antibodies in the therapy of tumors.
Cancer Treat Res
68:181, 1993[Medline]
[Order article via Infotrieve]
5.
Hombach A, Jung W, Renner C, Sahin U, Schmits R, Wolf J, Kapp U, Diehl V, Pfreundschuh M:
A CD16/CD30 bispecific monoclonal antibody induces lysis of Hodgkin's cells by unstimulated natural killer cells in vitro and in vivo.
Int J Cancer
55:830, 1993[Medline]
[Order article via Infotrieve]
6.
Stein H, Mason DY, Gerdes J, O'Connor N, Wainscoat J, Pallesen G, Gatter B, Falini B, Delsol G, Lemke H, Schwarting R, Lennert K:
The expression of the Hodgkin's disease associated antigen Ki-1 in reactive and neoplastic lymphoid tissue: Evidence that Reed-Sternberg cells and histiocytic malignancies are derived from activated lymphoid cells.
Blood
66:848, 1985[Abstract/Free Full Text]
7.
Hartmann F, Renner C, Jung W, Deisting C, Juwana M, Eichentopf B, Kloft M, Pfreundschuh M:
Treatment of refractory Hodgkin's disease with an anti-CD16/CD30 bispecific antibody.
Blood
89:2042, 1997[Abstract/Free Full Text]
8.
Gruber M, Schodin BA, Wilson ER, Kranz DM:
Efficient tumor cell lysis mediated by a bispecific single chain antibody expressed in Escherichia coli.
J Immunol
152:5368, 1994[Abstract]
9.
Mack M, Riethmüller G, Kufer P:
A small bispecific antibody construct expressed as a functional single-chain molecule with high tumor cell cytotoxicity.
Proc Natl Acad Sci USA
92:7021, 1995[Abstract/Free Full Text]
10.
Holliger P, Prospero T, Winter G:
"Diabodies": Small bivalent and bispecific antibody fragments.
Proc Natl Acad Sci USA
90:6444, 1993[Abstract/Free Full Text]
11.
Holliger P, Brissinck J, Williams RL, Thielmans K, Winter G:
Specific killing of lymphoma cells by cytotoxic T-cells mediated by a bispecific diabody.
Protein Eng
9:299, 1996[Abstract/Free Full Text]
12.
Atwell JL, Pearce LA, Lah M, Gruen LC, Kortt A, Hudson P:
Design and expression of a stable bispecific scFv dimer with affinity for both glycophorin and N9 neurominidase.
Mol Immunol
33:1301, 1996[Medline]
[Order article via Infotrieve]
13.
Zhu Z, Zapata G, Shalaby R, Snedecor B, Chen H, Carter P:
High-Level secretion of a humanized bispecific diabody from Escherichia coli.
Biotechnology
14:192, 1996[Medline]
[Order article via Infotrieve]
14.
Perisic O, Webb PA, Holliger P, Winter G, Williams RL:
Crystal structure of a diabody, a bivalent antibody fragment.
Structure
2:1217, 1994[Medline]
[Order article via Infotrieve]
15.
Kipriyanov SM, Kupriyanova OA, Little M, Moldenhauer G:
Rapid detection of recombinant antibody fragments directed against cell-surface antigens by flow cytometry.
J Immunol Methods
196:51, 1996[Medline]
[Order article via Infotrieve]
16.
Kipriyanov SM, Moldenhauer G, Srauss G, Little M:
Bispecific CD3 × CD19 diabody for T cell-mediated lysis of malignant human B cells.
Int J Cancer
77:763, 1998[Medline]
[Order article via Infotrieve]
17.
Hombach A, Pohl C, Heuser C, Sircar R, Diehl V, Abken H:
Isolation of single chain antibody fragments with specificity for cell surface antigens by phage display utilizing internal image anti-idiotypic antibodies.
J Immunol Methods
218:53, 1998[Medline]
[Order article via Infotrieve]
18.
Pfreundschuh M, Mommertz E, Meissner M, Feller AC, Hassa R, Krueger GRF, Diehl V:
Hodgkin and Reed-Sternberg cell associated monoclonal antibodies HRS-1 and HRS-2 react with activated cells of lymphoid and monocytoid origin.
