|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 9 (November 1), 1999:
pp. 2945-2954
Increased Sensitivity to Complement and a Decreased Red Blood Cell Life
Span in Mice Mosaic for a Nonfunctional Piga Gene
By
G. Tremml,
C. Dominguez,
V. Rosti,
Z. Zhang,
P.P. Pandolfi,
P. Keller, and
M. Bessler
From the Department of Human Genetics, Memorial Sloan-Kettering
Cancer Center, New York, NY; and the Division of
Hematology, Department of Medicine, Washington University School
of Medicine, St Louis, MO.
 |
ABSTRACT |
The gene PIGA encodes one of the protein subunits of the
 1-6-N acetylglucosaminyltransferase complex, which catalyses an early step in the biosynthesis of glycosyl phosphatidylinositol (GPI)
anchors. PIGA is somatically mutated in blood cells from patients with paroxysmal nocturnal hemoglobinuria (PNH), leading to
deficiency of GPI-linked proteins on the cell surface. To investigate in detail how inactivating mutations of the PIGA gene affect
hematopoiesis, we generated a mouse line, in which
loxP-mediated excision of part of exon 2 occurs on the
expression of Cre. After crossbreeding with EIIa-cre transgenic
mice, recombination occurs early in embryonic life. Mice that are
mosaics for the recombined Piga gene are viable and lack
GPI-linked proteins on a proportion of circulating blood cells. This
resembles the coexistence of normal cells and PNH cells in patients
with an established PNH clone. PIGA( ) blood cells in mosaic mice
have biologic features characteristic of those classically seen in
patients with PNH, including an increased sensitivity toward complement
mediated lysis and a decreased life span in circulation. However,
during the 12-month follow-up, the PIGA() cell population did not
increase, clearly showing that a Piga gene mutation is not
sufficient to cause the human disease, PNH.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
IN PATIENTS WITH paroxysmal nocturnal
hemoglobinuria (PNH), an acquired hemolytic anemia, the X-linked
PIGA gene is mutated in a proportion of blood cells, leading to
partial or complete absence of glycosyl phosphatidylinositol
(GPI)-linked proteins on the cell surface of the affected
cells.1-3 The PIGA gene encodes a protein subunit
of the  1-6-N acetylglucosaminyltransferase complex, an enzyme
essential in the biosynthesis of GPI anchor molecules.4 As
a result, PNH red cells have an increased sensitivity to complement
mediated lysis,5 because 2 of the complement inhibitors,
normally GPI-linked, are missing on their cell surface.6,7 As multiple blood lineages may be affected, the somatic mutation in the
PIGA gene must occur in a multipotent hematopoietic progenitor cell.8,9 Although PIGA mutations account for the
cellular phenotype, it is not clear why and how cells deficient in
GPI-linked proteins can expand and contribute substantially to
hematopoiesis in patients. PNH is often associated with aplastic
anemia.10 This observation has led to the hypothesis that
hematopoietic progenitor cells deficient in GPI-anchored proteins might
have a selective growth advantage in a bone marrow environment in which normal hematopoiesis is impaired.11,12
Complete absence of GPI-linked proteins is not compatible with
life.13,14 This limits the possibility of studying the
biologic consequences of GPI-anchor deficiency in hematopoiesis by
conventional knockout technology. Here we describe the generation of a
mouse suitable for spatially and temporally controlled inactivation of
the Piga gene by flanking the largest coding exon of
Piga with 2 loxP sites (in the following
"PIGA" refers to the human gene, "Piga" to
the murine gene, and "PIGA" to either gene
product15). Cre mediated inactivation of Piga was
obtained by crossbreeding these mice with mice transgenic for the
cre recombinase under the control of the adenoviral EIIa
promoter (EIIa-cre16). Because the EIIa promoter is
only active early in embryonic development we are able to obtain viable
offspring that are mosaic for a nonfunctional Piga gene. The
ease of crossbreeding provides us with an unlimited number of animals
and thus circumvents the limitations associated with chimeras obtained
by blastocyst injection of PIGA() murine embryonic stem (ES)
cells.13,14 In mosaic animals, we observe a proportion of
blood cells lacking GPI-linked proteins [also referred to as
PIGA() or PNH phenotype]. The coexistence of normal blood cells
and blood cells that lack GPI-linked proteins mimics the findings in
patients with PNH. In mosaic mice, no further Piga inactivation
occurs after birth.17 This enabled us to study the fate of
blood cells deficient in GPI-linked proteins during the lifetime of a
mouse and compare it with hematopoiesis in PNH patients.
| |
MATERIALS AND METHODS |
Targeting construct lox-Piga-LTNL-lacZ.
In a 9.7-kb genomic XhoI/NotI subclone of Piga,
the EcoRI site in intron 1 was destroyed. Then a 7.2-kb
SalI/BamHI Piga fragment was subcloned into
Bluescript (Stratagene, La Jolla, CA). The following oligonucleotide
containing the loxP sequence was inserted into the unique
SmaI site of exon 2: 5'
CATAACTTCGTATAATGTATGCTATACGAAGTTATC 3'. This destroyed the
SmaI site. To lengthen the homologous sequences 5' to the
lox-Piga-LTNL-lacZ targeting vector, a 2.5-kb
XhoI (filled)/BamHI genomic Piga fragment was
cloned into the targeting construct cut with BamHI/XbaI (filled).
For the LTNL lacZ fusion, first the ApaI/ClaI
and ClaI/BamHI region of pnLacF (obtained from Andreas
Kottman, Columbia University, New York, NY) was subcloned into the KS
Bluescript vector cut with ApaI/BamHI. Then an Asp718
(filled)/XbaI (filled) fragment was ligated to the LTNL
selectable marker cassette (loxP, thymidine
kinase gene, neomycin resistance gene, 3'
loxP site)18 cut with PacI and
recessed. Finally, the XbaI (filled) fragment containing the
LTNL lacZ fusion was cloned into the unique EcoRI
(filled) site of the lox-Piga-LTNL-lacZ targeting vector.
Homologous recombination and Cre recombination in ES cells.
The 129 SV CJ7 ES cell line19 was transfected with the
SalI linearized targeting construct
lox-Piga-LTNL-lacZ as described.14 In
total, 239 ES cell clones were picked and analyzed for homologous recombination by Southern blot hybridization.20 DNA Probe
6, located in exon 6, was used as an external probe14 and
DNA probe 1 and probe 2 were used as 2 internal probes. Probe 1 was
generated by subcloning a HindIII/SacII fragment
located upstream of exon 1 into the Bluescript vector. Probe 2 was
generated by subcloning a 400-bp polymerase chain reaction (PCR)
product of exon 2 with the forward primer 5' GTACATATTTGTTCGGGA
3' and the reverse primer 5' CTTTTCTGTAAACAAGTCTG 3'
into the pGem vector. Southern blot analysis was done by digesting
genomic DNA with EcoRI to screen for the loss of the
EcoRI site in intron 1. Then the ES cells were screened for the
presence of the 5' loxP sequence at the SmaI site
by PCR: forward primer (SacII) 5'
GCCGCGGACCACCTCAGCATGGCCAA 3', reverse primer (I2) 5'
AAAGCCACCATACAGAATGA 3'. The PCR products were digested with
SmaI. A 700-bp restriction fragment identified the wild-type
Piga gene, whereas the lox-Piga-lacZ gene was
identified by an 836-bp fragment. In 39 ES clones, (16%) homologous
recombination at the Piga locus had occurred. However, 17 (44%) of the recombined ES clones did not contain the 5'
loxP site. Clone 1G2 was electroporated as a single-cell
suspension of 5 × 106 cells at 240 mV, 500 µF with
30 µg supercoiled pMC-Cre plasmid.21 After 72 hours, the
cells were selected with 1 µmol/L Gancyclovir (Cytovene, Syntex, Palo
Alto, CA) for 10 days. Clones were analyzed for excision of the LTNL
selectable marker cassette by Southern blot and by PCR analysis with
the above described primer pair. In 2 of 751 ES clones, 1G2/87 and 1D4,
the LTNL marker cassette was excised. In 17 clones, both exon 2 and the
LTNL marker cassette had been excised, and 732 ES clones were of
wild-type origin. Targeted ES cells with Cre recombination that
preserves only the LTNL cassette were not detected because of selection
against the presence of the Herpes simplex virus (HSV)
thymidine kinase.
Generation of the lox-Piga-lacZ mice.
Clones 1G2/87 and 1D4 showed a normal karyotype of 40 XY22
and were injected into C57BL/6J blastocysts. Of 10 chimeric animals (3 females and 7 males), 4 male chimeras, all generated with clone 1G2/87,
transmitted the targeted Piga gene to their progeny
(lox-Piga-lacZ mice). Heterozygous lox-Piga-lacZ
females were bred to C57BL/6 males to produce hemizygous
lox-Piga-lacZ males in the N2 generation.
FVB/NJ mice homozygous for the EIIa-cre transgene
(EIIa-cre [+/+] mice) were generously provided by
Heiner Westphal (NIH, Bethesda, MD).16
Lox-Piga-lacZ (L) mice were crossbred with EIIa-cre (+/+) (E) mice as indicated. The
lox-Piga-lacZ/EIIa-cre offspring analyzed were of mixed genetic
background. (In this article, the different breedings are abbreviated
by 2 letters, EL and LE. The first letter represents the origin of the
mother and the second the origin of the father.)
Flow cytometric analysis (FCA).
FCA on fetal and adult peripheral blood cells was performed as
described previously.14 The following fluorochrome
conjugated antibodies toward GPI-linked surface antigens were used:
CD24 (Heat Stable Antigen, HSA) for red blood cells (RBCs); Gr-1 for granulocytes; and CD48 for lymphocytes. Lineage specificity was determined by using fluorescein isothiocyanate or phycoerythrin (PE)-conjugated anti-B220 antibodies for B lymphocytes, anti-TCR for T lymphocytes, and anti-CD11b for granulocytes. All the antibodies were purchased from Pharmingen (San Diego, CA). One to 2 µL of blood
was used for the immunostaining of RBCs and 25 µL was used for the
staining of white blood cells.
Blood cell counts.
Blood samples were obtained by puncture of the retroorbital plexus of
anesthetized mice by using heparinized capillary tubes. RBC count,
white blood cell count, hemoglobin, mean RBC volume, hematocrit, and
platelet count were determined with an automated blood cell counter,
Hemavet 850 (CDC Technology, Oxford, CT). Differential white blood cell
counts were performed on May-Grünwald-Giemsa-stained blood
films.23
Reticulocyte counts.
The fluorescence dye thiazole orange (Retic-COUNT, Becton Dickinson,
San Jose, CA) was used to detect reticulocytes in
conjunction with PE-conjugated CD24 to distinguish PIGA(+) from
PIGA() RBCs.24 The half-life of PIGA() red
cells was calculated for individual mice in steady state
(t1/2PIGA(+) = 15 days25):
Sensitivity toward complement mediated lysis.
We studied the sensitivity of PIGA(+) and PIGA() RBCs toward
complement mediated lysis. Many inbred laboratory mouse strains are deficient in C5.26 According to information obtained
from the Jackson Laboratory (Bar Harbor, ME), C57BL/6 and
129SV have a normal level of C5, whereas FVB/N are C5 deficient.
Lox-Piga-LacZ mice were a mixture of 129SV and C57BL/6, whereas the
EIIa-cre animals had the FVB/N genetic background. Mosaic offspring are therefore heterozygous for C5 deficiency and are expected to have a C5
level of 50% from normal. C5 is not a limiting factor in complement
activation. In vivo whole complement activity in our mosaic mice and
most biologic tests for complement activity in vitro are expected to be
indistinguishable from mice with 100% of C5 levels. Mouse serum is
known to have a low lytic activity in vitro.27 We used, as
have previously others, rat or human serum as a source of
complement.27,28 Aliquots were stored in liquid nitrogen
and thawed only once before use. Possible natural antibodies were
removed by RBC absorption. Absorption was performed on ice for 15 minutes with 100 µL of packed washed RBCs in 1,500 µL of serum.
Absorption was repeated 4 times. Half of the absorbed serum was heat
inactivated for 60 minutes at 56°C (heat-inactivated serum [HS]). To activate complement serum was acidified to a pH of
6.9 by adding HCl to a final concentration of 20 mmol/L. Washed blood
red cells (10 µL) from mosaic mice or an age matched control mouse
were incubated with dilutions of fresh or heat inactivated serum in 154 mmol/L NaCl in a final volume of 122 µL. MgCl2 was added
to a final concentration of 4.18 mmol/L. Lysis of PIGA() RBCs
was measured by flow cytometry after 60 and 120 minutes of incubation.
The hemoglobin content was determined by measuring absorbance at 412 nm. Lysis (100%) corresponded to the release of hemoglobin after
hypotonic lysis of an equal volume of RBCs.
DNA preparation and amplification.
ES cells were lysed overnight at 55oC in 100 mmol/L
Tris-HCl pH 8.5, 5 mmol/L ethylenediamine tetraacetate, 0.2% sodium
dodecyl sulfate, 200 mmol/L NaCl, 100 µg/mL proteinase K. DNA was
precipitated in equal volume isopropanol and analyzed by Southern blot
and PCR analysis. Genomic DNA from mouse tails was obtained as
described by Laird et al.29
Genotype analysis was done by PCR analysis from tail DNA: Wild-type
Piga and lox-Piga-lacZ were amplified with the forward primer "13 + 8" 5' GGACCACCTCAGCATGGCCAA 3'
and the reverse primer "Piga 600 rev" 5'
TATTTCAGGATTCAGTGCTGC 3'. The SmaI restriction site in
exon 2 was destroyed by the introduction of the 5' loxP site. Digestion of the amplification product with SmaI,
therefore, yielded a 551-kb fragment for the wild-type
(wt) gene and a 655-kb fragment for lox-Piga-lacZ.
Lox- Piga-lacZ was amplified with the forward primer
"13 + 8" and the reverse primer "lacZ 500 rev"
5' CGACAGTATCGGCCTCAGGAAGA 3', yielding a 382-bp fragment.
Reverse transcription (RT)-PCR analysis.
Total RNA was isolated with RNAzol B (Biotecx Laboratories, Houston,
TX) and treated with RNase free DNase. RNA (1 µg) was subjected to
cDNA synthesis by using the Superscript II system (GIBCO-BRL,
Gaithersburg, MD) followed by PCR amplification. The primer pairs for
the Cre expression cre1 (forward): 5'
TAAAATGTCCAATTTACTGACCGTACACAA 3' and cre2 (reverse): 5'
CTGGCAATTTCGGCTATACGTAACAGGGTG 3' amplifies a band of 520 bp. In
simultaneous PCR experiments, the primer pair SacII/293
(SacII: see above; Primer 293: 5' GGGTGACAGTTATGACCTTGTG 3'), which amplifies a 268-bp fragment of the Piga cDNA,
was used to control the integrity of the isolated RNA followed by cDNA synthesis.
| |
RESULTS |
Generation of the lox-Piga-lacZ mouse line.
To enable Cre-mediated recombination to take place at the Piga
locus, we introduced 3 loxP sites
(Fig 1A). In the replacement vector
lox-Piga-LTNL-lacZ, a 5' loxP sequence
was inserted into exon 2, downstream of the first AUG. This insertion
extends the Piga open reading frame by 12 amino acids and does
not interfere with PIGA function in vivo (see below). Two
additional loxP sequences were introduced, flanking a
positive/negative LTNL selection cassette. Downstream of the selection
cassette we placed the coding region of the lacZ gene with a
nuclear localization signal but without the translation initiating ATG.
Cre mediated recombination of the 5' and the 3'
loxP sites will generate a fusion gene between Piga and
lacZ. This recombination will excise a large portion of
Piga exon 2 resulting in complete loss of PIGA
function.14
View larger version (26K):
[in this window]
[in a new window]
| Fig 1.
Generation of lox-Piga-lacZ ES cells. (A)
Top panel shows the genomic structure of the mouse Piga gene.
The internal probes used for Southern blot analysis map to exon 1 (probe 1) and to exon 2 (probe 2), and the external probe maps to exon
6 (probe 6). Middle panel displays the targeting construct
(lox-Piga-LTNL-lacZ.). Bottom panel shows the
Piga gene after homologous recombination
(lox-LTNL-Piga-lacZ). Shaded boxes
represent exon 1-6, arrowheads represent loxP sites, hatched
line represents the selectable marker cassette and the bold black line
represents the lacZ gene. LTNL = loxP
thymidine kinase, neomycin resistance gene
loxP. Restriction enzyme sites S=SmaI,
B=BamHI, E=EcoRI. (B) Southern blot of homologous
recombined ES clone 1G2. Lanes 1, 3, and 5 represent DNA from wild-type
ES cells and lanes 2, 4, and 6 represent DNA from recombined ES clone
1G2. Lanes 1 and 2 were digested with BamHI and hybridized with
probe 6. DNA in lanes 3 and 4 was digested with EcoRI and
hybridized with probe 1. DNA in lanes 5 and 6 was digested with
BamHI and hybridized with probe 1. Because Piga maps to
the X chromosome and the ES cells are of male origin, no other allele
remains. (C) Top panel shows the
lox-LTNL-Piga-lacZ gene. Bottom panel shows the
lox-Piga-lacZ gene after Cre-mediated excision of the
selectable marker cassette LTNL. Dashed line represents the desired
Cre-mediated excision. (D) Southern blot of the desired Cre-mediated
recombination. Lanes 1 and 4 represent DNA from wild-type ES cells,
lanes 2 and 5 represent DNA from recombined ES clone 1G2, and lanes 3 and 6 represent DNA from Cre recombined ES clone 1G2/87. DNA in lanes
1-3 was hybridized with probe 6; DNA in lanes 4-6 was hybridized with
probe 2; DNA in lanes 1-6 was digested with BamHI.
|
|
We next proceeded to generate lox-Piga-lacZ ES cells
according to the 2-step technique described by Gu et al30
in 1994. In a first step, the replacement vector
lox-Piga-LTNL-lacZ was introduced into the Piga
locus by homologous recombination (Fig 1A and B). In a second step, the
selection cassette was removed by transient expression of the Cre
recombinase in targeted ES cells (Fig 1C and D).
For the generation of chimeras, 2 ES cell clones were injected into
blastocysts. Germ line transmission was obtained from clone 1G2/87. In
mice as in humans Piga maps to the X
chromosome,31,32 therefore lox-Piga-lacZ shows an
X-linked transmission pattern. No hematological or developmental
abnormalities were seen in homozygous females and in hemizygous males
(data not shown), confirming that the introduction of the loxP
sites and of the lacZ gene does not interfere with the normal
function of the Piga gene in vivo.
Generation of mosaic mice.
Cre mediated recombination was obtained by crossbreeding the
lox-Piga-lacZ mice with transgenic mice that express Cre under the adenoviral EIIa promoter. Figure 2
summarizes the factors that influence the extent of mosaicism in the
offspring of the 2 possible breeding pair. In the absence of its
natural transactivating coactivator E1A, the promoter of the adenovirus
EIIa gene is thought to be active only in oocytes and in
preimplantation embryos.17 In the offspring of the
EIIa-cre x lox-Piga-lacZ intercross, we, therefore,
expect that recombination of the lox-Piga-lacZ gene will only take place early in embryogenesis, just after fertilization, and will cease after implantation around day E4.5. The possibility that
Cre is expressed in bone marrow cells seems unlikely, because we failed
to detect Cre transcripts by RT-PCR analysis of bone marrow RNA from
EIIa-cre (+/+) transgenic mice (see
Fig 3).
View larger version (33K):
[in this window]
[in a new window]
| Fig 2.
Choice of the parent husbandry and sex of the offspring
influence the extent of blood mosaicism [proportion of PIGA()
cells] in lox-Piga-lacZ x EIIa-cre offspring: The
lox-Piga-lacZ gene follows an X-linked inheritance pattern.
Male offspring of the EL breeding therefore do not inherit a
lox-Piga-lacZ gene and therefore do not undergo Piga
gene recombination. The expression of Cre determines the time span
during which Piga gene recombination may occur. If maternally
derived, EIIa promoter activity starts already in the oocyte and ceases
around day E4.5. In contrast, if paternally derived, Cre expression
starts at the time when male gene expression is initiated which is
around E2.5. The contribution of PIGA() cells to hematopoiesis
depends on the contribution of PIGA() cells to the stem cell pool.
Male PIGA() cells are subject to early negative
selection.43 In female cells however, the PIGA()
phenotype is only expressed after the wild-type Piga gene has
been inactivated by X chromosome inactivation. Selection against
PIGA() cells starts therefore later in ontogenesis. This explains
the higher contribution of PIGA() hematopoietic cells found in
female mice compared to male mice from the same breeding and compared
to the PIGA() cell contribution previously reported in chimeric mice
obtained after injection of PIGA() XY ES cells.13,14 For
the LE breeding only the offspring carrying a lox-Piga-lacZ
gene are illustrated. The genotype is shown in italics, p
indicates paternally derived, m maternally derived genes.
|
|
View larger version (20K):
[in this window]
[in a new window]
| Fig 3.
Expression of Cre in EIIa-cre transgenic mice by
RT-PCR. Lanes 1-6, cDNA amplified with control primer pair
SacII/293. Lanes 7-12, cDNA amplified with primer pair
cre1/cre2. Lanes 2, 4, 6, 8, 10, 12 amplified in the presence of RT.
Lanes 1, 3, 5, 7, 9, 11 controls amplified without RT. Lanes 1, 2, 7, 8 RNA isolated from leg muscle. Lanes 3, 4, 9, 10 RNA isolated from
ovaries. Lanes 5, 6, 11, 12 RNA isolated from bone marrow. Lane 13 molecular marker. Note that primer pair cre1/cre2 amplifies a band of
520 bp and control primer pair SacII/293 amplifies a band of 268 bp.
|
|
Male mice hemizygous for lox-Piga-lacZ(+), or heterozygous
lox-Piga-lacZ(+/) females, were crossbred with
homozygous EIIa-cre(+/+) mice. Of 185 newborn mice, 67 carried
a lox-Piga-lacZ and an EIIa-cre gene. Fifty-five
animals had more than 2% CD24() erythrocytes. The number of
PIGA() blood cells in newborn mice was dependent on the breeding
and on the sex of the offspring (see Fig 2). Female offspring of the LE
breeding (LE; see Fig 2) had a higher contribution of PIGA()
RBCs at birth (median 8.5%) than male offspring from the same breeding
(median 3.5). The highest contribution of PIGA() cells (up to
53%) was observed in offspring with a paternally derived
lox-Piga-lacZ gene and a maternally derived EIIa-cre
gene (offspring of the EL breeding, genotype;
lox-Piga-lacZ(/+p); EIIa-cre(+m/);
Fig 4 and Table
1). Offspring of the EL breeding had a higher perinatal lethality
(13.4% v 3.7%) and a clearly biased sex distribution in favor
of male newborns not carrying a lox-Piga-lacZ allele
(male/female = 1.8). This suggests that very high levels of
Piga gene recombination may occur more frequently in EL offspring
but are associated with an increased intrauterine and perinatal
lethality.
View larger version (27K):
[in this window]
[in a new window]
| Fig 4.
Proportion of CD24-deficient RBCs in male and
female newborn mice obtained from the 2 different breedings. Fifty-five
animals that carry both the lox-Piga-lacZ and the EIIa-cre
gene are shown. (The analysis of the first 12 animals [11 EL
females and 1 LE female] were excluded because of initial problems
caused by clumping of CD24 positive cells during the staining
procedure.) Four male mice that did not inherit the
lox-Piga-lacZ gene served as negative controls. Each box plot
displays the 10th, 25th, 50th, 75th, and 90th percentile. The median is
indicated. Values above the 90th or below the 10th percentile are
plotted.
|
|
PIGA() blood cells in adult mice mosaic for a nonfunctional
Piga gene.
Thirty-nine animals with a RBC contribution of PIGA() cells
greater than 2% and a white blood cell contribution greater than 5%
at the age of 4 weeks were followed for an observation period of 8 to
12 months. During the observation period, 3 animals died. In 2 animals
the cause of death was most likely related to the anesthesia during the
bleeding procedure. One mouse developed a metastatic tumor of the
uterus at the age of 1 year (data not shown). The contribution of
PIGA() cells to the different blood cell lineages in peripheral
blood was variable. A representative example of a FCA is shown in
Fig 5. Animals with a high proportion of PIGA() cells in one blood cell lineage had usually also
a high contribution of PIGA() cells in all other blood cell
lineages. The magnitude of differences in the proportion of
PIGA() cells was dependent on the cell type
(Fig 6A and B).
View larger version (43K):
[in this window]
[in a new window]
| Fig 5.
FCA of peripheral blood cells of a mouse mosaic for
lox- Piga-lacZ (PIGA) and a normal age matched control
mouse. Monoclonal antibodies against CD24, Gr1, and CD48 were used
to determine the proportion of PIGA() cells in individual blood cell
lineages (see Materials and Methods). The left upper
quadrant displays the proportion of PIGA() cells in the individual
cell lineage. Proportion of PIGA() cells in the PIGA mouse and
values of the control mouse in parenthesis: RBCs: 10% {0%},
granulocytes: 22% {1%}, B cells 15% {0%}, T cells: 35%
{0%}, CD8+: 31% {0%}, CD4+: 33%
{0%}.
|
|
View larger version (40K):
[in this window]
[in a new window]
| Fig 6.
Proportion of PIGA() cells in peripheral blood from
mosaic mice. (A) Proportion of PIGA() RBCs during the observation
period of 12 months. (B) Proportion of PIGA() granulocytes (PMN), T
cells, B cells, CD8+, and CD4+ cells during
the observation period of 12 months. Each box plot displays the 10th,
25th, 50th, 75th, and 90th percentile. Values above the 90th or below
the 10th percentile are plotted [Table 2 shows the values for median,
the number of animals analyzed, and the level of significance of the
difference in the percentage of PIGA() cells between 2 successive
time points]. (C) Proportion of PIGA() reticulocytes in relation to
the proportion of PIGA() RBCs, granulocytes (PMN), and lymphocytes
(Lyc) in 11 animals more than 16 weeks of age. The values for the
median are indicated and shown by a horizontal line.
|
|
The proportion of PIGA() RBCs was highest after birth reaching
53%. Within the first 4 weeks of life, the proportion of PIGA() RBCs dropped drastically and continued to drop slowly thereafter, reaching a plateau at the age of 16 weeks of around 4% (Fig 6A and
Table 2). After 16 weeks, the proportion of
PIGA() RBCs did not change significantly.
Amongst white blood cells, the proportion of PIGA() cells was
highest for the T cells reaching a maximum of 40% and lowest for the B
cells with a maximum of 21%. The highest proportion of PIGA()
granulocytes observed was 29% (Fig 6B and Table 2). In contrast to the
RBCs within the granulocytes and T cells, the proportion of
PIGA() cells was stable and did not change significantly during
the observation period. Within the B cells an initial small increase of
the proportion of PIGA() B cells was observed up to 8 months,
followed by a decrease at the age of 1 year. Within the T-cell
subpopulation (CD4+ and CD8+ lymphocytes), the
proportion of PIGA() CD4+ cells decreased slowly,
whereas the proportion of PIGA() CD8+ increased
during the observation period of 1 year. It remains uncertain if the
changes observed within the B cells and the T-cell subpopulations are
of biologic significance.
Peripheral blood cell counts in mice mosaic for PIGA() cells.
Peripheral blood cell counts including reticulocyte counts and white
blood cell differentials were obtained from mosaic mice and age-matched
controls. At all times, blood cell counts from mosaic mice did not
differ from blood cell counts of age-matched control mice. In
particular, there was no anemia, cytopenia, or reticulocytosis
(Table 3). Red and white blood cell
morphologies were normal, as determined by visual examination of
May-Grünwald-Giemsa-stained blood films. Hemoglobinuria
was not observed. There was one salient exception: mosaic mouse
406.2 showed an unexplained transient leukocytosis of 23.3 ×103/ µL at the age of 12 months (see Table 3).
There were no signs of infection or other physical findings that would
have explained the leukocytosis in this animal. The proportion of PNH
cells in the individual blood cell lineages did not change.
Half-life of PIGA() RBCs.
To further investigate the decrease of PIGA() red blood cells
after birth we analyzed in 11 mice the proportion of circulating PIGA() reticulocytes (Fig 7) and
compared it with the proportion of PIGA() RBCs, granulocytes,
and lymphocytes within the same animal. In all 11 animals, the
proportion of PIGA() reticulocytes was significantly higher
(median 18.2%, range 7.9 to 27.6, P < .05) than the
proportion of PIGA() RBCs (median 9.5%, range 5.5 to 21.3) but
not significantly different from the number of PIGA() granulocytes (median 18.3%, range 12.4 to 26.7, P = 0.6) from the same animal (Fig 6C and Table 4). The
mean calculated half-life of PIGA() RBCs was 7.3 days and ranged
from 5.3 to 11.9 (Table 4), which is significantly lower than the
half-life of normal mouse RBCs of 15 days.25
View larger version (20K):
[in this window]
[in a new window]
| Fig 7.
FCA of RBCs and reticulocytes in a mouse mosaic for
lox-Piga-lacZ (PIGA, mouse I.D. 3.1; Table 4) and a
normal age matched control mouse. RBCs were stained with thiazole
orange and PE-conjugated anti-CD24 antibodies. The left upper quadrant
shows the proportion of mature normal RBCs (83%), the left lower
quadrant corresponds to the mature PIGA() cells (11%), right upper
quadrant normal reticulocytes (4%), and the right lower quadrant
displays PIGA() reticulocytes (1%).
|
|
View this table:
[in this window]
[in a new window]
|
Table 4.
Percentage of Reticulocytes Within PIGA(+) and
PIGA() RBCs in Lox-Piga-lacZ Mice and the Calculated
Half-Life of PIGA() RBCs
|
|
Complement sensitivity of PIGA() RBCs from mice mosaic for
lox-Piga-LacZ.
To determine whether the decreased life span of PIGA() RBCs
observed in our mosaic mice could be caused by complement mediated intravascular lysis we investigated if the PIGA() RBCs have an increased sensitivity toward complement
(Fig 8A). As mouse serum has previously
been shown to have a poor lytic activity in vitro27 and our
mosaic mice have a mixed genetic background, we chose rat and human
serum as the source of complement.27,28 Serial dilutions of
the serum was used to titrate complement activity. Exposed to acidified
serum at 37oC, RBCs from lox-Piga-lacZ mosaic
mice showed a substantially increased susceptibility toward the lytic
action of activated complement when compared with RBCs obtained from a
normal control animal (Fig 8A, B, and D). Lysis was complement
dependent as it only occurred in samples with fresh serum but not in
samples with heat inactivated serum. Complement dependent lysis of
PIGA() RBCs in mosaic animals was assessed by flow cytometry.
After 1 hour of incubation in either rat or human serum, a significant decrease of the proportion of PIGA() RBCs was noted, indicating that PIGA() RBCs are preferentially lysed after complement
activation (see Fig 8C and 8E).
View larger version (55K):
[in this window]
[in a new window]
| Fig 8.
Complement sensitivity of PIGA() RBCs. (A) Sensitivity
toward complement mediated lysis. Lysis of RBCs from mosaic mice
(PIGA) and from normal control mice were exposed to different
dilutions of acidified absorbed rat serum (S) or acidified absorbed rat
serum after heat inactivation (HS; see Materials and Methods) for 60 minutes at 37oC. The supernatant shows the degree of
hemolysis. (B, D) Lysis of RBCs from mosaic mice (filled symbols) and
from normal control mice (empty symbols) at different serum dilutions
from rat and (B) human (D). (C, E) Preferential lysis of PIGA() RBCs
by rat and (C) human serum (E) at serum dilutions that lyse only blood
cells from mosaic mice but not from normal control mice (full lines).
Dotted lines show the percentage of PIGA() RBCs exposed to heat
inactivated serum. Serum dilutions shown in C: triangle 1:2, rectangle:
1:4, squares: 1:8; in E: rectangle: 1:4, squares: 1:8, circles: 1:16,
and triangles: 1:32.
|
|
| |
DISCUSSION |
The molecular basis of the human disease PNH has been
elucidated,33-35 but we still need to explain how one or
few PNH clones virtually take over hematopoiesis in PNH patients. For
this purpose a mouse model would be extremely useful. Because Piga
inactivation is embryonic lethal, previous attempts had to depend
on the laborious task of producing chimeras.13,14 The mouse
model we have reported here has 4 distinct advantages: (1) By mating
lox-Piga-lacZ with EIIa-cre mice we can produce any
desired number of animals that undergo Piga inactivation at the
somatic cell level (as occurs in PNH patients). (2) Cre expression
under the EIIa promoter is temporally restricted to early embryonic
life and no Piga gene recombination occurs thereafter (see also
Fig 3). This allows us to study growth and differentiation of
hematopoietic stem cells that lack GPI-linked proteins. (3) In the
previously reported chimeric mice, the PIGA() ES-cells were from
strain 129, whereas the PIGA(+) host blastocysts were from strain
C57BL/6.13,14 Therefore, in those animals, PIGA(+) and PIGA
() hematopoiesis were genetically different.36,37 By
contrast, in our loxP-Piga-lacZ mosaic animals, all cells
are genetically identical except for the Piga mutation. (4) In
comparison to the chimeric mice13,14 the contribution of
PIGA() cells to hematopoiesis is significantly higher (up to
30-fold).
Piga gene inactivation in lox-Piga-lacZ mice.
Concurring with the "Ohno's law"31 the mouse
Piga gene, like its human homologue, maps to the X chromosome
at position F3-F4, which is syntenic to human Xp22.1.32 The
presence of GPI-deficient cells in female mice heterozygous for the
mutated Piga gene indicates that the murine Piga gene,
like the human gene, is subject to X-chromosome inactivation. The fact
that Piga is X-linked has been a distinct advantage in our
work, because knocking out a single allele produces complete loss of
gene product and in female offspring the PIGA() phenotype is
only expressed after X-chromosome inactivation of the chromosome
carrying the wild type Piga gene. The latter also accounts for
the high contribution of PIGA() cells in female offspring (see
also Figs 2 and 4 and Table 1).
Mice that are mosaic for a nonfunctional Piga gene have blood cells
with the PNH phenotype.
In lox-Piga-lacZ offspring some but not all of RBCs,
granulocytes, T lymphocytes, and B lymphocytes are deficient in
GPI-linked proteins. The extent of PIGA() cell contribution is
dependent on the breeding and on the sex of the offspring (see above
and Figs 2 and 4 and Table 1). The coexistence of normal cells and PIGA() blood cells mirrors the phenotype seen in patients with PNH and confirms that in mice, like in humans, PIGA() stem cells are able to contribute to hematopoiesis and to differentiate into mature blood cells of all lineages. The contribution of PIGA() cells to the peripheral blood was dependent on the blood cell lineage
(see Fig 6A and B). No relative increase in PIGA() blood cells
was observed in our mosaic mice over the observation period of 12 months. Because in our animals PIGA(+) and PIGA() cells are
otherwise isogenic, the fact that PIGA() cells do not have a
growth advantage proves conclusively that Piga inactivation is
not sufficient to bring about any progressive expansion of PNH cells.
PIGA() RBCs have a reduced half-life and an increased
sensitivity toward complement mediated lysis.
One of the classical clinical characteristics of patients with PNH
is hemoglobinuria (as implied by the name of the disease). In humans,
hemoglobinuria is caused by complement mediated intravascular hemolysis
of PNH RBCs because of their lack of GPI-linked complement regulatory
molecules (DAF and CD59). The half- life of PNH RBCs in circulation is
reduced, which is reflected by a usually higher proportion of PNH
reticulocytes compared with the proportion of mature PNH
RBCs.38,39 The presence of RBCs with an increased sensitivity to lysis by activated complement was used for the diagnosis
of PNH for many years. The various diagnostic tests mainly differ in
their means of complement activation. The Ham test was the standard
diagnostic test for PNH over half a century.5 It measures
indirectly the functional consequences of the lack of complement
regulatory proteins. In the Ham test PNH red blood cells, but not
phenotypically normal RBCs, are lysed by the action of complement
activated through the alternative pathway by lowering the serum
pH5. Although in our mice hemoglobinuria was not observed
and there were no obvious signs of hemolysis (Table 3), we found a
reduced half-life of PIGA() RBCs (Fig 6C) and the in vitro
sensitivity of PIGA() RBCs toward complement mediated lysis was
increased (Fig 8). The defect in regulation of complement on the cell
surface offers an elegant explanation of the decreased life span of
PIGA() RBCs in vivo, suggesting that our mice may experience
some degree of intravascular hemolysis, which might account for the
comparably low contribution of PIGA() RBCs in peripheral blood
and, at least in part, for the rapid decrease of PIGA() RBCs in
newborn mosaic animals. The fact that laboratory mice live in an
artificial clean environment, that the proportion of PIGA() RBCs
in our mice is rather small, and that murine RBCs, in contrast to human
RBCs, express, in addition to the GPI-linked CD55 and CD59 molecules,
also a transmembrane molecule Crry/p65, which regulates complement
activation,40 may explain why obvious signs of hemolysis
such as hemoglobinuria, reticulocytosis, and anemia were not observed
in mice with PIGA() RBCs. Although the increased sensitivity to
complement is an attractive explanation for the reduced life span of
PIGA() RBCs in vivo, we cannot exclude the possibility that
other mechanisms, different from hemolysis, may be responsible for or
contribute to the decreased half-life of PIGA() RBCs. An example
could be the removal of RBCs lacking GPI-linked proteins by macrophages
in the reticuloendothelial system.
Mice mosaic for a nonfunctional Piga gene; a mouse model of PNH.
Hematopoiesis of our mosaic mice resembles, in many ways,
hematopoiesis seen in patients with a small established PNH clone. However, there are distinct interesting differences; for example in the
contribution of PIGA() cells to the lymphoid lineage. Recent
studies suggest that most patients with PNH have circulating PNH
lymphocytes.41 However, the proportion of lymphocytes
affected is always much smaller than the proportion of PNH granulocytes or RBCs. In contrast in our mosaic mice, the proportion of
PIGA() cells was highest within the lymphocytes (sum of
CD48-cells) and significantly lower within the granulocytes or RBCs.
Moreover, in humans, the proportion of PNH B cells and T cells is
variable,42 whereas in our mice the proportion of
PIGA() B cells was always lower (about 50%) compared with the
proportion of PIGA() T cells (Fig 6B). Of course we cannot
exclude that some of these differences in PIGA() hematopoiesis
between mice and humans are due to the overall contribution of
PIGA() cells in our mosaic mice. However, studies on the
contribution of PIGA() cells in various tissues of mosaic mice
revealed a strong selection against PIGA() cells during
embryogenesis in all tissues with the salient exception of
hematopoietic cells.43 Nonetheless, transplantation
experiments in a congenic background will be necessary to finally
confirm that our findings are intrinsic to PIGA() hematopoiesis.
The most important difference, however, is that, in our mice, because of the nature of how Piga gene recombination was obtained,
hematopoiesis is mosaic and most likely derived from several
PIGA() hematopoietic stem cells. But, in humans PNH
hematopoiesis is clonal, caused by the expansion of one9 or
a few12 early hematopoietic progenitor cells. The ability
of the mutated progenitor cell to contribute equally to all blood cell
lineages might be limited. Clonal expansion of PIGA() cells was
not observed in our mice, suggesting that in humans in addition to the
PIGA mutation a second factor is responsible for the PNH clone
to expand and cause the disease of PNH.
The study of hematopoiesis after Cre mediated recombination in our
lox-Piga-lacZ animals is a promising tool for defining these
additional factors, which are crucial in the pathogenesis of PNH.
| |
ACKNOWLEDGMENT |
We thank Lucio Luzzatto for his generous support and helpful
discussions. We are grateful to John P. Atkinson for his expertise in
complement activation. We thank Dan Link, Rosario Notaro, Tassos Karadimitris, Doudja Nafa, David Araten for stimulating discussions, Philip J. Mason for reading the manuscript, Hubert Amrein and Andreas
Kottman for providing the lacZ and Cre vectors, and Peter Mombaerts for the LTNL vector. CJ7 ES cells were obtained from Tom
Gridley. EIIa-cre transgenic mice were kindly provided by Heiner Westphal.
| |
FOOTNOTES |
Submitted March 2, 1999; accepted May 7, 1999.
Work at the Memorial Sloan-Kettering Cancer Center was supported by a
National Institutes of Health (NIH) Grant No. RO1-HL-56678-01 to L. Luzzatto. Work at Washington University is supported by the McDonnell
Foundation, Howard Hughes Medical Institute, Barnes Jewish Hospital
Foundation, and Edward Mallinckrodt Foundation. P.P.P. is a Scholar of
the Leukemia Society of America. P.K. is funded by the Herzog-Egli
Stiftung. M.B. receives the Junior Faculty Award of the American
Society of Hematology.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to M. Bessler, MD, PhD, Division of
Hematology, Department of Medicine, Washington University School of
Medicine, 660 S Euclid Ave, Campus Box 8125, St Louis, MO 63110;
e-mail: mbessler{at}im.wustl.edu.
| |
REFERENCES |
1.
Takeda J, Miy |
TOP
ABSTRACT
INTRODUCTION