|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, Vol. 94 No. 8 (October 15), 1999:
pp. 2575-2582
By
From the Department of Pediatric Immunology, Unit INSERM U429,
Hôpital Necker-Enfants-Malades, Paris, France; the Department of
Pediatric Immunology, Hospital Garrahan, Buenos-Aires, Argentina; the
Department of Clinical Hematology, CHRU de Dijon, Dijon, France; the
Department of Pediatrics, Hôpital de Bicêtre, Le Kremlin
Bicêtre, France; the Department of Pediatric Immunology,
Newcastle General Hospital, Newcastle upon Tyne, UK; the Department of
Pediatric Immunology, Hôpital Debrousse, Lyon, France; the
Department of Pediatric Hematology, Hôpital Intercommunal,
Créteil, France; the Department of Clinical Immunology, Oxford
Radcliffe Hospital, Headington, Oxford, UK; The Juliane Marie Center,
Copenhagen, Denmark; and the Department of Pediatrics, Central Army
Hospital, Alger, Algeria.
Fas (CD95/Apo-1) mutations were previously reported as the genetic
defect responsible for human lymphoproliferative syndrome associated
with autoimmune manifestations (also known as autoimmune lymphoproliferative syndrome or Canale-Smith syndrome). We have identified 14 new heterozygous Fas mutations. Analysis of patients and
families allow us to further dissect this syndrome with regards to the
relationship between Fas mutations, inheritance pattern, and phenotype
as observed on long-term follow-up. In vitro studies show that
lymphocytes from all Fas mutant carriers exhibit a
Fas-antibody-induced apoptosis defect. However, among the 8 inherited
mutations, 4 of 4 Fas missense mutations were associated with high
clinical penetrance, whereas 3 of 4 mutations leading to a truncated
Fas product were associated with variable clinical penetrance. This suggests that a second defect, in another yet undefined factor involved
in apoptosis and/or lymphoproliferation control, is necessary to induce
full clinical expression of the disease. These results also indicate
that the currently available antibody-mediated in vitro apoptosis assay
does not necessarily reflect the in vivo ability of abnormal Fas
molecules to trigger lymphocyte death. In addition, we found that
lymphoproliferative manifestations resolved with age, whereas
immunological disorders [ie, hypergammaglobulinemia and detection of
TcR
Fas IS A MOLECULE belonging to the tumor
necrosis factor (TNF) receptor family.1 A subfamily has
been defined as those expressing an intracytoplasmic domain called the
death domain (DD).2 Several newly described molecules, such
as Apo-3 (also called DR3, Tramp, Wsl-1, and Lard)3-7 and
the Trail receptors,8 belong to this growing subfamily, in
which Fas and TNFR are the prototypes. They are all able to trigger a
death signal upon oligomerization. This signal is given through the
interactions of their DD with DD-containing adapter molecules (such as
FADD, TRADD, Rip, and RAIDD).9-14 These adapters are
thought to interact with proteases of the caspase family through
interactions of domains called death effector domains (DED) and caspase
recruitment domains (CARD).15 In particular, formation of a
death-inducing signaling complex (DISC) including Fas, FADD, and
Flice/Caspase-8 seems to be a crucial step in the cascade activation of
Caspases and delivering a death signal.9,16,17
The role of the Fas-FasL interaction in controlling lymphocyte
homeostasis has been described in the lpr and gld mouse
models.1 These mice, carrying genetic defects in the
Fas18 and FasL19 genes, respectively, exhibit
lymphoproliferation and severe autoimmune manifestations. Similar
manifestations have also been observed in humans.20-22 The
human disease appears to be more complex than the mouse disease models,
because the lymphoproliferative syndrome and autoimmune manifestations
(also called ALPS) are associated with mutations on
both21,23,24 or only 1 Fas allele.21-23,25 Both
homozygous Fas mutations described were null mutations as Fas
expression could not be detected at the cell surface. In these cases,
the phenotype is extremely severe.23,26 Heterozygous Fas
mutations have been shown to be responsible for a less severe lymphoproliferative syndrome and variable autoimmune
manifestations.26,27 Two forms of inheritance have been
reported. Autosomal recessive inheritance has been described in
patients in whom both Fas alleles are mutated, whereas heterozygous
carriers are asymptomatic.21,23,24 In contrast, inheritance
of lymphoproliferative syndrome with autoimmunity associated with
heterozygous Fas mutations is less clear. In some pedigrees, a clear
autosomal dominant inheritance pattern is found.22,25,27 In
others, only some carriers present with clinical
symptoms.25-28 We describe here the spectrum of clinical, immunological, and genetic features of 16 patients with
lymphoproliferative syndrome and autoimmunity who are heterozygous
for Fas mutations.
Patients
Antibodies
Apoptosis Assay Peripheral mononuclear cells were isolated from freshly drawn heparinized blood by means of Ficoll-hypaque (Pharmacia, Uppsala, Sweden) density gradient centrifugation. They were activated for 6 days with phytohemagglutinin (PHA) and interleukin-2 (IL-2; Genzyme; 20 IU/mL) and then cultured with Apo-1 MoAb (250 ng/mL) and a rat-antimouse IgG (Jackson Laboratories, Westgrove, PA; 10 µg/mL) for 24 hours. Apoptotic cells were quantified as described elsewhere.31 Briefly, cells were resuspended in a hypotonic solution containing 0.1% sodium citrate, 0.1% Triton X-100 (Sigma), and 50 µg/mL propidium iodide (Sigma). Red fluorescence was measured using a FACStar plus flow cytometer (Becton Dickinson). Apoptotic cells were counted as hypodiploid. The data are expressed as the percentage calculated as follows: (apoptosis observed in the patient)/(apoptosis observed in the control) × 100. The in vitro apoptosis observed in the controls and mutation negative relatives was always greater than 80%.Detection of Fas Mutations DNA samples were prepared from activated lymphocytes using standard methods.32 Single-strand conformation polymorphism (SSCP) was assayed as described elsewhere.22 Genomic DNA segments of 90 to 350 bp were amplified with following primers: Exon I F (5' GGAACACACCCTGAGGCCAG 3'); Exon I R (5' CCTCCACCCGGGCAGGGAAG 3'); Exon II F (5' TAAAATTCTCTTCATGCTTT 3'); Exon II R (5' CTGTAATCTCTGGATGTTTG 3'); Exon IIIa F (5' TTGTCTGTCATCCCTCTATACTTCCC 3'); Exon IIIa R (5' ATCACACAATCTACATCTTCTGCA 3'); Exon IIIb F (5' TGCCAAGAAGGGAAGGAGTA 3'); Exon IIIb R (5' ATTTGAGCTGATGAACCCTGTTCC 3'); Exon IV F (5' TAACTAATAGTTTCCAAACT 3'); Exon IV R (5' TGTTTTAATCTCTGAAAGAC 3'); Exon V F (5' TTTGAATTTCTCCTGTATTT 3'); Exon V R (5' GGGGAAAGGAGAATATAACC 3'); Exon VI F (5' CATATAATATGCCAATGTTC 3'); Exon VI R (5' AATCTGCAGTTTGAACAAAG 3'); Exon VII F (5' CATGCATTCTACAAGGCTGAGACC3'); Exon VII R (5' TTTTCTTTTCAAGGAAAGCTGATACC 3'); Exon VIII F (5' ACTTCTTTCTGAATTAAGGA 3'); Exon VIII R (5' GCAGGTAGAATTGTATGAGA 3'); Exon IXa F (5' CTGAAGTACTATAAAGAGAAAT 3'); Exon IXa R (5' CTTTCTGTTCTGCTGTGTCTTG 3'); Exon IXb F (5' GAGATCAAGAATGACAATGT 3'); and Exon IXb R (5' ACAGCCAGCTATTAAGAATC 3').
Fas Mutation Identification (Table 1) Fourteen different heterozygous Fas gene mutations were detected in this series of 14 families. Eleven mutations mapped to exon 9, 2 to intron 8 (donor splice site), and 1 to exon 3 (Fig 1). In 6 patients (no. 1, 2, 4, 5, 6, and 13) Fas gene mutations were found as de novo mutations. Patients no. 1, 4, and 5 had missense mutations in exon 9 leading to a Glu256 Lys, Ile243Arg, and Thr254Lys
substitution, and in patient no. 6 a 4-bp duplication (at nucleotide
921 or 928) resulted in a premature stop codon at residue 229. In
patient no. 13, a 2-bp insertion at nucleotide 885 led to a frame-shift
and a premature stop codon at amino acid position 224. This mutation
should result in a truncated Fas protein lacking the DD.
Clinical Features Lymphoproliferative syndrome.
The patients' clinical features are summarized in
Table 2. Two relatives' cases were also
reported (patient no. 10's brother and patient no. 12's first cousin)
as they were fully investigated. The first manifestations appeared
before 2 years of age in half of the patients (range, 1 month to 7 years). A splenectomy was performed in 7 patients either because of
discomfort (patients no. 8 and 9) or because of hypersplenism (patients
no. 5, 7, 11, 12b, and 13). The lymphadenopathy was severe in 12 patients, consisting of multiple lymph nodes larger than 2 cm. No
malignancy was observed, but this may relate to the young age and
limited duration of medical follow-up of several patients.
Autoimmune manifestations. Autoimmune manifestations were detected in 9 patients (Table 2). Urticarial rash (patients no. 1 and 8) and uveitis (patients no. 4 and 6) were each found in 2 patients, respectively. Glomerulonephritis, cutaneous vasculitis, Guillain Barre syndrome, and arthritis were found in 1 patient each. Three patients suffered severe autoimmune thrombopenia and 3 suffered autoimmune hemolytic anemia with the detection of corresponding autoantibodies. In patient no. 7, the hemolytic anemia was associated with a dyserythropoiesis that was sensitive to corticosteroid therapy. Seven patients presented no autoimmune manifestations. Immunological studies.
Hypergammaglobulinemia was found in all but 1 patient. It was
associated with hyper IgA in 10 cases. The serum IgM level was either
normal or low in 7 patients. Panhypogammaglobulinemia was detected in 1 patient (no. 5). Blood lymphocyte counts were high in 3 cases (patients
no. 1, 5, and 13). In all cases, a subset of TcR Evolution of clinical manifestations with age (Table
3).
Seven patients were observed for at least 10 years. For 3 of them (no.
2, 6, and 9), the medical follow-up was performed by the same
physician. In 4 patients (no. 2, 6, 9, and 14), splenomegaly and/or
lymphadenopathy were detected within the first 5 years of life. For the
other 3, the lymphoproliferative syndrome was detected at 6 (patient
no. 8), 8 (patient no. 11), and 12 years of age (patient no. 12b),
respectively. In the 3 patients, who are now more than 20 years of age
(patients no. 8, 9, and 12b), the lymphoproliferative syndrome has
progressively regressed. Nevertheless, a single lymph node more than 5 cm in diameter was detected in patient no. 8 (when 24 years old), and
in patient no. 9 (when 35 years old) an enlarged accessory spleen,
detected 2 years ago, was surgically removed. In patient no. 12b, a
splenomegaly was first noted at 12 years of age; lymphadenopathy
appeared after splenectomy was performed, but was no longer detectable
at 25 years of age. In addition, patient no. 14's mother presented in childhood with splenomegaly and lymphadenopathy that had resolved by 26 years of age. In patient no. 2, although massive lymphadenopathy was
observed before 5 years of age, this was no longer detectable by 15 years of age. In patient no. 6, no major change was observed during the
follow-up. In patient no. 11, lymphadenopathy decreased with time and
by 19 years only a few cervical nodes were detected. These observations
suggest that the lymphoproliferative syndrome is more pronounced during
childhood and tends to regress in adulthood. In contrast, the
immunological features of the syndrome, ie, hypergammaglobulinemia and
the presence of circulating CD4(
Family analysis.
Genetic analysis was performed in 14 families. De novo mutations were
detected in 6 patients (Table 1). In these families, Fas-induced
apoptosis was normal in both parents, consistent with the absence of
Fas gene mutations. Neither clinical nor immunological features were
detectable in the parents. Inherited mutations were found in 8 families
(Table 1). Mutations were inherited from the mother in 5 cases and from
the father in 3 cases. In 1 case (patient no. 7), the mutation was also
detected in the maternal grandfather. In 5 families (patients no. 3, 7, 9, 10, and 14), all relatives who carried the mutated Fas gene
presented with abnormal anti-Fas MoAb-mediated apoptosis (7/7) and
clinical manifestations (7/7), including splenomegaly associated in
some cases with lymphadenopathy. The severity of lymphoproliferative
syndrome did not correlate with the number of TcR
We have studied 16 patients (in 14 families) with lymphoproliferative syndrome and autoimmunity associated with defect in Fas-induced apoptosis. All of the 14 new Fas mutations are heterozygous. This finding is consistent with previous reports in which patients with lymphoproliferative syndrome and autoimmunity (also referred to as autoimmune lymphoproliferative syndrome [ALPS] and Canale-Smith syndrome) were shown to carry such mutations.21-23,25,28 The dominance of this genetic defect is likely to be due to the fact that trimerization of the Fas molecule is necessary to form a DISC and to trigger the death signal.9,37 Therefore, a mutated Fas protein would have to be produced to exert a dominant negative effect and partially (or totally) inhibit the apoptotic signal.
Submitted January 25, 1999; accepted May 30, 1999.
Supported by grants from Institut National de la Santé et de la Recherche Médicale, Assistance Public-Hôpitaux de Paris (PHRC AOM 96127), Association Française contre les Myopathies, Ligue Nationale contre la Cancer, and PHRC European concerted action Biomed-2 983007.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact.
Address reprint requests to Frédéric Rieux-Laucat, PhD, INSERM U429, Hôpital Necker-Enfants Malades, 149, rue de Sèvres, 75743 Paris Cedex 15, France; e-mail: rieux{at}necker.fr.
1.
Nagata S, Golstein P:
The Fas death factor.
Science
267:1449, 1995
2.
Ashkenazi A, Dixit VM:
Death receptors: Signaling and modulation.
Science
281:1305, 1998
3.
Chinnaiyan AM, O'Rourke K, Yu G, Lyons RH, Garg M, Duan DR, Xing L, Gentz R, Ni J, Dixit V:
Signal transduction by DR3, a death domain-containing receptor related to TNF-R1 and CD95.
Science
274:990, 1996 4. Kitson J, Raven T, Jiang Y, Goeddel DV, Giles KM, Pun K, Grinham CJ, Brown R, Farrow SN: A death-domain-containing receptor that mediates apoptosis. Nature 384:372, 1996[Medline] [Order article via Infotrieve] 5. Marsters SA, Sheridan JP, Donahue CJ, Pitti RM, Gray CL, Goddard AD, Bauer KD, Ashkenazi A: Apo-3, a new member of the tumor necrosis factor receptor family, contains a death domain and activates apoptosis and NF-kappa B. Curr Biol 6:1669, 1996[Medline] [Order article via Infotrieve] 6. Bodmer JL, Burns K, Schneider P, Hofmann K, Steiner V, Thome M, Bornand T, Hahne M, Schroter M, Becker K, Wilson A, French LE, Browning JL, MacDonald R, Tschopp J: TRAMP, a novel apoptosis-mediating receptor with sequence homology to TNFR1 and Fas (Apo-1/CD95). Immunity 6:79, 1997[Medline] [Order article via Infotrieve]
7.
Screaton GR, Xu XN, Olsen AL, Cowper AE, Tan R, McMichael AJ, Bell JI:
LARD: A new lymphoid-specific death domain containing receptor regulated by alternative pre-mRNA splicing.
Proc Natl Acad Sci USA
94:4615, 1997 8. Griffith TS, Lynch DH: TRAIL: A molecule with multiple receptors and control mechanisms. Curr Opin Immunol 10:559, 1998[Medline] [Order article via Infotrieve] 9. Kischkel FC, Hellbardt S, Behrmann I, Germer M, Pawlita M, Krammer PH, Peter ME: Cytotoxicity-dependent APO-1 (Fas/CD95)-associated proteins form a death-inducing signaling complex (DISC) with the receptor. EMBO J 14:5579, 1995[Medline] [Order article via Infotrieve]
10.
Boldin M, Varfolomeev E, Pancer Z, Mett I, Camonis J, Wallach D:
A novel protein that interacts with the death domain of fas/APO1 contains a sequence motif related to the death domain.
J Biol Chem
270:7795, 1995 11. Chinnaiyan A, O'Rourke K, Tewari M, Dixit V: FADD, a novel death domain-containing protein, interacts with the death domains of fas and initiates apoptosis. Cell 81:505, 1995[Medline] [Order article via Infotrieve] 12. Hsu H, Xiong J, Goeddel DV: The TNF receptor 1-associated protein TRADD signals cell death and NF-kappa B activation. Cell 81:495, 1995[Medline] [Order article via Infotrieve] 13. Stanger B, Leder P, Lee T, Kim E, Seed B: RIP: A novel protein containing a death domain that interacts with fas/APO-1(CD95) in yeast and causes cell death. Cell 81:513, 1995[Medline] [Order article via Infotrieve] 14. Duan H, Dixit VM: RAIDD is a new `death' adaptor molecule. Nature 385:86, 1997[Medline] [Order article via Infotrieve] 15. Hofmann K, Bucher P, Tschopp J: The CARD domain: A new apoptotic signalling motif. Trends Biochem Sci 22:155, 1997[Medline] [Order article via Infotrieve] 16. Muzio M, Chinnaiyan AM, Kischkel FC, O'Rourke K, Shevchenko A, Ni J, Scaffidi C, Bretz JD, Zhang M, Gentz R, Mann M, Krammer PH, Peter ME, Dixit VM: FLICE, a novel FADD-homologous ICE/CED3-like Protease, is recruited to the CD95 (Fas/APO-1) death-inducing signaling complex. Cell 85:817, 1996[Medline] [Order article via Infotrieve] 17. Boldin MP, Goncharov TM, Goltsev YV, Wallach D: Involvement of MACH, a novel MORT1/FADD-interacting protease, in Fas/APO-1-and TNF receptor-induced cell death. Cell 85:803, 1996[Medline] [Order article via Infotrieve] 18. Watanabe-Fukunaga R, Brannan CI, Copeland NG, Jenkins NA, Nagata S: Lymphoproliferation disorder in mice explained by defect in Fas antigen that mediates apoptosis. Nature 356:314, 1992[Medline] [Order article via Infotrieve] 19. Takahashi T, Tanaka M, Brannan CI, Jenkins NA, Copeland NG, Suda T, Nagata S: Generalized lymphoproliferative disease in mice, caused by a point mutation in the FAS ligand. Cell 76:969, 1994[Medline] [Order article via Infotrieve] 20. Sneller MC, Straus SE, Jaffe ES, Jaffe JS, Fleisher TA, Stetler-Stevenson M, Strober W: A novel lymphoproliferative/autoimmune syndrome resembling murine lpr/gld disease. J Clin Invest 90:334, 1992
21.
Rieux-Laucat F, Le Deist F, Hivroz C, Roberts I, Debatin K, Fischer A, de Villartay J:
Mutations in fas associated with human lymphoproliferative syndrome and autoimmunity.
Science
268:1347, 1995 22. Fisher G, Rosenberg F, Straus S, Dale J, Middelton L, Lin A, Strober W, Lenardo M, Puck J: Dominant interfering fas gene mutations impair apoptosis in a human autoimmune lymphoproliferative syndrome. Cell 81:935, 1995[Medline] [Order article via Infotrieve]
23.
Kasahara Y, Wada T, Niida Y, Yachie A, Seki H, Ishida Y, Sakai T, Koizumi F, Koizumi S, Miyawaki T, Taniguchi N:
Novel Fas (CD95/APO-1) mutations in infants with a lymphoproliferative disorder.
Int Immunol
10:195, 1998
24.
Bettinardi A, Brugnoni D, Quirosroldan E, Malagoli A, Lagrutta S, Correra A, Notarangelo LD:
Missense mutations in the Fas gene resulting in autoimmune lymphoproliferative syndrome
25.
Drappa J, Vaishnaw AK, Sullivan KE, Chu J-L, Elkon KB:
Fas gene mutations in the Canale-Smith syndrome, an inherited lymphoproliferative disorder associated with autoimmunity.
N Engl J Med
335:1643, 1996 26. Le Deist F, Emile JF, Rieux-Laucat F, Benkerrou M, Roberts I, Brousse N, Fischer A: Clinical, immunological, and pathological consequences of Fas-deficient conditions. Lancet 348:719, 1996[Medline] [Order article via Infotrieve]
27.
Sneller MC, Wang J, Dale JK, Strober W, Middelton LA, Choi YN, Fleisher TA, Lim MS, Jaffe ES, Puck JM, Lenardo MJ, Straus SE:
Clinical, immunologic, and genetic features of an autoimmune lymphoproliferative syndrome associated with abnormal lymphocyte apoptosis.
Blood
89:1341, 1997 28. Infante AJ, Britton HA, DeNapoli T, Middelton LA, Lenardo MJ, Jackson CE, Wang J, Fleisher T, Straus SE, Puck JM: The clinical spectrum in a large kindred with autoimmune lymphoproliferative syndrome caused by a Fas mutation that impairs lymphocyte apoptosis. J Pediatr 133:629, 1998[Medline] [Order article via Infotrieve]
29.
Illum N, Ralfkiaer E, Pallesen G, Geisler C:
Phenotypical and functional characterization of double-negative (CD4
30.
Trauth B, Klas C, Peters A, Matzku S, Möller P, Falk W, Debatin K, Krammer P:
Monoclonal antibody-mediated tumor regression by induction of apoptosis.
Science
245:301, 1989 31. Nicoletti I, Migliorati G, Pagliaci MC, Grignani F, Riccardi C: A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry. J Immunol Methods 139:271, 1991[Medline] [Order article via Infotrieve] 32. Sambrook J, Fritsch EF, Maniatis T: A Laboratory Manual (ed 2). Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1989 33. Fiucci G, Ruberti G: Detection of polymorphisms within the Fas cDNA gene sequence by GC-clamp denaturing gradient gel electrophoresis. Immunogenetics 39:437, 1994[Medline] [Order article via Infotrieve] 34. Soudais C, de Villartay JP, Le Deist F, Fischer A, Lisowska-Grospierre B: Independent mutations of the human CD3-epsilon gene resulting in a T cell receptor/CD3 complex immunodeficiency. Nat Genet 3:77, 1993[Medline] [Order article via Infotrieve]
35.
Vidaud M, Gattoni R, Stevenin J, Vidaud D, Amselem S, Chibani J, Rosa J, Goossens M:
A 5' splice-region G 36. Cooper DN, Krawczak M: Human Gene Mutation. Oxford, UK, Biosscientific, 1993 37. Dhein J, Daniel PT, Trauth BC, Oehm A, Moller P, Krammer PH: Induction of apoptosis by monoclonal antibody anti-APO-1 class switch variants is dependent on cross-linking of APO-1 cell surface antigens. J Immunol 149:3166, 1992[Abstract] 38. Cascino I, Papoff G, De Maria R, Testi R, Ruberti G: Fas/Apo-1 (CD95) receptor lacking the intracytoplasmic signaling domain protects tumor cells from Fas-mediated apoptosis. J Immunol 156:13, 1996[Abstract] 39. Vaishnaw AK, Orlinick JR, Chu JL, Krammer PH, Chao MV, Elkon KB: The molecular basis for apoptotic defects in patients with CD95 (Fas/Apo-1) mutations. J Clin Invest 103:355, 1999[Medline] [Order article via Infotrieve] 40. Jackson CE, Fischer RE, Hsu AP, Anderson SM, Choi Y, Wang J, Dale JK, Fleisher TA, Middelton LA, Sneller MC, Lenardo MJ, Straus SE, Puck JM: Autoimmune lymphoproliferative syndrome with defective Fas: Genotype influences penetrance. Am J Hum Genet 64:1002, 1999[Medline] [Order article via Infotrieve] 41. Adachi M, Suematsu S, Kondo T, Ogasawara J, Tanaka T, Yoshida N, Nagata S: Targeted mutation in the Fas gene causes hyperplasia in peripheral lymphoid organs and liver. Nat Genet 11:294, 1995[Medline] [Order article via Infotrieve] 42. Cohen PL, Eisenberg RA: Lpr and gld: Single gene models of systemic autoimmunity and lymphoproliferative disease. Annu Rev Immunol 9:243, 1991[Medline] [Order article via Infotrieve] 43. Fuss IJ, Strober W, Dale JK, Fritz S, Pearlstein GR, Puck JM, Lenardo MJ, Straus SE: Characteristic T helper 2 T cell cytokine abnormalities in autoimmune lymphoproliferative syndrome, a syndrome marked by defective apoptosis and humoral autoimmunity. J Immunol 158:1912, 1997[Abstract] 44. Itoh N, Yonehara S, Ishii A, Yonehara M, Mizushima S, Sameshima M, Hase A, Seto Y, Nagata S: The polypeptide encoded by the cDNA for human cell surface antigen Fas can mediate apoptosis. Cell 66:233, 1991[Medline] [Order article via Infotrieve]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  A. Magerus-Chatinet, M.-C. Stolzenberg, M. S. Loffredo, B. Neven, C. Schaffner, N. Ducrot, P. D. Arkwright, B. Bader-Meunier, J. Barbot, S. Blanche, et al. FAS-L, IL-10, and double-negative CD4-CD8- TCR {alpha}/{beta}+ T cells are reliable markers of autoimmune lymphoproliferative syndrome (ALPS) associated with FAS loss of function Blood, March 26, 2009; 113(13): 3027 - 3030. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Bristeau-Leprince, V. Mateo, A. Lim, A. Magerus-Chatinet, E. Solary, A. Fischer, F. Rieux-Laucat, and M.-L. Gougeon Human TCR {alpha}/{beta}+ CD4-CD8- Double-Negative T Cells in Patients with Autoimmune Lymphoproliferative Syndrome Express Restricted V{beta} TCR Diversity and Are Clonally Related to CD8+ T Cells J. Immunol., July 1, 2008; 181(1): 440 - 448. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Mateo, M. Menager, G. de Saint-Basile, M.-C. Stolzenberg, B. Roquelaure, N. Andre, B. Florkin, F. le Deist, C. Picard, A. Fischer, et al. Perforin-dependent apoptosis functionally compensates Fas deficiency in activation-induced cell death of human T lymphocytes Blood, December 15, 2007; 110(13): 4285 - 4292. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Thomas, K. A. Risma, T. B. Graham, A. S. Brody, G. H. Deutsch, L. R. Young, and P. M. Joseph A Kindred of Children With Interstitial Lung Disease Chest, July 1, 2007; 132(1): 221 - 230. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Rieux-Laucat, C. Hivroz, A. Lim, V. Mateo, I. Pellier, F. Selz, A. Fischer, and F. Le Deist Inherited and somatic CD3zeta mutations in a patient with T-cell deficiency. N. Engl. J. Med., May 4, 2006; 354(18): 1913 - 1921. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Rieux-Laucat, F. Le Deist, G. De Saint Basile, R. Clementi, M. Ferrarini, and M. Bregni Autoimmune Lymphoproliferative Syndrome and Perforin N. Engl. J. Med., January 20, 2005; 352(3): 306 - 307. [Full Text] [PDF]
|
|
|
|
|
|
S. J. Curnow, D. Scheel-Toellner, W. Jenkinson, K. Raza, O. M. Durrani, J. M. Faint, S. Rauz, K. Wloka, D. Pilling, S. Rose-John, et al. Inhibition of T Cell Apoptosis in the Aqueous Humor of Patients with Uveitis by IL-6/Soluble IL-6 Receptor trans-Signaling J. Immunol., October 15, 2004; 173(8): 5290 - 5297. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Holzelova, C. Vonarbourg, M.-C. Stolzenberg, P. D. Arkwright, F. Selz, A.-M. Prieur, S. Blanche, J. Bartunkova, E. Vilmer, A. Fischer, et al. Autoimmune Lymphoproliferative Syndrome with Somatic Fas Mutations N. Engl. J. Med., September 30, 2004; 351(14): 1409 - 1418. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Wu, C. Metz, X. Xu, R. Abe, A. W. Gibson, J. C. Edberg, J. Cooke, F. Xie, G. S. Cooper, and R. P. Kimberly A Novel Polymorphic CAAT/Enhancer-Binding Protein {beta} Element in the FasL Gene Promoter Alters Fas Ligand Expression: A Candidate Background Gene in African American Systemic Lupus Erythematosus Patients J. Immunol., January 1, 2003; 170(1): 132 - 138. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Shen, A. C. T. Liang, L. Lu, W. Y. Au, Y.-L. Kwong, R. H. S. Liang, and G. Srivastava Frequent Deletion of Fas Gene Sequences Encoding Death and Transmembrane Domains in Nasal Natural Killer/T-Cell Lymphoma Am. J. Pathol., December 1, 2002; 161(6): 2123 - 2131. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Watanabe, K. Ikuta, S. Nisitani, T. Chiba, and T. Honjo Activation and Differentiation of Autoreactive B-1 Cells by Interleukin 10 Induce Autoimmune Hemolytic Anemia in Fas-deficient Antierythrocyte Immunoglobulin Transgenic Mice J. Exp. Med., July 1, 2002; 196(1): 141 - 146. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. D. Arkwright, M. Abinun, and A. J. Cant Autoimmunity in human primary immunodeficiency diseases Blood, April 15, 2002; 99(8): 2694 - 2702. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. J. H. Bleesing, M. R. Brown, S. E. Straus, J. K. Dale, R. M. Siegel, M. Johnson, M. J. Lenardo, J. M. Puck, and T. A. Fleisher Immunophenotypic profiles in families with autoimmune lymphoproliferative syndrome Blood, October 15, 2001; 98(8): 2466 - 2473. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. R. Mauro, R. Foa, R. Cerretti, D. Giannarelli, S. Coluzzi, F. Mandelli, and G. Girelli Autoimmune hemolytic anemia in chronic lymphocytic leukemia: clinical, therapeutic, and prognostic features Blood, May 1, 2000; 95(9): 2786 - 2792. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 1999 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
TOP
ABSTRACT
INTRODUCTION
(+) CD4(
) CD8(
/
,
deletion; Fs, frameshift; bp, basepair; SP, signal peptide; TM,
transmembrane domain; DD, death domain. Upper and lower numbers
delineate exon locations at nucleotide and amino acid residues,
respectively, according to Itoh et al.
A molecular and immunological analysis.
Blood
89:902, 1997