|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 9 (November 1), 1999:
pp. 2955-2962
Molecular Basis and Enzymatic Properties of Glucose 6-Phosphate
Dehydrogenase Volendam, Leading to Chronic Nonspherocytic Anemia,
Granulocyte Dysfunction, and Increased Susceptibility to Infections
By
Dirk Roos,
Rob van Zwieten,
Juul T. Wijnen,
Felix Gómez-Gallego,
Martin de Boer,
David Stevens,
Claudia J. Pronk-Admiraal,
Thea de Rijk,
Cornelis J.F. van Noorden,
Ron S. Weening,
Tom J. Vulliamy,
J. Eduard Ploem ,
Philip J. Mason,
José M. Bautista,
P. Meera Khan, and
Ernest Beutler
From the Central Laboratory of the Netherlands Red Cross Blood
Transfusion Service and Laboratory for Experimental and Clinical
Immunology, and the Department of Cell Biology and Histology, and
Department of Pediatrics, Emma Children's Hospital, Academic Medical
Center, University of Amsterdam, Amsterdam; Department of Human
Genetics, University of Leiden, Leiden; Laboratory of Clinical
Chemistry, Hematology and Immunology, Medical Center Alkmaar, Alkmaar;
Department of Hematology, Sint Lucas Hospital, Amsterdam, The
Netherlands; Department of Biochemistry and Molecular Biology IV,
University Complutense de Madrid, Madrid, Spain; Department of
Haematology, Imperial College School of Medicine, Hammersmith Hospital,
London; Royal Postgraduate Medical School, University of London,
London, United Kingdom; and the Department of Molecular and
Experimental Medicine, The Scripps Research Institute, La Jolla,
CA.
 |
ABSTRACT |
We have investigated the blood cells from a woman with a low degree
of chronic nonspherocytic hemolytic anemia and frequent bacterial
infections accompanied by icterus and anemia. The activity of glucose
6-phosphate dehydrogenase (G6PD) in her red blood cells (RBCs) was
below detection level, and in her leukocytes less than 3% of normal.
In cultured skin fibroblasts, G6PD activity was approximately 15% of
normal, with 4- to 5-fold increased Michaelis constant (Km) for NADP
and for glucose 6-phosphate. Activated neutrophils showed a decreased
respiratory burst. Family studies showed normal G6PD activity in the
RBCs from all family members, including both parents and the 2 daughters of the patient. Sequencing of polymerase chain reaction
(PCR)-amplified genomic DNA showed a novel, heterozygous
514C T mutation, predicting a Pro172Ser replacement.
Analysis of G6PD RNA from the patient's leukocytes and fibroblasts
showed only transcripts with the 514CT mutation. This was
explained by the pattern of X-chromosome inactivation, studied by means
of the human androgen receptor (HUMARA) assay, which proved to be
skewed in the patient, her mother, and one of the patient's daughters.
Thus, the patient has inherited a de novo mutation in G6PD from her
father and an X-chromosome inactivation determinant from her mother,
causing exclusive expression of the mutated G6PD allele. Purified
mutant protein from an Escherichia coli expression system
showed strongly decreased specific activity, increased Km for NADP and
for glucose 6-phosphate, and increased heat lability, which indicates
that the defective phenotype is due to 2 synergistic molecular
dysfunctions: decreased catalytic efficiency and protein instability.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
GLUCOSE 6-PHOSPHATE dehydrogenase (G6PD)
catalyzes the conversion of glucose 6-phosphate into
6-phosphogluconolactone and the concomitant reduction of NADP into
NADPH. This is the first step in the hexose monophosphate (HMP) pathway
and, together with the second step in this pathway, the only source of
NADPH in cells lacking mitochondria. Therefore, G6PD has an essential function in protecting red blood cells (RBCs) against oxidative stress.
Deficiency of G6PD is one of the most common genetic
defects in humans, probably due to the protection of G6PD-deficient
RBCs against proliferation of malaria parasites.1 The
clinical expression of G6PD deficiency varies from mild hemolytic
anemia induced by infections or drugs (World Health Organization
[WHO] class 3) to chronic nonspherocytic hemolytic anemia with
attacks of severe anemia induced by infections and drugs (class 1).
This last type of G6PD deficiency is often first manifested by neonatal
jaundice, because the liver function may be impaired as
well.1 Because the G6PD gene is located on the X
chromosome, the clinical symptoms of the disease are usually confined
to hemizygous men, although female carriers with a marked expression of
the aberrant allele may also suffer.
Occasionally, patients with G6PD deficiency have been described with
decreased leukocyte functions.2-6 In general, the
G6PD activity in the leukocytes needs to be below 5% of
normal for such impairment to occur.3 In particular,
phagocytic leukocytes use NADPH for the reduction of molecular oxygen
to superoxide (O2 ), a prerequisite for
effective killing of micro-organisms by these cells. As a result,
severe G6PD deficiency manifested in leukocytes may present as a form
of chronic granulomatous disease, which is usually caused by intrinsic
defects in the superoxide-generating enzyme.7
We now describe a female patient with severe G6PD
deficiency, chronic hemolytic anemia, increased susceptibility to
infections, and impaired superoxide generation. We have
characterized the enzymatic properties of the mutant G6PD and
determined the mutation responsible for these changes. The
results indicate that replacement of proline-172 by serine causes
drastic changes in the characteristics of the enzyme. We propose to
call this variant enzyme G6PD Volendam, after the place of origin of
the patient. Some of our findings were reported previously in
abstract form.8,9
| |
MATERIALS AND METHODS |
Case History
The patient is a woman born in 1960 from a nonconsanguineous marriage,
with no hematologic abnormalities in the maternal or paternal family.
The pedigree is shown in Fig 1. After birth, she presented with severe
icterus. Thereafter, she experienced several episodes of hemolysis and
icterus after the use of aspirin and during infections. In particular,
she suffered from pneumonia due to pneumococcus infection, from
cystitis, and from several noncharacterized infections of the airways.
These infections were treated with oral antibiotics, but recovery was
slow. During infection-free periods, a mild chronic hemolysis was
apparent from the low-normal level of hemoglobin (11.1 to 11.6 g/dL;
normal, 11.8 to 15.3), decreased levels of haptoglobin (<30
mg Hb bound per 100 mL serum; normal, 30 to 240), and
increased fraction of reticulocytes (3.6% to 4.0%; normal, 0.2% to
2.0%). The mean RBC indices were as follows: mean corpuscular
hemoglobin concentration (MCHC), 20.5 mmol/L (normal, 19.3 to 22.3); mean corpuscular hemoglobin (MCH), 2,330 attomol (normal, 1,720 to 2,170); and mean corpuscular
volume (MCV), 114 fL (normal, 85 to 104). Blood transfusions were given to the patient after episodes of hemolysis and each time after she had
given birth. The first child, a daughter, was born in 1988 after an
uneventful, full-term pregnancy. The second child, a daughter, was born
in 1990 after a 30-week pregnancy but died 12 hours later of
intra-abdominal bleeding. The last child, a daughter, was born in 1992 after a 30-week pregnancy. She and her eldest sister are healthy.
Methods
Purification and culture of cells.
RBCs were obtained as described10 from citrated blood by
centrifugation and aspiration of plasma and buffy coat, and were washed
3 times with physiologic saline before analysis. Leukocytes were
prepared from heparinized blood as described11 by
centrifugation, aspiration of plasma, and lysis of RBCs with isotonic
ammonium chloride. The leukocytes were washed 3 times with saline
before analysis. Neutrophils and lymphocytes were purified from
leukocytes by centrifugation over isotonic Percoll of 1.077 g/mL.10 Skin fibroblasts were cultured until confluency in
Ham's F10 medium (Life Technologies, Breda, The
Netherlands) supplemented with 20% fetal calf serum, and were
harvested by trypsinization according to standard methods.
Enzyme determinations.
G6PD activity in RBCs was determined as described
previously,10 with 1.3 mmol/L glucose 6-phosphate and 0.1 mmol/L NADP. Quantitative determination of G6PD activity in single
erythrocytes was performed with a cytochemical staining method based on
the reduction of tetra-nitroblue tetrazolium (tetra NBT).12
Activities of glutathione reductase in RBCs and 6-phosphogluconate
dehydrogenase in purified neutrophils and lymphocytes were determined
as described previously.10,13
Partial purification of G6PD from cultured fibroblasts was performed by
the first 2 steps of the procedure described by Yoshida.14 Molecular characterization of partially purified G6PD was performed according to the recommendations of the WHO Report on the Study of
G6PD,15 except for the electrophoresis on
Cellogel (MALTA, Milano, Italy) instead of starch.
Neutrophil function tests.
Purified neutrophils were suspended in a medium that contained 138 mmol/L NaCl, 2.7 mmol/L KCl, 8.1 mmol/L
Na2HPO4, 1.5 mmol/L KH2PO4, 0.6 mmol/L CaCl2, 1.0 mmol/L MgCl2, 5.5 mmol/L glucose, and 0.5% (wt/vol) human
albumin (pH 7.4). Oxygen consumption was measured with an oxygen
electrode11 and hydrogen peroxide production by
oxidation of homovanillic acid.16 Semiquantitative
assessment of superoxide generation in individual cells was performed
with an NBT slide test.17 Activity of the hexose
monophosphate pathway was measured by 14CO2
formation from 1-14C-glucose.13 Phagocytosis,
killing, and degradation of Escherichia coli by neutrophils was
determined with the test described by Hamers et al.18
Molecular genetic studies.
Genomic DNA was isolated from circulating leukocytes.19
Southern blot analysis of genomic DNA was performed by digestion with
the restriction enzyme EcoRI and hybridization with the
full-length G6PD cDNA probe pGD-T-5B. Fragments of the G6PD gene were
amplified from genomic DNA by polymerase chain reaction (PCR) with the
primers and under conditions specified by Beutler et al.20
For nucleotide sequencing, the direct sequencing method was
used.21 To confirm the mutation found in the patient,
mismatch PCR was applied with the primers listed in Table
1, followed by restriction fragment analysis with BanII. In addition, a PCR-amplified fragment of genomic DNA that contained nt C514 was also sequenced with an Amplitaq-21M13 Dye Primer Cycle Sequencing kit (Perkin-Elmer, Norwalk,
CT) and analyzed with a model 373 DNA sequencer (Applied Biosystems,
Foster City, CA). Primers and conditions are given in Table 1.
RNA was isolated from circulating mononuclear leukocytes or cultured
fibroblasts and converted into cDNA.21 A fragment of G6PD
cDNA from nt 408 to nt 703 was amplified by PCR with the primers and
under conditions specified in Table 1. The product of this reaction was
sequenced by cycle sequencing as described earlier.
Analysis of the X-chromosome inactivation patterns was performed by
investigating the repeat polymorphisms and methylation-sensitive HpaII site at the androgen receptor gene locus (HUMARA), as
described elsewhere.22,23
Expression of G6PD in E coli.
The pMPM24 series of arabinose-inducible expression vectors
was a kind gift of Dr M.P. Mayer (Institute for Biochemistry and
Molecular Biology, Albert Ludwigs University, Freiburg, Germany). To
facilitate cloning into the pMPM series of vectors, G6PD cDNA was
prepared as a partial NcoI/XhoI fragment. This was
cloned into NcoI/XhoI-cleaved pMPM-A4 . In this
vector, there is an EcoRI site immediately 5' of the
NcoI site. Subsequently, the EcoRI/XhoI fragment containing G6PD cDNA was cloned into pBluescript
(Stratagene, La Jolla, CA) for manipulation. Site-directed mutagenesis
was performed with the Transformer mutagenesis kit obtained from
Clontech (Palo Alto, CA) and used according to the
manufacturer's recommendations. The template for mutagenesis was a
plasmid that consisted of the NcoI/XhoI fragment of
G6PD cDNA cloned into pBluescript. By means of the oligonucleotide
5'CGTGGAGAAGAGCTTCGGGAGGGA3', the sequence 5'GCCCTT3' was changed into 5'GAGCTT3'. This
changed the residue 172 from Pro to Ser and introduced an MboII
restriction site 5'GAAGA3', which was subsequently used to
identify clones carrying the mutation. After mutagenesis, the cDNA was
cloned into pMPM-A4 by means of EcoRI and XhoI
sites. Recombinant (r) human G6PD B and G6PD Volendam were expressed in
DR612 E coli lacking endogenous G6PD activity25 by
induction with 2% arabinose.24 Purification of rG6PDs was
performed by affinity chromatography as previously reported.26,27 Elution of rG6PD Volendam in the presence of 20 µmol/L glucose 6-phosphate was achieved with 100 µmol/L NADP instead of the usual 50 µmol/L NADP due to the increased binding of
G6PD Volendam to 2',5'-ADP-Sepharose 4B. The
electrophoretic mobility of the recombinant enzymes was determined by
means of electrophoresis in native polyacrylamide in Tris buffer (pH
8.8) at 4°C,28 followed by G6PD activity staining with
phenazine methosulfate (PMS) and methylthiotetrazole
(MTT).15 Thermostability assays were performed according to
the WHO protocol.15 Briefly, samples with purified
recombinant enzyme were incubated for 60 minutes at 51°C; aliquots
were drawn every 20 minutes and assayed for G6PD activity.
| |
RESULTS |
Table 2 shows that the G6PD activity in the
patient's RBCs was below the detection limit of our assay. In
contrast, the glutathione reductase activity was increased, as was the
number of reticulocytes in the patient's blood. None of these
abnormalities were found in the patient's relatives: her parents, 11 paternal uncles and aunts, 12 maternal uncles and aunts, 1 brother, 2 sisters, and 2 daughters (Fig 1).
Nevertheless, paternity investigations showed a 99.4% probability of
the patient being the child of her legal parents.
The cultured fibroblasts from the patient contained approximately 15%
of normal G6PD activity (Table 3). On
electrophoresis the enzyme formed 2 anodal bands that migrated
approximately 75% and 95% of the distance of the normal G6PD B enzyme
on Cellogel in 75 mmol/L Tris-EDTA-citric acid (TEC)
buffer at pH 7.5.29 The Michaelis constants (Km) for NADP
and glucose 6-phosphate were increased by a factor of 4 and 5, respectively, whereas the inhibitor constant (Ki) for
NADPH was normal (Table 3). The utilization of the substrate analog
deamino-NADP was one third of normal (Table 3). Furthermore, the pH
optimum was found to be a narrow peak at pH 8.5, instead of a broad
range at pH 7.0 to 8.5 for G6PD B (Fig 2).
View larger version (20K):
[in this window]
[in a new window]
| Fig 2.
pH curve of G6PD Volendam. The enzymatic activity of G6PD
partially purified from cultured fibroblasts of a healthy individual
( ) or from the patient ( ) was measured at various pH values.
Results are percentage of normal G6PD-B activity at pH 8. Each data
point is the mean of 2 independent measurements performed in duplicate;
the mean values of the 2 duplicates did not differ by more than 5%.
|
|
Because the patient suffered from undue susceptibility to bacterial
infections of the airways, granulocyte functions and enzyme content
were tested. Table 2 shows that G6PD deficiency was also manifested in
the total leukocytes and in the purified neutrophils of the patient.
Moreover, as shown in Table 4, her
neutrophils displayed a profoundly diminished oxidative capacity after
activation with opsonized zymosan particles (STZ) or phorbol-myristate
acetate (PMA). Phagocytosis, killing, and degradation of E coli
in vitro were normal (data not shown).
To identify the mutation in the G6PD gene responsible for the enzyme
deficiency, genomic DNA from leukocytes was PCR-amplified and
sequenced. This showed a heterozygous 514CT mutation,
predicting a Pro172Ser substitution (Fig
3). Restriction enzyme analysis of
PCR-amplified genomic DNA from hair roots also indicated the patient to
be heterozygous for the 514CT mutation (not shown). No other
mutations in the coding region of the G6PD gene were found. We also
examined the G6PD gene for a possible deletion by restriction fragment
length polymorphism (RFLP) analysis of genomic DNA after incubation
with EcoRI, probing with full-length G6PD cDNA, but found only
normal fragments in the patient, her parents, sisters, brother, and
eldest daughter. These fragments were stained with normal intensity (in
the women with an intensity twice as big as in the men). In leukocyte
DNA from these family members, the 514CT mutation was not
found (Fig 3).
View larger version (28K):
[in this window]
[in a new window]
| Fig 3.
Analysis of genomic and complementary DNA from the
patient with G6PD Volendam and her family. A PCR product, containing
the region around 514C of the G6PD gene, was generated from genomic or
cDNA obtained from blood leukocytes or cultured fibroblasts, and was
analyzed by Dye Primer Cycle sequencing. Starting material: left,
genomic DNA from leukocytes of the father and the mother of the
patient, the patient, and her 2 daughters; right, cDNA from leukocytes
of a healthy control and the patient; and cDNA from cultured
fibroblasts of a healthy control and the patient. Arrows indicate
mutant sequence.
|
|
Because the G6PD activity in the patient's cells was so low, we
suspected that the normal allele was hardly transcribed. Indeed, when
we tested the RBCs with a cytochemical assay that scores the G6PD
activity quantitatively in each separate cell, we found 94% of the
patient's cells without any activity and 6% with less than 5% of the
normal mean activity (Fig 4). Thus, there
was no indication for a population of RBCs with normal G6PD activity. Moreover, in the patient's purified neutrophils, a similar
cytochemical test for the distribution of the NADPH oxidase activity
(which generates superoxide) showed all cells to contain a low
activity. Apparently, the G6PD deficiency was manifested in all cells,
in neutrophils as well as in erythrocytes. Analysis of PCR-amplified cDNA from the patient's leukocytes and cultured fibroblasts revealed only the 514T sequence in the G6PD cDNA (Fig 3), indicating the preferential transcription of the mutated allele in these cells.
View larger version (98K):
[in this window]
[in a new window]
| Fig 4.
Cytochemical localization of G6PD activity in
erythrocytes from the patient with G6PD Volendam and her family. The
test was performed as described.12 G6PD activity in
individual erythrocytes was analyzed as production of formazan by
reduction of tetra NBT and quatitated by means of cytophotometry
through a microscope. The mean integrated absorbance per cell was
measured in 50 randomly chosen cells, corrected for aspecific light
loss in cells incubated in the absence of glucose 6-phosphate and
expressed in activity grades from 1 to 10 (grade 1 = 0 to 10 arbitrary units, grade 2 = 10 to 20 arbitrary units, etc, up to grade
10 = 90 to 100 arbitrary units). (A) Histochemical localization of
G6PD activity in erythrocytes from a healthy control, the father and
mother of the patient, and the patient herself. Original magnification
x 400. (B) Quantitative scores of these reactions are shown for the
control, the father, the mother, and the patient.
|
|
Thus, the patient, a heterozygous female, only appears to be expressing
the mutated G6PD gene. This situation may arise by nonrandom
X-chromosome inactivation. We investigated X-chromosome inactivation
patterns in her leukocytes and in those from some of her relatives by
means of the HUMARA assay. The results (Fig 5) show that she had a completely skewed
X-chromosome inactivation pattern, with only 1 chromosome active in all
her cells. Her mother and 1 of the patient's daughters also had
completely skewed patterns, while her 2 sisters showed a random
pattern. Data from the other daughter were uninformative.
View larger version (59K):
[in this window]
[in a new window]
| Fig 5.
Segregation of a skewed pattern of X-chromosome
inactivation. The autoradiograph shows the results of amplification of
the HUMARA polymorphism either without ( ) or with (+) prior
digestion with HpaII. Each allele appears as a doublet. With
reference to the family tree in Fig 1, the subjects analyzed are as
follows: 1 =II:13 (mother of the patient); 2 = II:4 (father of the
patient); 3 = III:2 (patient); 4 = III:4 (sister of the patient); 5 = III:5 (sister of the patient); 6 = IV:1 (daughter of the
patient); 7 = IV:3 (daughter of the patient). Notice that 1, 3, and 7 show a skewed pattern of X-chromosome inactivation, 4 and 5 are random,
and 6 is uninformative.
|
|
Finally, we also analyzed rG6PD Volendam514T purified from
E coli. The results (Table
5) were in full agreement with those
obtained with the partially purified enzyme from the patient's
fibroblasts (Table 3). The specific activity of the rG6PD Volendam was
only 17% of that observed with rG6PD B, and the Km for NADP and
glucose 6-phosphate was increased by a factor of 2.5 and 3, respectively. The Ki for NADPH was normal. Utilization of
2-deoxy-glucose 6-phosphate, galactose 6-phosphate, and deamino-NADP by
rG6PD Volendam was decreased. The electrophoretic mobility of purified
rG6PD Volendam was near normal, with a band migrating at 95% of the
distance traveled by rG6PD B. However, electrophoresis of crude
bacterial lysate containing rG6PD Volendam resulted in a G6PD-specific
smear between 70% and 95% of the distance migrated by G6PD B in a
crude lysate (Fig 6). The thermostability
of purified rG6PD Volendam at 51°C was strongly decreased (90%
loss of activity after 20 minutes v 20% loss in rG6PD B).
These results indicate that the Pro172Ser substitution in
G6PD induces both altered enzymatic properties and protein instability.
View larger version (115K):
[in this window]
[in a new window]
| Fig 6.
Electrophoretic mobility of rG6PD B and rG6PD Volendam.
rG6PD B and rG6PD Volendam were electrophoresed in native 5%
polyacrylamide gel. The gels were stained for G6PD activity by PMS and
MTT, as described.15 Left: Bacterial crude extract of E
coli DR612 containing pMPM-A4 encoding human G6PD B (B) or G6PD
Volendam (Vol). From top to bottom, arrows indicate the 70%, 95%, and
100% mobilities. Right: rG6PD B and rG6PD Volendam purified by
affinity chromatography.
|
|
| |
DISCUSSION |
The 514CT mutation found in the G6PD gene of
the patient was not detected in the DNA from her father or her mother.
However, the mutation was present in the patient's leukocytes, as well as in her hair-root cells, and the enzyme deficiency was found in her
blood cells as well as in her fibroblasts. Therefore, we conclude that
the mutation must have arisen in the germ-line cells of one of her
parents. In addition, the heterozygous mutation was expressed in an
apparently homozygous way, which can only be explained by inactivation
of the X chromosome that carries the normal G6PD allele in almost all
of her cells. Detection of only the mutated G6PD RNA sequence in the
leukocytes and in the fibroblasts of the patient confirms this idea.
Our study of X-chromosome inactivation patterns in the family showed
that the patient had completely skewed X-chromosome inactivation with
only the X chromosome containing the mutated G6PD allele active in all
of her cells. Her mother and 1 of her daughters also showed complete
skewing. Thus, skewed X-chromosome inactivation appears to be
segregating in this family as a Mendelian X-linked trait. In other
X-linked traits, such as Wiskott-Aldrich syndrome and Duchenne muscular
dystrophy, female carriers who manifest the disease have been observed,
sometimes in families in which skewed X-chromosome inactivation is
inherited (reviewed by Belmont30 and Puck and
Willard31). One mechanism to explain this phenomenon is a
deleterious genetic lesion on the X chromosome that is always inactivated. An alternative mechanism is a genetic defect in the X-chromosome inactivation process itself.31 In the patient
and her mother, this skewed X-chromosome inactivation trait is linked to a different HUMARA allele than in the patient's daughter, which indicates that a recombination event has taken place between the inactivation determinant and the HUMARA allele at Xq11.2. Because the
patient inherited the X chromosome carrying the inactivation determinant from her mother, the de novo mutation in the G6PD gene must
have occurred on the paternal X chromosome.
G6PD molecules form catalytically active dimers by binding NADP. The
proline-to-serine substitution does not alter the charge of the
protein, but it did diminish the affinity for the negatively charged
NADP (Table 3), which may have led to an apparent increase in positive
charge of the protein. Thus, the 95%-mobility band may have contained
mutant dimers with bound NADP, and the 75%-mobility band may have
consisted of monomers or dimers without NADP. Indeed, the fully
NADP-saturated, purified rG6PD Volendam showed a mobility that was 95%
of normal, whereas the same mutant enzyme in crude E coli
lysate (not NADP-saturated) displayed a smear with a mobility of 70%
to 95% of normal.
Although there is a cluster of class 1 mutations in exons 10 and 11 (residues 351 to 455), some other substitutions producing chronic
nonspherocytic hemolytic anemia have been identified elsewhere (as far
away as exons 3 and 4). Pro172 of the human enzyme corresponds to
Pro149 in G6PD from the bacterium Leuconostoc
mesenteroides,32 the only G6PD from which the
three-dimensional structure has been solved up to
date.33 This residue is neither in the subunit interface
nor in the NADP-binding site. Instead, this proline is in a completely
conserved protein coil between the secondary structural elements
beta-sheet-E and alpha-helix-e, important for structural stability.