Anticancer Res
8:217, 1988[Medline]
[Order article via Infotrieve]
19.
Engert A, Martin G, Preundschuh M, Amlot P, Hsu SM, Diehl V, Thorpe P:
Antitumor effects of ricin A chain immunotoxins prepared from intact antibodies and Fab' fragments on solid human Hodgkin's disease tumors in mice.
Cancer Res
50:2929, 1990[Abstract/Free Full Text]
20.
von Kalle C, Wolf J, Becker A, Sckaer A, Munck M, Engert A, Kapp U, Fonatsch C, Komitowski D, Féaux de Lacroix W, Diehl V:
Growth of Hodgkin cell lines in severely combined immunodeficient mice.
Int J Cancer
52:887, 1992[Medline]
[Order article via Infotrieve]
21.
Sanger F, Nicklen S, Coulson R:
DNA sequencing with chain terminating inhibitors.
Proc Natl Acad Sci USA
74:5463, 1977[Abstract/Free Full Text]
22.
Kipriyanov SM, Moldenhauer G, Martin ACR, Kupriyanova OA, Little M:
Two amino acid mutations in an anti-human CD3 single chain Fv antibody fragment that affect the yield on bacterial secretion but not the affinity.
Protein Eng
10:445, 1997[Abstract/Free Full Text]
23.
Kipriyanov SM, Moldenhauer G, Little M:
High level production of soluble single chain antibodies in small-scale Eschericha coli cultures.
J Immunol Methods
200:69, 1997[Medline]
[Order article via Infotrieve]
24.
Matzinger P:
The JAM test.
J Immunol Methods
145:185, 1991[Medline]
[Order article via Infotrieve]
25.
Renner C, Pfreundschuh M:
Treatment of heterotransplanted Hodgkin's tumors in SCID mice by a combination of human NK or T cells and bispecific antibodies.
J Hematother
4:447, 1995[Medline]
[Order article via Infotrieve]
26.
Kaplan EL, Meier P:
Nonparametric estimation from incomplete observations.
J Am Stat Assoc
53:457, 1958
27.
Mantel N, Haenszel W:
Statistical aspects of the analysis of data from retrospective studies of disease.
J Natl Cancer Inst
22:719, 1959
28.
Horn U, Strittmatter W, Krebber A, Knupfer U, Kujau M, Wenderoth R, Müller K, Matzku S, Plückthun A, Riesenberg D:
High volumetric yields of functional dimeric miniantibodies in Escherichia coli, using an optimized expression vector and high-cell-density fermentation under non-limited growth conditions.
Appl Microbiol Biotechnol
46:524, 1996[Medline]
[Order article via Infotrieve]
29.
Huston JS, George AJT, Adams GP, Stafford WF, Jamar F, Tai MS, McCartney JE, Oppermann H, Heelan BT, Peters AM, Houston LL, Bookman MA, Wolf EJ, Weiner LM:
Single-chain Fv radioimmunotargeting.
Q J Nucl Med
40:320, 1996[Medline]
[Order article via Infotrieve]
30.
Adams GP, Schier R, McCall AM, Crawford RS, Wolf EJ, Weiner LM, Marks JD:
Prolonged in vivo tumour retention of a human diabody targeting the extracellular domain of human HER2/neu.
Br J Cancer
77:1405, 1998[Medline]
[Order article via Infotrieve]
31.
Weiner LM, Houston LL, Huston JS, McCartney JE, Tai MS, Apell G, Stafford WF, Bookman MA, Gallo JM, Adams GP:
Improving the tumor-selective delivery of single-chain Fv molecules.
Tumor Targeting
1:51, 1995
32.
Yokota T, Milenic DE, Withlow M, Schlom J:
Rapid tumor penetration of a single-chain Fv and comparison with other immunglobulin forms.
Cancer Res
52:3402, 1992[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. Schlapschy, M. Fogarasi, H. Gruber, O. Gresch, C. Schafer, Y. Aguib, and A. Skerra
Functional humanization of an anti-CD16 Fab fragment: obstacles of switching from murine {lambda} to human {lambda} or {kappa} light chains
Protein Eng. Des. Sel.,
March 1, 2009;
22(3):
175 - 188.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Germain, E. Campigna, I. Salhi, S. Morisseau, I. Navarro-Teulon, J.-P. Mach, A. Pelegrin, and B. Robert
Redirecting NK cells mediated tumor cell lysis by a new recombinant bifunctional protein
Protein Eng. Des. Sel.,
November 1, 2008;
21(11):
665 - 672.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Asano, Y. Sone, K. Ikoma, H. Hayashi, T. Nakanishi, M. Umetsu, Y. Katayose, M. Unno, T. Kudo, and I. Kumagai
Preferential heterodimerization of a bispecific diabody based on a humanized anti-EGFR antibody 528
Protein Eng. Des. Sel.,
October 1, 2008;
21(10):
597 - 603.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Asano, Y. Sone, K. Makabe, K. Tsumoto, H. Hayashi, Y. Katayose, M. Unno, T. Kudo, and I. Kumagai
Humanization of the Bispecific Epidermal Growth Factor Receptor x CD3 Diabody and Its Efficacy as a Potential Clinical Reagent.
Clin. Cancer Res.,
July 1, 2006;
12(13):
4036 - 4042.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Kawakami, K. Kawakami, M. Kioi, P. Leland, and R. K. Puri
Hodgkin lymphoma therapy with interleukin-4 receptor-directed cytotoxin in an infiltrating animal model
Blood,
May 1, 2005;
105(9):
3707 - 3713.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Schlapschy, H. Gruber, O. Gresch, C. Schafer, C. Renner, M. Pfreundschuh, and A. Skerra
Functional humanization of an anti-CD30 Fab fragment for the immunotherapy of Hodgkin's lymphoma using an in vitro evolution approach
Protein Eng. Des. Sel.,
December 1, 2004;
17(12):
847 - 860.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Le Gall, U. Reusch, M. Little, and S. M. Kipriyanov
Effect of linker sequences between the antibody variable domains on the formation, stability and biological activity of a bispecific tandem diabody
Protein Eng. Des. Sel.,
April 1, 2004;
17(4):
357 - 366.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. M. Kipriyanov, B. Cochlovius, H. J. Schafer, G. Moldenhauer, A. Bahre, F. Le Gall, S. Knackmuss, and M. Little
Synergistic Antitumor Effect of Bispecific CD19 x CD3 and CD19 x CD16 Diabodies in a Preclinical Model of Non-Hodgkin's Lymphoma
J. Immunol.,
July 1, 2002;
169(1):
137 - 144.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Hartmann, C. Renner, W. Jung, L. da Costa, S. Tembrink, G. Held, A. Sek, J. Konig, S. Bauer, M. Kloft, et al.
Anti-CD16/CD30 Bispecific Antibody Treatment for Hodgkin's Disease: Role of Infusion Schedule and Costimulation with Cytokines
Clin. Cancer Res.,
July 1, 2001;
7(7):
1873 - 1881.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Schmiedl, F. Breitling, and S. Dubel
Expression of a bispecific dsFv-dsFv' antibody fragment in Escherichia coli
Protein Eng. Des. Sel.,
October 1, 2000;
13(10):
725 - 734.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S.-i. Takemura, R. Asano, K. Tsumoto, S. Ebara, N. Sakurai, Y. Katayose, H. Kodama, H. Yoshida, M. Suzuki, K. Imai, et al.
Construction of a diabody (small recombinant bispecific antibody) using a refolding system
Protein Eng. Des. Sel.,
August 1, 2000;
13(8):
583 - 588.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Cochlovius, S. M. Kipriyanov, M. J. J. G. Stassar, J. Schuhmacher, A. Benner, G. Moldenhauer, and M. Little
Cure of Burkitt's Lymphoma in Severe Combined Immunodeficiency Mice by T Cells, Tetravalent CD3 CD19 Tandem Diabody, and CD28 Costimulation
Cancer Res.,
August 1, 2000;
60(16):
4336 - 4341.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
B. Cochlovius, S. M. Kipriyanov, M. J. J. G. Stassar, O. Christ, J. Schuhmacher, G. Strau{beta}, G. Moldenhauer, and M. Little
Treatment of Human B Cell Lymphoma Xenografts with a CD3 CD19 Diabody and T Cells
J. Immunol.,
July 15, 2000;
165(2):
888 - 895.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION