|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, Vol. 94 No. 8 (October 15), 1999:
pp. 2622-2636
By
From the Ludwig Institute for Cancer Research, Melbourne Tumour
Biology Branch, Royal Melbourne Hospital, Victoria, Australia; the
Howard Hughes Medical Institute, Children's Hospital, Boston, MA; the
Department of Genetics, Washington University Medical School, St Louis,
MO; and the Institute of Neurosciences, University of Oregon, Eugene,
OR.
Members of the JAK family of protein tyrosine kinase (PTK) proteins
are required for the transmission of signals from a variety of cell
surface receptors, particularly those of the cytokine receptor family.
JAK function has been implicated in hematopoiesis and regulation of the
immune system, and recent data suggest that the vertebrate JAK2
gene may play a role in leukemia. We have isolated and characterized
jak cDNAs from the zebrafish Danio rerio. The
zebrafish genome possesses 2 jak2 genes that occupy paralogous
chromosome segments in the zebrafish genome, and these segments
conserve syntenic relationships with orthologous genes in mammalian
genomes, suggesting an ancient duplication in the zebrafish lineage.
The jak2a gene is expressed at high levels in erythroid
precursors of primitive and definitive waves and at a lower level in
early central nervous system and developing fin buds. jak2b is
expressed in the developing lens and nephritic ducts, but not in
hematopoietic tissue. The expression of jak2a was examined in
hematopoietic mutants and found to be disrupted in cloche
and spadetail, suggesting an early role in hematopoiesis. Taken together with recent gene knockout data in the mouse, we suggest
that jak2a may be functionally equivalent to mammalian Jak2, with a role in early erythropoiesis.
CYTOKINES ARE IMPORTANT regulators of
proliferation, differentiation, and cell function for a wide range of
cells of hematopoietic and other lineages. The JAK/STAT signaling
system is required for the function of a number of cytokines, acting to
transduce signals from cytokine receptors.1,2
JAK tyrosine kinases possess a distinctive structure. Amino acid
sequence comparison of the 4 mammalian JAK family members (JAK1, JAK2,
JAK3, and TYK2) shows the presence of 7 highly conserved domains (named
JH1 through JH7).3 The N-terminal region of JAK kinases
contains structures (JH7-JH3) that confer specific binding activity
toward cytokine receptor cytoplasmic domains.4-9 Further
C-terminal, the kinase-related domain (JH2) exhibits significant similarity to a tyrosine kinase domain yet diverges within several critical catalytic motifs.10 Indeed, this domain appears
not to possess phosphotransferase activity10; rather, it is
required for the stability and binding affinity of associated
receptors.11,12 The C-terminal domain (JH1) contains a
protein tyrosine kinase10 responsible for initiating much
of the signaling activity from cytokine receptors that use this family
of PTKs. Expression of kinase inactive JAK variants abrogate most if
not all aspects of signaling in a dominant negative manner through
receptors for cytokines such as erythropoietin (EPO),13
growth hormone (GH),5 granulocyte-macrophage
colony-stimulating factor (GM-CSF),14 granulocyte
colony-stimulating factor (G-CSF),15 interleukin-6 (IL-6),16 interferon Three lines of evidence link JAK function directly to the regulation of
the growth and differentiation of hematopoietic cells in vivo. First,
gene targeting of Jak loci in the mouse yields hematopoietic
phenotypes: Jak1-deficient mice exhibit impaired lymphopoiesis,21 Jak2 deficiency abolishes
definitive erythropoiesis,22,23 and Jak3 null
mutation results in the murine equivalent of human severe combined
immunodeficiency syndrome (SCID).24-27 Second, the
dominant Drosophila melanogaster JAK mutant,
hopscotchTum-l causes a lethal leukemia in fruit
flies.28 The protein products of
hopTum-l and a recently identified allele
hopT42 show increased levels of autophosphorylation
and the capacity to activate Stat92E.29-31 Third,
constitutive JAK2 catalytic activity can be detected in some acute
lymphoblastic leukemia (ALL) cells in humans. Chromosomal translocation
in a human T-cell ALL creates a TEL-JAK2 fusion protein capable of
oligomerization through the TEL fusion partner, resulting in
constitutive activation of JAK2 tyrosine kinase activity.32
Mice expressing this fusion protein in bone marrow developed a fatal
mixed myeloproliferative and T-cell lymphoproliferative
disorder.33 These results indicate that JAK genes
are required for normal hematopoiesis and that the deregulation of JAK
catalytic activity is capable of causing hematopoietic neoplasia.
To further explore the role that the JAK family has in
controlling blood cell growth, we have isolated and characterized
JAK genes from the zebrafish, Danio rerio. The
zebrafish offers many technical advantages for the developmental
analysis of gene function, because embryos are plentiful, develop
externally, and are optically transparent. As a vertebrate experimental
system, the zebrafish allows strong analogies to be drawn to human
biology. For example, in contrast to Drosophila melanogaster
and Caenorhabditis elegans, zebrafish has
circulating blood cells of the erythroid, myeloid, and lymphoid
lineages.34,35 Furthermore, a recent mutant screen performed in the zebrafish led to the isolation of mutations in more
than 20 complementation groups that disrupt
hematopoiesis,36,37 including a model for human congenital
sideroblastic anemia, sauternes.38 Importantly, the
possibility of performing modifier screens in the zebrafish offers the
means of identifying other factors in these complex developmental
processes by a genetic approach.
Our search using degenerate oligonucleotide polymerase chain reaction
(PCR) for homologs of JAK and STAT genes in D
rerio yielded several genes from both JAK (jak1, jak2a,
and jak2b) and STAT (stat1 and
stat3) gene families. The characterization of zebrafish members of
the STAT family will be reported elsewhere.38a We
report here in detail on the structure and evolutionary relationships of the zebrafish JAK2 homologs. We determined the expression of these genes in wild-type and several selected zebrafish mutants and
consequently propose a role for jak2a in erythropoiesis.
Isolation of zebrafish jak homologs.
JAK-directed degenerate oligonucleotide primers were designed
after Wilks,39 based around conserved subdomains VIb and
IX40 in the catalytic JH1 domain of Homo
sapiens JAK1,10 Mus
musculus Jak2,3 H sapiens
JAK341 and TYK2,42 and D
melanogaster HOP.43 Wherever complete degeneracy was
required at a nucleotide position in the primers, an inosine residue
was incorporated.44 The sequence of the primers is
CCGAATTCCA(C/T)(C/A)GIGA(C/T)(C/T)TIGCIGCI(C/A)GIAA and
CCGAATTCIACICC(A/G)(A/T)AI(G/C)(A/T)CCAIAC(G/A)TC. cDNA libraries were
plated and screened at high stringency according to standard methods,45 with PCR products generated by
JAK-directed degenerate oligonucleotide PCR as described above,
and specific for the zebrafish jak1, jak2a, and
jak2b genes. Mixed developmental stage D rerio cDNA
libraries in Lambda Zap (Stratagene, La Jolla, CA), both random and poly-A primed, were a gift of J. Campos-Ortega (University of Köln, Köln, Germany). Lambda Zap cDNA
libraries generated from staged embryonic mRNA populations were made by
Bob Riggleman and Kathryn Helde and were a kind gift of D. Grunwald
(Eccles Institute, University of Utah, Salt Lake City,
UT). The "Contig Manager" application of the
DNAstar suite of programs (DNAstar Inc, Madison, WI) was used to create
and monitor contigs from the primary sequence data. cDNA
sequences presented herein corresponding to each of the gene
transcripts under study were sequenced in both directions to a minimum
of 2-fold coverage.
Zebrafish care and strains.
Zebrafish were raised and maintained as described.46
Zebrafish carrying the following mutant alleles of cloche
(clom39),47 spadetail
(sptb104),48 cabernet
(cabtl236), retsina
(rettr217), chianti
(ciatu25f), sauternes
(sauty121),38 chablis
(chatu245/tu242e) (thought to be clonal alleles),
weißherbst (wehth238,
wehtp85c), chardonnay
(cdyte216), frascati
(frstm130d, frstq223),
reisling (ristb237), and merlot
(mottm303c)36 were studied.
Sequence analysis and evolutionary comparison.
Electronic database searches were made by submitting nucleic acid
sequence and putative amino acid sequence to the public search facility
at the Baylor College of Medicine (Houston, TX; http://hgsc.bcm.tmc.edu/SearchLaunches/) using
"WU-BLAST."49 To study the evolutionary relationships
between the PTKs and JAKs identified, the deduced amino acid
sequences of the genes in question were aligned with the
"CLUSTAL" protein alignment program50 of the MegAlign
application (DNAstar suite) and refined by hand using structural
information, where available. These alignments were used to create
maximum parsimony phylogenetic trees and distance matrices using the
options of that program. The topology of the phylogenetic tree shown
was insensitive to the order of sequence addition.
Whole mount in situ hybridization.
Embryos were staged according to Kimmel et al.51 Embryos
raised to time points beyond 24 hours postfertilization (hpf) were transferred to E3 embryo medium with 0.003% phenylthiourea (PTU; Sigma, St Louis, MO) to prevent melanization. Riboprobe
synthesis and in situ hybridization were performed essentially as
described52 with the following modifications. Riboprobes
were purified before use over RNA sephadex G-50 columns (Boehringer
Mannheim, Indianapolis, IN). Using estimates of RNA
synthesis based on 32P-CTP incorporation, probes were
resuspended in HYB+ 52 at a concentration of 1 ng/mL for use. Embryos up to 24 hpf were not proteinase K-digested,
embryos between 24 hpf and 36 hpf were digested for 10 minutes (10 µg/mL), and embryos greater than 36 hpf were digested for between 20 and 30 minutes (20 µg/mL). Hybridization and washing was performed at
temperatures of 65°C to 70°C. Nonspecific antidigoxygenin
Fab-AP binding (Boehringer Mannheim; used at a dilution of 1/5,000) was
blocked by 2% wt/vol Blocking Reagent (Boehringer Mannheim)/10%
heat-inactivated sheep serum/MABT (100 mmol/L Maelic acid, 150 mmol/L
NaCl, 0.1% Tween-20, pH 7.5) for 1 hour at room temperature. Color
detection reactions used BM purple substrate (Boehringer Mannheim) and
were developed for up to 2 days before fixing in 4%
paraformaldehyde/PBT (phosphate-buffered saline/0.1%
Tween 20). Embryos were either cleared in glycerol or benzyl
benzoate:benzyl alcohol (2:1) and photographed using a Leitz Wild T
stereo dissection microscope (Leitz, Wetzlar, Germany) or a Nikon
Microphot AX compound microscope (Nikon Inc, Melville, NY). The entire jak2b cDNA was used to generate a digoxygenin (DIG)-labeled probe, and the jak2a riboprobe
contained the 5'-most 800 bp encoding the JH7 and JH6 domains.
Generation of DNA polymorphisms and genetic mapping.
A bacterial artificial chromosome (BAC) library (Genome Systems, St
Louis, MO) containing large insert zebrafish genomic DNA was screened
by hybridization to oligonucleotide probes derived from jak1,
jak2a, and jak2b cDNA. Clones corresponding to the genomic loci were obtained for jak1 (96 E18, 100 K4, and 143 O15) and jak2a (112 K6), but not jak2b. A P1 artificial
chromosome (PAC) library (C. Amemiya, Boston University, Boston,
MA) was screened by hybridization to an oligonucleotide
probe derived from jak2b and clones obtained (35 F6 and 58 G17). Sequence information from the ends of each of these genomic
clones was determined (data not shown) and, along with the sequence of
3' UTR regions from cDNA of the jak genes, was used to
design PCR primer pairs that amplified products from genomic DNA that
segregated in a C32xSJD mapping cross.53 The primers for
jak1 (100 T7-1 GTAGAAGATACAGTCGCCTG, 100 T7-2
GTAAAGCAATATCAATAGAG) give a codominant size polymorphism54 of 290/270 bp; the jak2a codominant size polymorphism (200/220 bp) is from the primer pair j2A.29 (GATCATCCACAGTTCAGCTCC), j2A.30 (TAATGATGAGAGAACACCCGC); jak2b was mapped with a codominant
sequence polymorphism55 in the PCR product generated by the
j2B.M1 (AAGAAAGTCTGTCCGCTGTCTTCACATGTC), j2B.M4
(CGCGCCAGCACTGCTAGCATAACAGAAACC) primer pair. Linkage was determined by
comparison of a given marker on a C32xSJD haploid panel consisting of
96 individuals that were genotyped against approximately 600 markers
for close correlation of segregation patterns53,56-59 using
the program "MapMaker"60 (Massachusetts Institute of
Technology, Cambridge, MA) and the program
"mapmanager"61 (Roswell Park Cancer
Institute, Buffalo, NY).
Assessment of linkage of jak2a to the cab and
mot mutations.
Homozygous diploid embryos were generated as described46
from a ABxDAR hybrid mother carrying a single mutant allele of cabtl236 and from a ABxDAR hybrid mother
heterozygous for mottm303c and scored for an
erythropoietic phenotype. These embryos were typed for the segregation
of the j2A.29/j2A.03 marker from the jak2a 3' UTR with
the mutant phenotype, based on a size polymorphism evident between the
AB and DAR strains.
Cloning of zebrafish jak2 genes.
To isolate JAK homologs in zebrafish, PCR was used to amplify
cDNA derived from mixed-stage embryonic mRNA with JAK-directed degenerate primer pairs, yielding 8 distinct PTK fragments
corresponding to members from 3 kinase subfamilies
(Fig 1a). Sequence comparison of the PCR
products to known JAK genes suggested that 2 of the PTKs were
closest in identity to mammalian JAK2; these were termed jak2a (HD-1) and jak2b (HD-71). A third, HD-9,
was most similar to mammalian JAK1 and was designated
jak1. This manuscript will focus on the 2 jak2 genes we
detected in the zebrafish. The embryonic expression of jak1
will be reported elsewhere (Oates and Wilks, manuscript in
preparation).
Structure of the zebrafish jak2 transcripts.
Examination of the conceptual translation of both zebrafish
jak2 genes showed a high degree of sequence conservation. The jak2a protein shows approximately 65% identity to the mammalian JAK2
proteins from mouse, human, rat, and pig. As shown in Fig 1b, by
comparison to human JAK2, all recognized structural elements found in
mammalian JAK2 proteins are present. This high degree of sequence
conservation indicated a strong likelihood of functional conservation.
Comparison of the predicted amino acid sequence of the majority of the
JH2 domain and the entire JH1 domain found in the jak2b cDNA
with other JAK kinases indicated that it, too, is most closely related
to mammalian JAK2 proteins.
Genetic mapping of the jak genes.
Knowledge of the genetic position of a gene is important in assessing
potential linkage to a particular mutation and the identification of
candidate genes from the collection of hematopoietic mutants. To
generate polymorphic markers for each of the jak genes for genetic mapping, genomic DNA or cDNA sequence was used to design PCR
primers for use in single-stranded conformational polymorphism (SSCP)
and simple sequence-length polymorphism (SSLP) assays.
Expression of jak2a in the developing zebrafish.
Analysis of the developmental expression pattern of jak2a
indicates that it may play a role in hematopoiesis. jak2a
transcripts were first detected at a low level throughout the embryo at
10 hpf (Fig
3a), persisting until 14 hpf. During this period, the intensity of
signal increased in the anterior part of the axis, eventually being
strongest in the eyes. By 14 hpf (Fig 3b and c), cells of the medial
lateral plate mesoderm expressed jak2a in a pattern consistent
with the sites of earliest hematopoietic activity.65 Cells
in this region have earlier expressed scl66 and
gata1 and gata2 at 11 hpf.67 Costaining of
jak2a with gata1 at 14 hpf and thereafter showed that
both genes were expressed in identical regions of the lateral plate
mesoderm (data not shown). This suggests that the first cells of the
primitive wave of erythropoiesis express jak2a and that this
expression is a later event in the commitment to this lineage than
gata1 expression. Cells in this region maintained jak2a
expression as they moved from a lateral position to the midline
and differentiated in the intermediate cell mass (ICM; Fig 3d),
consistent with jak2a expression in proliferating proerythroblasts. By 24 hpf, high level staining was restricted to
cells of the anterior ICM, although a low level of expression was
detected in the brain and eyes (Fig 3e). The distribution of
jak2a transcript at this stage differs from the hematopoietic expression of the vascular and stem cell marker scl in 2 important respects. As shown in Fig 3f, with white arrowheads, cells in a set of bilateral stripes located more rostrally than the ICM are
scl-positive and thought to be persistent hematopoietic
progenitor cells66; however, these cells did not express
jak2a. Furthermore, although both scl and jak2a
transcripts were detected at high levels in the anterior ICM, only
scl expression is detected in the posterior ICM (solid
arrowhead, Fig 3f). In both of these aspects, the expression of
jak2a resembles that of gata1.67 Because
scl is expressed in both vascular and hematopoietic
precursors,66 we wished to establish unambiguously the
identity of the cells that expressed jak2a message. Sectioning
of embryos immediately postcirculation showed that jak2a
expression was confined to cells contained within the vasculature with
a large, rounded morphology (Fig
4). These cells also express gata1 and hemoglobin (data not shown, see Detrich et al67) and the embryonic
globin genes (see Fig 6, below), consistent with an
erythroblast identity.
Expression of jak2b in the developing zebrafish.
Northern blot analysis using total RNA indicated that jak2b was
expressed at a very low level during embryogenesis (data not shown).
Whole mount in situ hybridization demonstrated that expression at 24 hpf was restricted to the lens and the nephritic duct (Fig 5a and b),
persisting until 48 hpf (Fig 5c). The rostral extent of staining of
jak2b in the nephritic duct (Fig 5b) is equivalent to that seen
at 24 hpf with a probe to the ret gene.70 Low-level expression of jak2b was seen in the fin buds in embryos at 2.5 dpf, coincident with jak2a expression, but by 3.5 dpf, no
jak2b transcript was detectable by this method (data not
shown). At 5 dpf, low-level jak2b expression was seen in the
gill arches, elements of the jaw, and the anterior and posterior
lateral line, persisting until 8 dpf (Fig 5d). Thus, based on
thedistribution of transcript, jak2b might play a role in
signaling during embryonic lens and nephritic duct development and in
signaling in the larval lateral line and gills, but not in the
development of the hematopoietic system.
Analysis of jak2a expression in the zebrafish hematopoietic
mutants.
Mutations that disrupt hematopoiesis have been identified in
zebrafish.36,37,47,67 The majority of these mutations were discovered by screening for the presence and color of circulating erythroblasts; hence, the majority represents genes required in erythropoiesis. Because the screens were performed at developmental stages up to 5 dpf, it seems likely that the target of the screen was
erythroblasts of the primitive cohort.37 Examination of mutant phenotypes allows mutant genes to be categorized into a scheme
of erythroblast development as outlined by Orkin and Zon.71 Embryos from selected mutant lines were examined for perturbation of
jak2a expression by in situ hybridization at various time
points before and/or after the onset of a visible phenotype. A summary of the results of this investigation is presented in
Table 1, and the results are described
below in detail.
Expression of jak2a in a Hemangioblast mutant,
cloche.
Homozygous cloche (clo) animals fail to produce blood
or vasculature and die as embryos.47,66,72,73 Consistent
with a general failure in clo mutants to produce cells of the
hematopoietic lineage, jak2a expression in the hematopoietic
lateral plate mesoderm was not initiated at 13 hpf in approximately one
quarter of the embryos from a given clutch and neither was it detected
in hematopoietic tissue at any stage examined thereafter (Table 1),
although jak2a central nervous system (CNS) expression appears
normal. The expression of jak2a in the clo mutant
background was compared with the expression of other lineage and stage
specific markers at 24 hpf (Fig 6). Clutches of embryos from
heterozygous incrosses were examined before the onset of circulation by
in situ hybridization for expression of the stem cell marker
scl,66 the immature erythroblast marker gata1,67 jak2a, and the embryonic
Expression of jak2a in an early onset hematopoietic
mutant, spadetail.
In contrast to clo, embryos homozygous for the
spadetail (spt) mutation specify and differentiate
vasculature correctly.73 However, the hematopoietic program
is severely affected, with few, if any primitive erythroblasts reaching
maturity. Clutches of embryos from spt heterozygous parents
were examined for jak2a expression throughout the first 24 hours of development (Fig 7). Despite the
expression of the stem cell marker scl in spt mutants in the lateral plate mesoderm at 14 somites (Fig 7d), and in contrast to wild-type embryos at this stage (Fig 7a), jak2a transcripts could not be detected in the spt homozygotes in regions of
hematopoietic activity (Fig 7c). As spt homozygotes developed,
scl expression in the lateral plate decreased dramatically,
indicating a failure to maintain a population of early stem cells (Fig
7h). Occasionally in spt homozygotes, isolated scl,
gata1, and embryonic globin-positive cells were visible
in the ICM, as shown by arrowheads in Fig 7h (and data not shown, see
Thompson et al73), indicating the emergence of a more
mature primitive erythroid cell. However, jak2a message does
not accumulate in the corresponding locations or in any hematopoietic tissue at the stages examined (Fig 7g). Combined with the data from
clo mutants, this result indicates that, within the boundaries of the sensitivity of the technique, the expression of erythroid markers in the escaper cells of the caudal part of the anterior ICM is
not accompanied by jak2a expression.
Expression of jak2a in late onset hematopoietic mutant
zebrafish.
Expression of jak2a was examined by in situ hybridization in
zebrafish embryos carrying mutations in the frascati
(frs), chablis (cha), retsina
(ret), weißherbst (weh), cabernet
(cab), sauternes (sau), chardonnay
(cdy), and chianti (cia) genes, which display a
late phenotypic onset.36 In all mutants examined,
jak2a expression was found in the cells of the ICM at 24 hpf
and in circulating erythroblasts until 48 hpf, as seen in wild-type
clutches (Table 1). In summary, jak2a expression is perturbed
only in those mutants (clo, spt) that perturb
erythropoiesis at early stages in development, supporting the
hypothesis that jak2a is expressed in immature primitive
erythroblasts in the zebrafish.
Linkage of the jak2a gene to the hematopoietic mutants.
As described above, jak2a was mapped to the distal tip of LG21
(Fig 2b and e). Comparison of the map position of jak2a with those of the mutants with known positions on the zebrafish genetic map
showed that jak2a was not linked to cha, cdy,
chi, clo, frs, gre, mon,
pin, ris, ret, sau, spt, or
weh (data not shown).Thus, jak2a is not a candidate
gene for any of these mutations. Linkage to additional, currently
unmapped hematopoietic mutants cab and mot was tested
by typing genomic DNA from mutant embryos with the
jak2a-associated marker used to map the jak2a gene, as
described above. The jak2a polymorphism did not segregate with
either the cabtl236 or
mottm303c phenotype (data not shown), indicating
that jak2a is not linked to these mutations.
Recent studies in Drosophila and mouse have shown a role for
members of the JAK gene family in the control of growth and
differentiation of multiple blood cell lineages and in leukemogenesis.
The Jak2 gene is required in mice for successful erythropoiesis
and JAK2 is implicated in ALL in human patients. We show here
that the zebrafish has 2 jak2 genes that are expressed in the
developing embryo and larva; however, only 1, jak2a, is
expressed in the erythropoietic system. Our results in wild-type and
mutant embryos suggest that jak2a may play an early role in
primitive erythropoiesis in the zebrafish and, thus, is likely to
represent the functional homolog of the mouse Jak2 gene with
respect to hematopoiesis.
Hematological implications of zebrafish jak2a expression.
The timing of jak2a expression in wild-type embryos suggests
that the presence of jak2a message defines an intermediate
stage in the lineage of the primitive erythrocyte that occurs between the commitment of progenitors and the expression of the
end-differentiated phenotype. Furthermore, the transience of
jak2a expression indicates that any signaling into primitive
erythroblasts via receptors that use jak2a occurs in a window of time
as the erythroblasts mature from 14 hpf to approximately 2 dpf.
Expression of jak2a in the developing erythrocytes of wild-type
and mutant zebrafish has strong implications for the involvement of
jak2a in cytokine signaling in hematopoiesis.
Evolutionary relationships among the jak genes.
The presence of 4 JAK genes per mammalian genome fits well with
current theories about tetraploidization events early in the vertebrate
lineage that suggest 2 successive duplications giving rise to 4 copies
of an ancestral chromosome complement.77 Genes of the
JAK family in zebrafish map to separate chromosomes, indicating that tandem duplication is not the cause of the extra jak2
genes in the zebrafish. Instead, they map to regions in which syntenies are conserved compared with their homologs in mouse and human, a region
known as the Katsanis paralogy group.78 This finding extends the observation that large portions of the chromosomes of early
vertebrates remain intact, with disturbance mainly from local
rearrangement,59,79 and indicates that the cause of the initial JAK2 duplication seems to have been a large-scale
event, possibly involving 1 or more chromosomes (Fig 2g and h). If the paralogous duplication took place before the lineage of ray fin and
lobe fin fish (ie, tetrapods) diverged, there must have existed a
second JAK2 paralog in the genome of both lineages. In this case, there may still be a second JAK2 in existing tetrapod
genomes. However, examination of mammalian JAK2 cDNA sequences
and ESTs in the databases indicates that all JAK2 proteins from
different mammals reported are more than 95% identical to each other
and that all cDNAs or ESTs from any given species are, in fact, from the same gene (data not shown). Consideration of JAK1,
JAK3, and TYK2 database entries in the same manner
indicates that all listed sequences, ignoring splice variants, are
orthologous or identical. In conclusion, mounting evidence of the
existence of higher numbers of gene family members in zebrafish and
other ray finned fish than in mammalian genomes80,81
combined with the chromosomal localization data presented above favors
the scenario in which duplicate jak2 genes are an innovation
specific to ray finned fish.
Comparison and implications of jak2 expression patterns in
the zeb |
TOP
ABSTRACT
INTRODUCTION
(IFN
,
cDNA is marked by an arrow at the site of predicted translational
termination due to alternate splicing.
/
e1 globin, and 