Probably, this coil is also involved in allowing the 2 domains of each
G6PD subunit to adjust their positions when NADP and glucose
6-phosphate are bound.32 With secondary structural content
prediction (SSCP,34,35 the 7 amino acids of this coil
(EKPFGRD) can be predicted to have a 100% coil content, whereas in the
mutant configuration (EKSFGRD) it shows 80% coil content, 10% alpha
helix content, and 10% beta sheet content. Moreover, Pro149 in the
L mesenteroides G6PD structure refined at 2 Å resolution
presents a different conformation (cis and trans) in
each monomer of the G6PD dimer and is directly involved in positioning
of the substrate pocket to bind the phosphate group of glucose
6-phosphate.33 Extra flexibility induced by substitutions at this position may be expected to both decrease the affinity for
glucose 6-phosphate and, by opening up the structure at a point that
should be rigid, render the enzyme more susceptible to denaturation.
Indeed, the Km value of G6PD Volendam is among the highest described to
date for any G6PD mutant,36 and the recombinant mutant
enzyme was found to be highly unstable. Moreover, the total lack of
enzymatic activity in the RBCs of the patient (mean age in the
circulation,  30 days), the 3% to 4% of normal activity in her
neutrophils (mean age in the circulation, 14 days) and the 15% of
activity in her fibroblasts (doubling time in culture, 4 days) suggests
that G6PD Volendam may be unstable in vivo as well. Probably, both
synergistic effects of the mutation are needed to result in class 1 hemolytic anemia, because G6PD Orissa, caused by another mutation in
the surroundings of the catalytic pocket, shows a high Km value for
glucose 6-phosphate, but is a class 3 variant that leads to anemia only
in the presence of stress.37
Increased susceptibility to bacterial or fungal infections has been
described in a few G6PD-deficient patients.2-6 Only when the G6PD activity in the neutrophils is less than 5% of normal, is the
substrate supply for the NADPH oxidase in these cells insufficient for
the production of normal amounts of superoxide, needed for efficient
killing of micro-organisms.3 Indeed, we found markedly diminished activity of the HMP pathway, oxygen
consumption, and hydrogen peroxide formation in the activated
neutrophils from our patient, albeit not as low as found in neutrophils
from patients with chronic granulomatous disease.7 The
capacity of the neutrophils from our patient to kill E coli in
vitro was undisturbed, also in contrast to the findings in chronic
granulomatous disease,18 and the clinical symptoms were
less severe. However, the in vivo capacity of the G6PD-deficient
neutrophils may be insufficient to locally kill large numbers of
bacteria and clear an infected area quickly.
| |
FOOTNOTES |
Deceased.
Submitted January 27, 1998; accepted June 18, 1999.
Address reprint requrests to Dirk Roos, PhD, Central
Laboratory of the Netherlands Red Cross Blood Transfusion Service,
Plesmanlaan 125, 1066 CX Amsterdam, The Netherlands; e-mail:
d_roos{at}clb.nl.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
| |
REFERENCES |
1.
Beutler E:
G6PD deficiency.
Blood
84:3613, 1994[Free Full Text]
2.
Cooper MR, DeChatelet LR, McCall CE, LaVia M, Spurr CL, Baehner RL:
Complete deficiency of leukocyte glucose-6-phosphate dehydrogenase with defective bactericidal activity.
J Clin Invest
51:769, 1972
3.
Baehner RL, Johnston RB, Nathan DG:
Comparative study of the metabolic and bactericidal characteristics of severely glucose-6-phosphate dehydrogenase deficient polymorphonuclear leukocytes and leukocytes from children with chronic granulomatous disease.
J Reticuloendothel Soc
12:150, 1972[Medline]
[Order article via Infotrieve]
4.
Gray GR, Klebanoff SJ, Stamatoyannopoulos G, Austin T, Naiman SC, Yoshida A, Kliman MR, Robinson GCF:
Neutrophil dysfunction, chronic granulomatous disease, and non-spherocytic haemolytic anaemia caused by complete deficiency of glucose-6-phosphate dehydrogenase.
Lancet
2:530, 1973[Medline]
[Order article via Infotrieve]
5.
Vives Corrons JL, Feliu E, Pujades MA, Cardellach F, Rozman C, Carreras A, Jou JM, Vallespí MT, Zuazu FJ:
Severe glucose-6-phosphate (G6PD) deficiency associated with chronic hemolytic anemia, granulocyte dysfunction and increased susceptibility to infections: Description of a new molecular variant (G6PD Barcelona).
Blood
59:428, 1982[Abstract/Free Full Text]
6.
Mamlok RJ, Mamlok V, Mills GC, Daeschner CW, Schmalstieg FC, Anderson DC:
Glucose-6-phosphate dehydrogenase deficiency, neutrophil dysfunction and Chromobacterium violaceum sepsis.
J Pediatr
111:852, 1987[Medline]
[Order article via Infotrieve]
7.
Roos D, de Boer M, Kuribayashi F, Meischl C, Weening RS, Segal AW, Åhlin A, Nemet K, Hossle JP, Bernatowska-Matuszkiewicz E, Middleton-Price H:
Mutations in the X-linked and autosomal recessive forms of chronic granulomatous disease.
Blood
87:1663, 1996[Free Full Text]
8.
Meera Khan P, Ploem JE, Wijnen JTh, Breukel C, Korthof G, Weening RS:
G6PD Volendam: De novo mutation of unusual mechanism in a severely deficient Dutch female born to apparently normal parents. Berlin, Germany, 7th International Congress of Human Genetics, September 22-26, 1986 (abstr 418a)
9.
Meera Khan P, Ploem JE, Wijnen JTh, Breukel C, Korthof G, Weening RS:
De novo mutation at G6PD locus with clinical consequences in a Dutch female.
Am J Hum Genet
39:14a, 1986 (suppl, abstr)
10.
Loos JA, Roos D, Weening RS, Houwerzijl J:
Familial deficiency of glutathione reductase in human blood cells.
Blood
48:53, 1976[Abstract/Free Full Text]
11.
Weening RS, Roos D, Loos JA:
Oxygen consumption of phagocytizing cells in human leukocyte and granulocyte preparations: A comparative study.
J Lab Clin Med
83:570, 1974[Medline]
[Order article via Infotrieve]
12.
Van Noorden CJF, Vogels IMC, James J, Tas J:
A sensitive cytochemical staining method for glucose-6-phosphate dehydrogenase activity in individual erythrocytes. I. Optimalization of the staining procedure.
Histochemistry
75:493, 1982[Medline]
[Order article via Infotrieve]
13.
Roos D, Weening RS, Voetman AA, van Schaik MLJ, Bot AAM, Meerhof LJ, Loos JA:
Protection of phagocytic leukocytes by endogenous glutathione: Studies in a family with glutathione reductase deficiency.
Blood
53:851, 1979[Free Full Text]
14.
Yoshida A:
Glucose-6-phosphate dehydrogenase of human erythrocytes. I. Purification and characterisation of normal (B+) enzyme.
J Biol Chem
241:4966, 1966[Abstract/Free Full Text]
15. Betke K, Beutler E, Brewer GJ, Kirkman HN, Luzatto L, Motulsky
AG, Ramot B, Sinascalco M: Standardization of procedures for the study
of glucose-6-phosphate dehydrogenase. Report of a WHO Scientific Group.
WHO Tech Rep Ser No. 366, 1967
16.
Roos D, Voetman AA, Meerhof LJ:
Functional activity of enucleated human polymorphonuclear leukocytes.
J Cell Biol
97:368, 1983[Abstract/Free Full Text]
17.
Meerhof LJ, Roos D:
Heterogeneity in chronic granulomatous disease detected with an improved nitroblue tetrazolium dye test.
J Leukoc Biol
39:699, 1986[Abstract]
18.
Hamers MN, Bot AAM, Weening RS, Sips HJ, Roos D:
Kinetics and mechanism of the bactericidal action of human neutrophils against Escherichia coli.
Blood
64:635, 1984[Abstract/Free Full Text]
19.
Sambrook J, Fritsch E, Maniatis T:
Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1989
20.
Beutler E, Kuhl W, Gelbart T, Forman L:
DNA sequence abnormalities of human glucose-6-phosphate dehydrogenase variants.
J Biol Chem
266:4145, 1991[Abstract/Free Full Text]
21.
Bolscher BGJM, de Boer M, de Klein A, Weening RS, Roos D:
Point mutations in the  -subunit of cytochrome b558 leading to X-linked chronic granulomatous disease.
Blood
77:2482, 1991[Abstract/Free Full Text]
22.
Allen RC, Zoghbi HY, Moseley AB, Rosenblatt HM, Belmont JW:
Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-receptor gene correlates with X-chromosome inactivation.
Am J Hum Genet
51:1229, 1992[Medline]
[Order article via Infotrieve]
23.
Gale RE, Mein CA, Linch DC:
Quantification of X-chromosome inactivation patterns in hematological samples using the DNA PCR-based HUMARA assay.
Leukemia
10:362, 1996[Medline]
[Order article via Infotrieve]
24.
Mayer MP:
A new set of useful cloning expression vectors derived from pBluescript.
Gene
163:41, 1995[Medline]
[Order article via Infotrieve]
25.
Fraenkel D:
Selection of Escherichia coli mutants lacking glucose 6-phosphate dehydrogenase.
J Bacteriol
95:1267, 1968[Abstract/Free Full Text]
26.
Town M, Bautista JM, Mason PJ, Luzatto L:
Both mutations in G6PD A- are necessary to produce the G6PD deficient phenotype.
Hum Mol Genet
1:171, 1992[Abstract/Free Full Text]
27.
Bautista JM, Mason PJ, Luzatto L:
Purification and properties of human glucose-6-phosphate dehydrogenase made in E. coli.
Biochim Biophys Acta
1119:74, 1992[Medline]
[Order article via Infotrieve]
28.
Kirkman HN, Hendrikson EM:
Sex-linked electrophoretic difference in glucose 6-phosphate dehydrogenase.
Am J Hum Genet
15:241, 1963
29.
Ratazzi MC, Bernini LF, Fiorelli G, Mannucci PM:
Electrophoresis of glucose-6-phosphate dehydrogenase: A new technique.
Nature
213:79, 1967
30.
Belmont JW:
Genetic control of X inactivation and processes leading to X-inactivation skewing.
Am J Hum Genet
58:1101, 1996[Medline]
[Order article via Infotrieve]
31.
Puck JM, Willard HF:
X inactivation in females with X-linked disease.
N Engl J Med
338:325, 1998[Free Full Text]
32.
Naylor CE, Rowland P, Basak AK, Gover S, Mason PJ, Bautista JM, Vulliamy TJ, Luzatto L, Adams MJ:
Glucose 6-phosphate dehydrogenase mutations causing enzyme deficiency in a model of the tertiary structure of the human enzyme.
Blood
87:2974, 1996[Abstract/Free Full Text]
33.
Rowland P, Basak AK, Gover S, Levy HR, Adams MJ:
The three-dimensional structure of glucose 6-phosphate dehydrogenase from Leuconostoc mesenteroides refined at 2.0 Angstrom resolution.
Structure
2:1073, 1994[Medline]
[Order article via Infotrieve]
34.
Eisenhaber F, Imperiale F, Argos P, Froemmel C:
Prediction of secondary structural content of proteins from their amino acid composition alone. I. New analytic vector decomposition methods.
Proteins Struct Funct Design
25:157, 1996
35.
Eisenhaber F, Froemmel C, Argos P:
Prediction of secondary structural content of proteins from their amino acid composition alone. II. The paradox with secondary structural class.
Proteins Struct Funct Design
25:169, 1996
36.
Beutler E:
The genetics of glucose 6-phosphate dehydrogenase deficiency.
Semin Hematol
27:137, 1990[Medline]
[Order article via Infotrieve]
37.
Kaeda JS, Chhotray GP, Ranjit MR, Bautista JM, Reddy PH, Stevens D, Naidu JM, Britt RP, Vulliamy TJ, Luzatto L, Mason PJ:
A new glucose 6-phosphate dehydrogenase variant, G6PD Orissa (44Ala->Gly), is the major polymorphic variant in tribal populations in India.
Am J Hum Genet
57:1335, 1995[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
G P Spickett
Immune deficiency disorders involving neutrophils
J. Clin. Pathol.,
September 1, 2008;
61(9):
1001 - 1005.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T C Alba-Loureiro, S M Hirabara, J R Mendonca, R Curi, and T C Pithon-Curi
Diabetes causes marked changes in function and metabolism of rat neutrophils
J. Endocrinol.,
February 1, 2006;
188(2):
295 - 303.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Wolach, Y. Scharf, R. Gavrieli, M. de Boer, and D. Roos
Unusual late presentation of X-linked chronic granulomatous disease in an adult female with a somatic mosaic for a novel mutation in CYBB
Blood,
January 1, 2005;
105(1):
61 - 66.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. van Bruggen, J. M. Bautista, T. Petropoulou, M. de Boer, R. van Zwieten, F. Gomez-Gallego, B. H. Belohradsky, N. G. Hartwig, D. Stevens, P. J. Mason, et al.
Deletion of leucine 61 in glucose-6-phosphate dehydrogenase leads to chronic nonspherocytic anemia, granulocyte dysfunction, and increased susceptibility to infections
Blood,
July 18, 2002;
100(3):
1026 - 1030.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. N Ames, I. Elson-Schwab, and E. A Silver
High-dose vitamin therapy stimulates variant enzymes with decreased coenzyme binding affinity (increased Km): relevance to genetic disease and polymorphisms
Am. J. Clinical Nutrition,
April 1, 2002;
75(4):
616 - 658.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Efferth, U. Fabry, and R. Osieka
DNA damage and apoptosis in mononuclear cells from glucose-6-phosphate dehydrogenase-deficient patients (G6PD Aachen variant) after UV irradiation
J. Leukoc. Biol.,
March 1, 2001;
69(3):
340 - 342.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
A. Rovira, M. De Angioletti, O. Camacho-Vanegas, D. Liu, V. Rosti, H. F. Gallardo, R. Notaro, M. Sadelain, and L. Luzzatto
Stable in vivo expression of glucose-6-phosphate dehydrogenase (G6PD) and rescue of G6PD deficiency in stem cells by gene transfer
Blood,
December 15, 2000;
96(13):
4111 - 4117.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. A. Lekstrom-Himes and J. I. Gallin
Immunodeficiency Diseases Caused by Defects in Phagocytes
N. Engl. J. Med.,
December 7, 2000;
343(23):
1703 - 1714.
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Ristoff, C. Augustson, J. Geissler, T. de Rijk, K. Carlsson, J.-L. Luo, K. Andersson, R. S. Weening, R. van Zwieten, A. Larsson, et al.
A missense mutation in the heavy subunit of gamma -glutamylcysteine synthetase gene causes hemolytic anemia
Blood,
April 1, 2000;
95(7):
2193 - 2196.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION