|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 94 No. 9 (November 1), 1999:
pp. 3141-3150
Myeloid Transcription Factor C/EBP Is Involved in the Positive
Regulation of Lactoferrin Gene Expression in Neutrophils
By
Walter Verbeek,
Julie Lekstrom-Himes,
Dorothy J. Park,
Pham
My-Chan Dang,
Peter T. Vuong,
Seji Kawano,
Bernard M. Babior,
Kleanthis Xanthopoulos, and
H. Phillip Koeffler
From the Division of Hematology/Oncology, the Department of Medicine,
Cedars-Sinai Medical Center, UCLA School of Medicine, Los Angeles, CA;
Clinical Gene Therapy Branch, National Institutes of Health, Bethesda,
MD; the Division of Biochemistry, the Department of Molecular and
Experimental Medicine, The Scripps Research Institute, La Jolla, CA;
and Aurora Biosciences Inc, San Diego, CA.
 |
ABSTRACT |
Targeted mutation of the myeloid transcription factor C/EBP in
mice results in gram-negative septic death at 3 to 5 months of age.
This study defines the underlying molecular defects in their terminal
granulocytic differentiation. The mRNA for the precursor protein of the
cathelin-related antimicrobial peptides was almost completely absent in
the bone marrow cells of C/EBP / mice. This finding may help
explain their susceptibility to gram-negative sepsis, because both are
bacteriocidal peptides with potent activity against gram-negative
bacteria. Superoxide production was found to be reduced in both
granulocytes and monocytes of C/EBP/ mice. While gp91 phox
protein levels were normal, p47phox protein levels were considerably
reduced in C/EBP / granulocytes/monocytes, possibly limiting
the assembly of the NADPH oxidase. In addition, expression of mRNA of
the secondary and tertiary granule proteins, lactoferrin and
gelatinase, were not detected, and levels of neutrophil collagenase
mRNA were reduced in bone marrow cells of the knock-out mice. The
murine lactoferrin promoter has a putative C/EBP site close to the
transcription start site. C/EBP bound to this site in
electromobility shift assay studies and mutation of this site abrogated
binding to it. A mutation in the C/EBP site reduced the activity of the
promoter by 35%. Furthermore, overexpression of C/EBP in U937 cells
increased the activity of the wild-type lactoferrin promoter by 3-fold.
In summary, our data implicate C/EBP as a critical factor of host
antimicrobial defense and suggests that it has a direct role as a
positive regulator of expression of lactoferrin in vivo.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
THE CCAAT ENHANCER binding protein
(C/EBP) family of transcriptional factors contains 6 members. Two of
these, C/EBP and C/EBP , are of critical importance for the
development of normal neutrophils.1,2 All C/EBP proteins
share a highly conserved, C-terminal leucine-zipper dimerization domain
and a basic DNA binding domain.3-5 The DNA binding
consensus site has been identified as TKNNGYAAK (Y = C or T, K = T or
G).6 The aminoterminal transactivation domains are more diverse.
In the hematopoietic system, C/EBP is expressed early in the
granulocytic differentiation pathway, and its absence in C/EBP knock-out mice leads to a complete lack of granulocytic differentiation with an arrest at the stage of immature myeloblasts. Myeloid cells of
C/EBP/ mice lack granulocyte colony-stimulating factor
(G-CSF) receptor mRNA, which may contribute to their defective
differentiation.2 Recent findings place C/EBP as a
critical factor needed for granulocytic commitment of the myeloid
progenitor cells.7 Expression of C/EBP is strikingly
restricted to the later stages of the granulocytic differentiation
pathway and to the T-lymphoid lineage.8-11 More recently,
expression has also been described in murine monocytes.12 Consistent with the restricted expression pattern of C/EBP, the C/EBP knock-out mice morphologically display defects in terminal differentiation of neutrophils and decreased numbers of eosinophils. The G-CSF, macrophage (M)-CSF, and GM-CSF receptors are expressed in
the myeloid cells of C/EBP/ mice.1
Functional defects of C/EBP/ granulocytic cells
include a significantly reduced capacity to produce superoxide in
response to phorbol 12-myristate 13-acetate (PMA) as well as an
impaired ability to migrate. The mice are born apparently healthy, but
die 3 to 5 months after birth because of infectious complications, most
notably infections with gram-negative bacteria like pseudomonas
aeruginosa.1
To characterize further the differentiation defects in
C/EBP/ mice and to determine potential target genes of
C/EBP, we examined the expression of various myeloid-specific genes
in the bone marrow cells of C/EBP knock-out mice. We focused on
genes potentially involved in the phenotype of abnormal
C/EBP/ granulocytes, eg, the NADPH oxidase complex,
bacteriocidal peptides (cathelins), chemotaxis receptors, and the
primary and secondary granule proteins. In addition, we provide
evidence that the lactoferrin promoter is a direct target of the
transcription factor C/EBP.
| |
MATERIALS AND METHODS |
Expression vectors and promoter reporter constructs.
Eukaryotic expression vectors for the C/EBP isoform p32 and murine
C/EBP have been described.1 The lactoferrin promoter (750 to +39) was amplified using the polymerase
chain reaction (PCR) with primers containing KpnI (5')
and BglII (3') restriction sites. The PCR product was
digested with KpnI and BgllI, agarose gel purified, and
ligated into the KpnI/BglII predigested luciferase reporter plasmid pGL3 basic (Promega, Madison, WI). The construct was
sequenced to confirm its identity to the published sequence (750
Lac-Luc).13 A shorter construct 230 Lac-Luc was
derived from this template by PCR using Pfu Polymerase. A mutation of the C/EBP site was introduced into the wild-type template by PCR mutagenesis with Pfu polymerase and the mutagenic primer: 5' GGG TGT CTA TCT GAC GAC AGG GCG GG 3' according to the method of
Picard et al.14 Sequencing primers derived from pGL 3 basic
were used as 5' (pGL 2) and 3' (RV3) primers for the PCR
reaction. The PCR product was digested with KpnI and
BglII and religated into the vector. A short construct only
containing the proximal 87 bp of the lactoferrin promoter in the
KpnI/BglII restriction sites of pGl3 basic was kindly
provided by Dr Nancy Berliner (Division of Hematology, Yale School of
Medicine, New Haven, CT).
Animals.
C/EBP/ mice and control 129/SvEv × NIH Black
Swiss mice were bred under sterile conditions in the animal housing
facility at the Burns and Allen Research Institute. Mice were killed by cervical neck dislocation. Bone marrow was flushed out of isolated femurs and tibiae with Iscove's Modified Dulbecco's Medium
(IMDM) + 20% fetal calf serum (FCS) using a no. 26 gauge
needle. After depletion of adherent cells by incubation on plastic
dishes for 1 hour, cells were spun down and immediately dissolved in
Trizol reagent. RNA was isolated according to the manufacturer's
protocol. The bone marrow cells taken for RNA isolation contained less
than 1% monocytes and approximately 25% Gr-1 positive cells in
wild-type and knock-out mice. Neutrophils were harvested 4 hours after
intraperitoneal injection with 2 mL 4% thioglycollate by peritoneal
lavage and dissolved in Trizol Reagent (GIBCO-BRL, Rockville,
MD). The RNA was subsequently treated with DNAse I for
30 minutes at 37°C, phenol/chloroform extracted, precipitated with
ice-cold ethanol, and resuspended in 50 µL DEPC-treated
H2O.
Northern blot analysis.
Twenty micrograms of RNA of C/EBP/ bone marrow,
control bone marrow, and NIH3T3 fibroblasts were run on a denaturing
formaldehyde gel at 30 V for 3 hours. RNA was partially hydrolysed by
soaking the gel in 0.05 mol/L NaOH/1.5 mol/L NaCl for 30 minutes
followed by soaking 30 minutes in 0.5 mol/L TrisCl/(pH7.4) for pH
neutralization. The gel was blotted in 20X sodium chloride sodium
citrate solution (SSC) overnight on a nylon membrane
(Magna Charge; Micron Separations Inc, Westborough, MA). The membrane
was baked for 1 hour at 80°C in a vacuum oven and crosslinked in a
UV crosslinker (Stratagene, La Jolla, CA).
Prehybridization and hybridization of the membrane were performed in
Rapid Hyb hybridization buffer (Amersham, Arlington Heights, IL) at
65°C for 1 and 3 hours, respectively. Posthybridization washes were
performed with 2X SSC, 0.1% sodium dodecyl sulfate (SDS) for 20 minutes at room temperature and twice with 0.1X SSC, 0.1% SDS at
65°C for 15 minutes each.
Plasmids containing the cDNAs for lactoferrin (probe:
PvuII/SmaI fragment), neutrophil gelatinase (probe:
EcoRI/BamHI fragment), and neutrophil collagenase
(BglII/PstI fragment) were kindly provided by Dr Nancy
Berliner. A plasmid encoding the cDNA for murine gp91 phox (probe:
NcoI fragment) was kindly provided by Dr M. Dinauer (Herman B. Wells Center for Pediatric Research, Indiana University School of
Medicine, Indianapolis, IN). The probe for murine
cathelin related protein (MCRP) was generated by PCR. The PCR product
(200 bp) was gel purified and directly sequenced using the Perkin Elmer Applied Biosystems DNA sequencing kit (PE Applied Biosystems, Warrington, UK) to confirm its identity to the
published sequence.15 All probes were randomly labeled
before hybridization with 32P-dCTP using the Ready To Go
DNA labeling Kit (Pharmacia Biotech, Piscataway, NJ).
Reverse transcriptase (RT)-PCR assay.
Five micrograms of DNAse I-treated RNA was reverse transcribed with
avian myeloblastosis virus (AMV) RT (Promega, Madison, WI) for 30 minutes at 37°C. Untreated RNA was used as control for
DNA contamination in the RT-PCR reactions. One microliter of cDNA of
C/EBP/, control bone marrow, and NIH3T3 fibroblasts were used as template. PCR was performed under the following
conditions: an initial denaturation step at 94°C for 2 minutes was
followed by 27 cycles, 94°C for 40 seconds, 55°C/58°C for
35 seconds, and 72°C for 35 seconds with the primer pairs listed
in Table 1. The annealing
temperature for rac-1 amplification was 52°C, and for rac-2
64°C. PCR products were blotted by alkaline transfer in 400 mmol/L
NaOH on a nylon membrane and probed with 32P- ATP
end-labeled internal oligonucleotides as indicated. In Table 1, primer
sequences are given as cDNA sequence positions.
Western blot.
107 cells were collected at either 12 or 72 hours after
intraperitoneal injection of 4% thioglycollate into 3-week-old
CEBP/ and wild-type mice. Cells were washed once in
ice-cold phosphate-buffered saline (PBS) and then treated with 2.7 µmol/L DFP (diisopropyl fluorophosphate; Calbiochem, La Jolla, CA)
for 10 minutes on ice, then washed 3 times in ice-cold PBS and lysed in
Triton buffer (20 mmol/L TrisHCl, pH 8.0, 150 mmol/L NaCl, 1 mmol/L
EDTA, 1% TritonX-100, 2 mmol/L phenylmethylsulfonyl fluoride
[PMSF], 20 µg/mL chymostatin, 10 µmol/L
leupeptin, and 1 mmol/L AEBSF [4-(2-aminoethyl)benzene sulfonylfluoride]. All protease inhibitors were purchased from Calbiochem. Fifty micrograms of total cell lysates were loaded in each
lane of a 12% polyacrylamide gel. After SDS polyacrylamide gel
electrophoresis, the proteins were transferred to a nitrocellulose membrane overnight. Membranes were blocked with 5% nonfat dry milk in
TBS-T buffer for 1 hour, then probed with gp91phox (dilution, 1:2,000)
or p47 phox antiserum (dilution, 1:1,000). Antiserum to murine gp91
phox was kindly provided by Dr M. Dinauer.16 Antiserum to
p47phox was described previously.17 Blots were then
incubated with biotinylated anti-mouse/anti-rabbit IgG secondary antibody (dilution 1:3,000; Vector Laboratories Inc, Burlingame, CA)
followed by peroxidase conjugated streptavidin (BioGenax, San Ramon,
CA) as recommended by the manufacturers. All the blots were reprobed
with mouse antirabbit GAPDH antibody (1:4,000 dilution) (Research
Diagnostics Inc, Flanders, NJ) to ensure equal loading of samples.
Signals were detected with Supersignal Blaze Chemiluminescent substrate
(Pierce, Rockford, IL). Antibody incubations and wash steps were
performed with TBS-T (0.05% Tween 20) + 5% nonfat dry milk.
Preparation of nuclear extracts.
For preparation of nuclear extracts, 5 × 106 cells
were washed 3 times with ice-cold PBS. After the last wash, adherent
cells were scraped off the dish with a rubber policeman and resuspended in 500 µL extraction buffer B (20 mmol/L HEPES, pH 7.9, 20%
glycerol, 10 mmol/L NaCl, 0.2 mmol/L EDTA, 1.5 mmol/L
MgCl2, 0.1% Triton X, 1 mmol/L dithiothreitol
[DTT], 1 mmol/L PMSF, 40 µL/mL Complete [Boehringer, Indianapolis, IN]). After a 15-minute incubation on ice,
the nuclei were pelleted at 250g for 10 minutes. Nuclei were
resuspended in extraction buffer B, and NaCl was added dropwise with
mixing to a final concentration of 300 mmol/L NaCl. Nuclei were rocked
for 60 minutes at 4°C. Samples were microcentrifuged at 12,000 rpm
and supernatants frozen at 80°C.
Electromobility shift assay (EMSA).
For protein expression, 10 µg of eukaryotic expression vector
(C/EBP, C/EBP) was transfected into COS-1 cells (10-cm dish). Transfection was performed with Superfect reagent (Qiagen, Valencia, CA) over 3 hours according to the manufacturer's protocol. Nuclear extracts were prepared after 48 hours. Alternatively, recombinant Maltose binding protein (MBP)-C/EBP fusion protein was expressed in
Bl 21 bacteria and purified with amylose resin as described previously.9 Two fragments of the cloned 5', 750-bp
lactoferrin promoter were generated by digestion with
KpnI/Xba and
Xba/BglII. The fragments were gel
purified, treated with calf intestinal phosphatase, and end-labeled
with 32P-ATP. Double-stranded oligonucleotides (30 bp)
containing the C/EBP consensus site of the lactoferrin promoter and
adjacent sequences were end-labeled with 32P ATP. A
standard reaction contained 1 ng labeled probe, 10 µg COS-1 nuclear
extract expressing either C/EBP or C/EBP, 2 µg pdIdC, and 4.5 µg BSA in a 20-µL volume. Competing cold oligonucleotides (shown
below at 10- and 100-fold molar excess) or antibodies (1 µg/µL)
were added where indicated. Electrophoresis was performed on a 4%
polyacrylamide gel at 30 mA.
Lactoferrin: 5' GGGTGTCTATTGGGCAACAGGGCGGC 3'
Mutant Lactoferrin: 5'
GGGTGTCTATCTGACGACAGGGCGGC
3'
Transient transfection assays.
Cell line U937 was grown in RPMI 1640 + 10% fetal bovine serum (FBS) + penicillin/streptomycin. Approximately 2 × 107 U937
cells were transfected by electroporation with 1 pulse at 320 V, 30 ms
with 25 µg of 230 Lac-Luc lactoferrin promoter reporter plasmid or C/EBP site mutant together with 2.5 µg of
cytomegalovirus (CMV)- -galactosidase vector in 500 µL RPMI + 10% FBS. Cells were harvested after 16 hours to measure
luciferase and -galactosidase activity. Transfection efficiency was
normalized for all samples according to -galactosidase activity.
Cell line U937 stably transfected with a zinc inducible C/EBP (p32)
expression vector or empty vector was grown in RPMI 1640 + 10% FBS + 800 µg/mL G418. Approximately 4 × 107 U937 (p32) or
empty-vector (PMT) myeloid cells were transfected by electroporation
with 1 pulse at 320 V, 30 ms with 40 µg (87 Lac-Luc)
lactoferrin promoter reporter plasmid and 4 µg of -galactosidase vector in 500 µL RPMI + 10% FBS. After electroporation, cells were
split in half and plated in 10 mL RPMI +10 FBS ± 100 µmol/L zinc-sulfate. Cells were harvested after 16 hours to measure luciferase activity. Aliquots were taken to monitor the induction of C/EBP p32
by Western blot analysis.
Electron microscopy.
Peripheral blood of C/EBP/ and control mice was
obtained from the retroocular venous plexus. A buffy coat was prepared in a 1-mL tuberculin syringe. The plasma was removed and the remaining cells were overlayered with 3% glutaraldehyde. The samples were fixed
in 1% osmium-tetraoxide and embedded in epon for ultrathin sectioning.
Sections were stained with uranylacetate and lead citrate and evaluated
with a JEOL transmission electron microscope (JEOL, Peabody, MA).
Continuous ferricytochrome c assay.
Superoxide anion production was measured via superoxide
dismutase-inhibitable reduction of ferricytochrome c18 on a
UVIKON 941 spectrophotometer equipped with a
temperature-controlled (37°C) cuvette holder. In brief, cells (2 × 106/mL) were incubated with cytochrome c (100 µmol/L) and PMA (100 ng/mL) in 1 mL of Hanks' balanced salt solution
(HBSS, pH 7.4). Reduced cytochrome c was measured on the basis of
increase in absorbance at 550 nm, and O2
generation was calculated by using an absorption coefficient of 21 mmol/L1 cm1.
| |
RESULTS |
The morphological changes in the neutrophils of C/EBP/
mice suggest that C/EBP transactivates target genes important in late myeloid differentiation.1
Figure 1
compares the ultrastructural morphology of peripheral blood
granulocytes from C/EBP/ and wild-type mice. The EM
study shows signs of cytoplasmic immaturity in C/EBP/
peripheral blood granulocytes. Rod-shaped tertiary granules are
completely missing, the ratio of primary to secondary granules is
increased, and the number of mitochondria/cell is higher in
C/EBP/ granulocytic cells.
View larger version (419K):
[in this window]
[in a new window]
| Fig 1.
Electron micrograph of a peripheral blood neutrophil from
a C/EBP/mouse (A and B) and a wild-type mouse (C). (A) The
C/EBP/ peripheral blood neutrophil shows signs of immaturity;
the absolute number of granules is reduced and tertiary,
bacilliform-shaped granules are missing. (B) Higher magnification of
middle section of C/EBP/ neutrophil: The ratio of the larger,
primary (electron-dense) granules (arrows) to the smaller less
electron-dense, secondary granules is increased. In the less mature
C/EBP/ neutrophils, most secondary granules appear
electron-lucent, most likely due to extraction by glutaraldehyde
fixation (arrowheads) as previously described.46 (C) For
comparison, mature wild-type granulocyte has multiple, small secondary
granules (arrows) and bacilliform tertiary granules (arrowhead).
|
|
A striking feature of C/EBP/ granulocytic cells is
their reduced superoxide production.1 To examine this
observation further, we determined the degree of this defect by using a
quantitative ferricytochrome c assay. We compared the superoxide
production of normal mouse bone marrow cells with
C/EBP/ bone marrow cells. Both samples contained
approximately 20% Gr-1-positive granulocytic cells. 2 × 106 C/EBP/ bone marrow cells did not
produce detectable superoxide anion levels. Under the same conditions,
the identical number of normal mouse bone marrow cells produced 1.3 ± 1.27 nmol superoxide anions/min. Granulocytes and monocytes
collected by peritoneal lavage at 12 and 72 hours after injection of
4% thioglycollate into the peritoneal cavity produced 5.95 and 6.5 nmol/min, respectively, in the wild-type and 1.09 and 0.38 nmol/min,
respectively, in C/EBP/ mice. Due to a defect in the
migratory function of C/EBP/ granulocytes, their
percentage in the peritoneal cavity of these mice was lower than was
found in the wild type (WT) at both 12 hours (C/EBP/:
56% v WT: 70%) and 72 hours (C/EBP/: 6%
v WT: 75%) (Table
2). Normal PMA activated monocytes are known to
generate approximately 1/3 the amount of
O2 compared with PMA-stimulated
granulocytes.19 The difference in cell composition in the
samples collected at 12 hours (56% v 70% granulocytes in
intraperitoneal [i.p.] lavage from
C/EBP/ v C/EBP+/+, respectively) would not
account for the difference in superoxide anion production between the
cells of the knock-out and wild-type mice. Interestingly, the
superoxide production of a population of 94% pure,
C/EBP/ monocytes/macrophages (2 × 106 cells) was only 0.38 nmol/min, indicating that the
defect may also affect C/EBP/ monocytes. (For
comparison: O2 production of normal
murine monocytes/macrophages [2 × 106]: 1 to 1.8 nmol/min20.)
View this table:
[in this window]
[in a new window]
|
Table 2.
Superoxide Anion Production by 2 × 106
Wild-Type and C/EBP/ Cells Collected From Either the Bone
Marrow or Peritoneal Cavity (12 or 72 hours after intraperitoneal
injection of 4% thioglycollate)
|
|
Because the NADPH oxidase system is mainly responsible for superoxide
production in phagocytic cells, we examined the expression of its
components. Northern blot analysis showed that the expression of the
murine gp91 phox gene is not reduced in the monocyte-depleted bone
marrow of C/EBP/ mice (Fig
2A, right panel). Semiquantitative RT-PCR studies with bone marrow
cells from mutant and wild-type animals also showed no difference for
the other members constituting the NADPH oxidase complex: p22 phox, p40
phox, p47 phox, p67 phox (Fig 2A, left panel) as well as rac-1 and -2 (Fig 2B).21-26 Protein expression of gp91 phox and p47 phox
was measured by Western blot analysis in wild-type and
C/EBP/ granulocytes/monocytes (Fig 2C). Cells
collected from the peritoneal cavity of 4 wild-type and 4 C/EBP/ mice at either 12 or 72 hours after the
intraperitoneal injection of 4% thioglycollate were pooled at each
time point to determine the mean number of granulocytes and monocytes
and to extract protein. Gp 91 phox was found to be normally expressed in C/EBP/ granulocytes/monocytes collected at 12 hours. At 72 hours the level of gp 91phox expression was higher in the
C/EBP/ sample. This sample contained 94% monocytes as
opposed to only 6% in the wild type. The differences observed could
result from a higher expression of gp91phox in monocytes/macrophages.
These experiments were repeated 3 times and each demonstrated that the protein expression of p47phox was considerably reduced in
C/EBP/ phagocytes collected at either 12 or 72 hours
(Fig 2C). This effect was most prominent in the sample collected at 12 hours, in which the majority of collected cells were granulocytes:
wild-type, 70%; C/EBP/, 56%.
View larger version (165K):
[in this window]
[in a new window]
| Fig 2.
(A, right) Northern blot analysis of gp91 phox expression
from C/EBP/ and wild-type bone marrow cells. RNA from NIH 3T3
fibroblasts was used as negative control. Gp91 phox expression was not
reduced in C/EBP/ bone marrow cells. Hybridization with a beta
actin probe was used as a control for equal loading of samples. (A,
left) RT-PCR assays to determine expression of the p22 phox, p40 phox,
p47 phox, p67 phox and (B) rac-1 and -2 genes. Primers for GAPDH were
used to test the integrity of the cDNAs. All genes were expressed in
both wild-type and C/EBP/ bone marrow cells. (C) Western blot
comparing the protein expression of gp91 phox and p47 phox in wild-type
and C/EBP/ phagocytes collected at either 12 or 72 hours after
intraperitoneal injection of 4% thioglycollate into the peritoneal
cavity of wild type and C/EBP/ mice. The mean percentage of
granulocytes and monocytes in the samples were at 12 hours: Wild-type,
70/30; C/EBP/, 56/44 and at 72 hours: Wild-type, 75/25;
C/EBP/, 6/94. GAPDH expression was a control for equal
loading. The reduction of p47 phox expression was found in 3 independent experiments. The figure depicts the results of a
representative experiment.
|
|
To elucidate further the molecular defects in antimicrobial activity of
C/EBP/ animals, we tested the cathelin protein family
that is important for the generation of antibacterial peptides. The
peptides CRAMP1 and CRAMP2, both derived from cathelin-related protein
(MCRP), have bactericidal activity, especially against gram-negative
bacteria, like Pseudomonas aeroginosa.15,27 Northern blot
analysis shows that the 1-kb mRNA of the cathelin-related protein is
virtually absent in C/EBP/ bone marrow in comparison to a very strong expression in wild-type mice
(Fig 3). Also, the expression of a second
murine cathelin homolog (B9 protein) was reduced in the
C/EBP/ bone marrow (Fig 3). This protein is normally
expressed in murine promyelocytes.28
View larger version (48K):
[in this window]
[in a new window]
| Fig 3.
Lack of expression of cathelin proteins. First panel
shows Northern blot of C/EBP/ and wild-type bone marrow cells
examined for expression of MCRP. Second panel shows that the lanes were
balanced for intact RNA by reprobing Northern blot with -actin.
Third panel displays RT-PCR for murine cathelin homolog B9, and the
fourth panel assures that cDNA were intact by showing their equal
expression of GAPDH. Both genes were markedly diminished in their
expression in bone marrow cells from C/EBP/ mice.
|
|
C/EBP/ granulocytic cells were shown to exhibit an
impaired migration.1 Expression of receptors for both
interleukin-8 and N-formyl-methionyl-leucyl phenylalanine
(fMLP) are required for normal granulocytic
migration.29-31 Therefore, we examined the expression of
these receptors by RT-PCR. Both receptors were expressed in
granulocytic cells of C/EBP/ mice isolated 4 hours after i.p. thioglycollate injection (data not shown).
Consistent with the morphological conservation of primary granules in
C/EBP/ granulocytic cells as observed by
electronmicroscopy, RT-PCR showed that the primary granule proteins,
myeloperoxidase and cathepsin G, were expressed in the bone marrow
cells (Fig 4A). The slightly stronger
signal detected in C/EBP/ bone marrow most likely
reflects myeloid hyperplasia. This notion is reinforced by the
increased number of myeloperoxidase (MPO)-positive bone marrow cells
seen with MPO immunohistochemistry (data not shown).
View larger version (105K):
[in this window]
[in a new window]
| Fig 4.
(A) Expression analysis of MPO and cathepsin G mRNAs by
RT-PCR. (B) Northern blot analysis for lactoferrin, neutrophil
gelatinase, and collagenase mRNA expression.
|
|
A hallmark of late myeloid differentiation is the expression of
secondary (specific) granules containing lactoferrin, neutrophil gelatinase, neutrophil collagenase, and transcobalamin I32
and tertiary (gelatinase) granules defined by their high concentration of gelatinase. Expression of the secondary granule proteins is at least
in part transcriptionally controlled.33 In addition, the
downregulation of the binding activity of CCAAT displacement protein
(CDP) has been implicated in their coordinate expression.34 Northern blot analysis showed the complete absence of lactoferrin and
gelatinase mRNA in C/EBP/ bone marrow. The mRNA level
of neutrophil collagenase was considerably reduced (Fig 4B).
Therefore, we investigated whether the lactoferrin promoter is a direct
target for C/EBP. We first performed electromobility shift assays
with 2 large fragments (750 to 300) and (300 to +39) of the lactoferrin promoter. Recombinant MBP-C/EBP bound to the
proximal, but not the upstream fragment (data not shown). The proximal
fragment contains a predicted C/EBP site at position 55. We
designed a double-stranded oligonucleotide representing this putative
C/EBP site which is conserved between mouse and humans.35
We expressed C/EBP and C/EBP protein in cos-1 cells and used 5 µg nuclear extract for the binding assay.
Figure 5 shows that C/EBP and
C/EBP bound specifically to the site. Binding was
competed by cold self, but not mutated oligonucleotide. The binding
complexes were supershifted by specific antisera against C/EBP and
C/EBP, respectively. A 32P-ATP-labeled
oligonucleotide mutated at the binding site did not bind the C/EBP
proteins (Fig 5).
View larger version (74K):
[in this window]
[in a new window]
| Fig 5.
EMSA demonstrating binding of C/EBP and C/EBP to
the putative C/EBP site at position 55 of the lactoferrin promoter.
Bars point to binding of either C/EBP (lanes 2 through 7), or
C/EBP complex (lanes 9 through 14) to double-stranded
32P ATP-labeled oligonucleotide- containing
C/EBP site (-55) in lactoferrin promoter. Binding is specifically
competed by cold oligonucleotides (lanes 3, 4 and 10, 11), but not by
mutated oligonucleotides (lanes 5, 6 and 12, 13). The complexes did not
bind to labeled mutated oligonucleotides (lanes 7 and 14). Both
C/EBP and C/EBP were supershifted by specific antisera (lanes 8 and 15, respectively).
|
|
The proximal promoter fragment (230 to +39) of lactoferrin that
contained the putative C/EBP site was fused to a luciferase reporter
gene. This construct was 50-fold more active than empty vector when
transiently transfected into U937 cells
(Fig 6A). Mutation of the putative C/EBP
site reduced this activity by 35% (Fig 6A). Furthermore, an 87-bp
lactoferrin promoter-reporter construct was transiently transfected
into U937 cells that had been engineered so that they could be induced
to overexpress C/EBP because a Zn-inducible C/EBP expression
vector was stably integrated into the cells (Fig 6B). Reporter gene
activity was more than 3-fold greater in these U937 cells
overexpressing C/EBP compared with uninduced U937 cells, suggesting
indirectly that C/EBP is a positive regulator of the lactoferrin
promoter in myeloid cells (Fig 6C).
View larger version (65K):
[in this window]
[in a new window]
| Fig 6.
(A) Effect of mutation of C/EBP site (55) on
lactoferrin promoter activity in U937 cells. The 230-bp lactoferrin
promoter luciferase (Lac-Luc) reporter either with or without a
mutation at the C/EBP site as well as -galactosidase plasmid were
transfected into U937 cells. After 16 hours, cells were harvested to
determine luciferase activity. Relative light units (RLU) were
normalized for -galactosidase activity. Data shown represent mean ± standard deviation of 3 independent experiments. (B) Western blot
for C/EBP expression in U937 cells stably integated with either
zinc-inducible C/EBP expression vector or empty expression vector
(PMT). Addition of 100 µmol/L zinc-sulfate strongly induces C/EBP
protein (labeled p32). (C) U937 cells containing either a stably
integrated, zinc-inducible C/EBP expression vector (labeled
C/EBP) or empty vector (PMT, control) were transiently transfected
with either the 87 lactoferrin promoter reporter plasmid (labeled
87 Lac-Luc) or empty vector pGL 3basic. After
transfection, half of the cells were treated with 100 µmol/L zinc
( ) either to induce expression of C/EBP or control for a possible
nonspecific zinc effect on promoter activity in the case of U937 with
integrated empty vector. Half of the cells were not treated with zinc
( ) and used to determine the basal activity of the 87 Lac-Luc
plasmid in U937/C/EBP and U937/PMT. Data represent mean and standard
deviation of 3 independent experiments.
|
|
| |
DISCUSSION |
In this study, we examined the expression of a number of
myeloid-specific genes in C/EBP/ mice to elucidate
further the molecular basis of their phenotype. Although superoxide
production is significantly reduced in phagocytes of
C/EBP/ mice, we found a normal gp91 phox mRNA
expression and no apparent lack of p22, p40, p47, and p67 phox, rac-1,
and -2 expression, the major components of the NADPH oxidase
complex.21-26 Western blot analysis did not show a
decrease of gp91phox protein expression. This finding is consistent
with our Northern blot data showing the equal expression of gp91phox
mRNA in C/EBP/ and wild-type bone marrow. p47 phox protein expression, however, was considerably reduced in
C/EBP/ granulocytes/monocytes. The phosphorylation of
p47phox is essential for the assembly of the NADPH oxidase and its
translocation to the plasma membrane.36 The reduction of
p47phox levels may contribute to the decreased capacity of
C/EBP/ phagocytes to produce superoxide. The
discrepancy beween similar p47phox mRNA expression in wild-type and
knock-out as measured by RT-PCR and reduced p47phox protein expression
in C/EBP/ granulocytes/monocytes is most likely due to
the technical limitations of RT-PCR to detect quantitative changes.
Recent reports of the expression of C/EBP in murine monocytes12 are consistent with our finding that their
capacity to produce superoxide is also reduced.
The normal expression of the gp91phox gene in C/EBP/
mice contrasts to its absence in the granulocytes of
PU.1/ mice.36 The gp91 phox gene is known to
be negatively regulated by CDP and was recently shown to be positively
regulated by PU.1.37,38 The expression of the gp91phox gene
in C/EBP/ mice not only implies that C/EBP is not
essential for its expression but, more interestingly, suggests that the
mature fraction of C/EBP/ granulocytic cells probably
lacks the repressive binding activity of CDP. The CDP binding activity
is normally downregulated during granulocytic
differentiation.37 The gp91 phox promoter has 4 binding
sites for CDP and the protein competes with activating factors for
binding to the promoter.39 Overexpression of CDP in
differentiating myeloid cells silences the gp 91 phox
promoter.37 The downregulation of CDP has recently been
implicated in the coordinate upregulation of secondary granule
proteins.34,40 The absence of lactoferrin and gelatinase
mRNA in C/EBP/ mice places the maturation arrest of
C/EBP/ granulocytic cells between gp91phox, and the
secondary, respectively tertiary granule proteins. We conclude that in
addition to the downregulation of CDP, positive regulators are critical
for the expression of secondary granule protein genes. Alternatively,
different forms of CDP negatively regulate the gp91phox and the
secondary granule protein genes.
Because myeloid leukemia cell lines express CDP binding
activity,41 we omitted the CDP binding site at position
880 and potential other CDP sites in the upstream lactoferrin
promoter, allowing us to study positive regulators of the lactoferrin
promoter in cells which do not express lactoferrin. The reduced
activity of the C/EBP site (55) mutant indicates that C/EBP
proteins are involved in the regulation of the lactoferrin promoter.
Furthermore, overexpression of C/EBP in U937 cells increases by
3-fold the already high promoter activity of the proximal 87-bp
construct, indicating that C/EBP can modulate the promoter activity.
Likewise, Zn-inducible overexpression of C/EBP in U937 cells rapidly
induces the accumulation of lactoferrin mRNA (data not shown). Our in vitro lactoferrin promoter studies, however, do not explain the complete absence of lactoferrin expression in C/EBP/
mice. The proximal 87 bp of the lactoferrin promoter contain at least 2 other binding sites for transcription factors involved in myeloid gene
regulation: PU.1 and Sp1.13 Lactoferrin expression is also absent in granulocytes of PU.1/ mice.36
Possibly, 2 or more factors are cooperating in the positive regulation
of the lactoferrin promoter in vivo. We hypothesize that the lack of
one of these could prevent the assembly of an active complex and
thereby render all contributing factors essential.
Our studies using the C/EBP/ mouse places C/EBP
downstream of C/EBP. Because C/EBP/ mice express
C/EBP in their bone marrow cells, C/EBP alone is not sufficient
for lactoferrin expression in vivo. Interestingly, the cell line U937
can be driven to express lactoferrin by overexpression of C/EBP,
which, however, also leads to an increase in C/EBP
expression.8 Taken together, C/EBP most likely directly
contributes to the transcriptional activation of the lactoferrin
promoter in vivo.
Secondary granule protein deficiency was reported as a rare genetic
disorder in humans.42 The patients are susceptible to infections, mainly with gram-positive organisms. Secondary granule protein deficiency probably contributes to the complex phenotype of
C/EBP/ mice. Nevertheless, the absence of the potent
bacteriocidal peptides CRAMP1 and 2 are also probably extremely
important for the phenotype of C/EBP/ mice. The
Northern analysis shows that the mRNA encoding cathelin-related protein
is highly abundant in normal murine bone marrow. Because murine
granulocytes lack defensins,43 cathelins constitute a major
source of bactericidal peptides in murine granulocytes. Their
predominant activity against gram-negative bacteria matches the
infectious spectrum in C/EBP/ mice.15
Interestingly, the promoter of the human cathelin homolog Fall 39 has a
C/EBP binding site at position 154.44,45 This raises
the possibility of a direct involvement of C/EBP in the transcriptional regulation of the cathelin-related protein. Enhanced expression of C/EBP might offer a unique approach to augment the
ability of an individual to fight potentially serious infections.
| |
ACKNOWLEDGMENT |
We thank Dr Robert Lehrer for helpful and very thoughtful discussions
and Kai Chien for excellent technical assistance.
| |
FOOTNOTES |
Submitted December 3, 1998; accepted June 14, 1999.
Supported in part by the following grants: NIH-C/EBP, NIH-Genetic
Core, Lichtenstein for Leukemia Research, Parker Hughes Grant, and C. and H. Koeffler Grant. W.V. was supported by a Grant of the Deutsche Forschungsgemeinschaft.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to H. Phillip Koeffler, MD, Cedars-Sinai
Medical Center, Burns and Allen Research-Institute, UCLA School of
Medicine, Davis Research Bldg, Room D 5066, 8700 Beverly Blvd, Los
Angeles, CA 90048.
| |
REFERENCES |
1.
Yamanaka R, Barlow C, Lekstrom-Himes, Castilla LH, Liu PP, Eckhaus M, Decker T, Wynshaw-Boris A, Xanthopoulos K:
Impaired granulopoiesis, myelodysplasia and early lethality in CCAAT/enhancer binding protein -deficient mice.
Proc Natl Acad Sci USA
94:131187, 1997
2.
Zhang DE, Zhang P, Wang N-D, Hetherington CJ, Darlington GJ, Tenen D:
Absence of granulocyte colony-stimulating factor signaling and neutrophil development in CCAAT enhancer binding protein -deficient mice.
Proc Natl Acad Sci USA
94:569, 1997[Abstract/Free Full Text]
3.
Landschultz WH, Johnson PF, Adashi EY, Graves BJ, McKnight SL:
Isolation of a recombinant copy of the gene encoding C/EBP.
Genes Dev
2:786, 1988[Abstract/Free Full Text]
4.
Williams PW, Cantwell CA, Johnson PF:
A family of C/EBP related proteins capable of forming covalently linked leucine zipper dimers in vitro.
Genes Dev
5:1553, 1991[Abstract/Free Full Text]
5.
Lekstrom-Himes J, Xanthopoulos K:
Biological role of the CCAAT Enhancer-binding protein family of transcription factors.
J Biol Chem
44:28545, 1998
6.
Osada S, Yamamoto H, Nishihara T, Imagawa M:
DNA binding specificity of the CCAAT/enhancer-binding protein transcription factor family.
J Biol Chem
271:3891, 1996[Abstract/Free Full Text]
7.
Radomska HS, Huettner CS, Zhang P, Cheng T, Scadden DT, Tenen DG:
CCAAT enhancer binding protein alpha is a regulatory switch sufficient for induction of granulocytic development from bipotential myeloid progenitors.
Mol Cell Biol
18:4301, 1998[Abstract/Free Full Text]
8.
Antonson P, Stellan B, Yamanaka R, Xanthopoulos KG:
A novel human CCAAT/enhancer binding protein gene, C/EBP is expressed in cells of lymphoid and myeloid lineages and is localized on chromosome 14q11.2 close to the T-cell receptor / locus.
Genomics
35:30, 1996[Medline]
[Order article via Infotrieve]
9.
Chumakov AM, Grillier I, Chumakowa E, Chih D, Slater J, Koeffler HP:
Cloning of the novel human myeloid-cell-specific C/EBP transcription factor.
Mol Cell Biol
17:1375, 1997[Abstract]
10.
Morosetti R, Park DJ, Chumakow AM, Grillier I, Shiohara M, Gombart AF, Nakamaki T, Weinberg K, Koeffler HP:
A novel, myeloid transcription factor, C/EBP epsilon, is upregulated during granulocytic, but not monocytic differentiation.
Blood
90:2591, 1997[Abstract/Free Full Text]
11.
Yamanaka R, Kim G-D, Radomska HS, Lekstrom-Himes J, Smith LT, Antonson P, Tenen D, Xanthopoulos K:
CCAAT/enhancer binding protein is preferentially upregulated during granulocytic differentiation and its functional versatility is determined by alternative use of promoters and differential splicing.
Proc Natl Acad Sci USA
94:6462, 1997[Abstract/Free Full Text]
12.
Williams SC, Yang D, Schwartz RC, Weiler SR, Ortiz M, Keller JR, Johnston PF:
C/EBP is a myeloid-specific activator of cytokine, chemokine, and macrophage colony-stimulating factor receptor genes.
J Biol Chem
273:13493, 1998[Abstract/Free Full Text]
13.
Johnston JJ, Rintels P, Chung J, Sather J, Benz EJ, Berliner N:
Lactoferrin gene promoter: Structural integrity and nonexpression in HL60 cells.
Blood
79:2998, 1992[Abstract/Free Full Text]
14.
Picard V, Ersdal-Badju, Lu Aiqin, Bock SC:
A rapid and efficient one-tube PCR-based mutagenesis technique using Pfu DNA Polymerase.
Nucleic Acids Res
22:2587, 1994[Abstract/Free Full Text]
15.
Gallo RL, Kim KJ, Bernfield M, Kozak CA, Zanetti ML, Merluzzi R, Gennaro R:
Identification of CRAMP, a cathelin-related antimicrobial peptide expressed in the embryonic and adult mouse.
J Biol Chem
272:13088, 1997[Abstract/Free Full Text]
16.
Bjoergvinsdottir H, Zhen L, Dinauer MC:
Cloning of murine gp91 phox cDNA and functional expression in a human X-linked chronic granulomatous disease cell line.
Blood
87:2005, 1996[Abstract/Free Full Text]
17.
Babior MB:
NADPH Oxidase: An update.
Blood
93:1464, 1999[Free Full Text]
18.
Cohen HJ, Chovaniec ME:
Superoxide generation by digitonin-stimulated guinea pig granulocytes. A basis for a continuous assay for monitoring superoxide production and for the study of the activation of the generating system.
J Clin Invest
61:1081, 1978
19.
Yagisawa M, Yuo A, Yonemaru M, Imajoh-Ohmi S, Kanegasaki S, Yazaki Y, Takaku F:
Superoxide release and NADPH oxidase components in mature human phagocytes: Corrrelation between functional capacity and amount of functional proteins.
Biochem Biophys Res Commun
228:510, 1996[Medline]
[Order article via Infotrieve]
20.
Tritsch G, Evans RL:
Graphic analysis of superoxide secretion by phagocytic leukocytes at different cell concentrations.
J Immunol Methods
160:59, 1993[Medline]
[Order article via Infotrieve]
21.
Sumimoto H, Nozaki M, Sasaki H, Takeshige K, Sakaki Y, Minakami S:
Complementary DNA for the mouse homolog of the small subunit of cytochrome beta 558.
Biochem Biophys Res Commun
165:902, 1989[Medline]
[Order article via Infotrieve]
22.
Jackson SH, Malech HL, Kozak CA, Lomax KJ, Gallin JI, Holland SM:
Cloning and expression of the mouse homologue of p47 phox.
Immunogenetics
39:272, 1994[Medline]
[Order article via Infotrieve]
23.
Mizuki K, Kadomatsu K, Hata K, Ito T, Fan QW, Kage Y, Fukumaki Y, Sakaki, Takeshige K, Sumimoto H:
Functional modules and expression of mouse p40(phox) and p67 (phox), SH3 domain-containing proteins involved in the phagocyte NADPH oxidase complex.
Eur J Biochem
25:573, 1998[Medline]
[Order article via Infotrieve]
24.
Leto Th.L, Adams AG, De Mendez:
Assembly of the phagocyte NADPH oxidase: Binding of Src homology 3 domains to proline rich targets.
Proc Natl Acad Sci USA
91:10650, 1994[Abstract/Free Full Text]
25.
Leusen JH, de Klein A, Hilarius PM, Ahlin A, Palmblad J, Smith CI, Diekman D, Hall A, Verhoeven AJ, Roos D:
Disturbed interaction of p21-rac with mutated p67phox causes chronic granulomatous disease.
J Exp Med
184:1243, 1996[Abstract/Free Full Text]
26.
Roberts AW, Kim C, Zhen L, Lowe JB, Kapur R, Petryniak B, Spaetti A, Pollock JD, Borneo JB, Bradford GB, Atkinson SJ, Dinauer MC, Williams DA:
Deficiency of the hematopoietic cell-specific Rho family GTPase Rac2 is characterized by abnormalities in neutrophil function and host defense.
Immunity
10:183, 1999[Medline]
[Order article via Infotrieve]
27.
Popesuva AE, Zinojeva MV, Visser JWM, Mark J, Zijlmans JM, Fibbe WE, Belyavsky V:
A novel murine cathelin-like protein expressed in bone marrow.
FEBS Lett
391:5, 1996[Medline]
[Order article via Infotrieve]
28.
Moscinski LC, Hill B:
Molecular cloning of a novel myeloid granule protein.
J Cell Biochem
59:431, 1995[Medline]
[Order article via Infotrieve]
29.
Cerreti DP, Nelson N, Kozlosky CJ, Morrissey Ph J, Copeland NG, Gilbert DJ, Jenkins NA, Dosik JK, Mock BA:
The murine homologue of the human interleukin 8 receptor B maps near the Ity-Lsh-Bcg disease resistance locus.
Genomics
18:410, 1993[Medline]
[Order article via Infotrieve]
30.
Chuntharapai A, Kim KJ:
Regulation of the expression of IL-8 receptorA/B by IL-8: Possible functions of each receptor.
J Immunol
155:2587, 1995[Abstract]
31.
Campbell JJ, Foxman EF, Butcher EC:
Chemoattractant receptor cross talk as a regulatory mechanism in leukocyte adhesion and migration.
Eur J Immunol
27:2571, 1997[Medline]
[Order article via Infotrieve]
32.
Borregaard N, Cowland JB:
Granules of human neutrophilic polymorphonuclear leukocytes.
Blood
89:3503, 1997[Free Full Text]
33.
Graubert T, Johnston J, Berliner N:
Cloning and expression of the cDNA of mouse neutrophil gelatinase: Demonstration of coodinate secondary granule protein gene expression during neutrophil maturation.
Blood
10:3192, 1992
34.
Khanna-Gupta A, Zibello T, Kolla S, Neufeld EJ, Berliner N:
CCAAT displacement protein (CDP/cut) recognizes a silencer element within the lactoferrin gene promoter.
Blood
90:2784, 1997[Abstract/Free Full Text]
35.
Teng CT, Liu Y, Yang N, Walmer D, Panella T:
Differential molecular mechanism of the estrogen action that regulates lactoferrin gene in human and mouse.
Mol Endocrinol
6:1969, 1992[Abstract/Free Full Text]
36.
Anderson KL, Smith KA, Pio F, Torbett BE, Maki RA:
Neutrophils deficient in PU.1 do not terminally differentiate or become functionally competent.
Blood
92:1576, 1998[Abstract/Free Full Text]
37.
Skalnik DG, Strauss EC, Orkin St H:
CCAAT displacement protein as a repressor of the myelomonocytic-specific gp91-phox gene promoter.
J Biol Chem
266:16736, 1991[Abstract/Free Full Text]
38.
Eklund EA, Jalava A, Kakar R:
PU.1, interferon regulatory factor 1, and interferon consensus sequence-binding protein cooperate to increase gp91phox expression.
J Biol Chem
29:13957, 1998
39.
Luo W, Skalnik D:
CCAAT displacement protein competes with multiple transcriptional activators for binding to four sites in the proximal gp91phox promoter.
J Biol Chem
30:18203, 1996
40.
Lawson ND, Khanna-Gupta A, Berliner N:
Isolation and characterization of the cDNA for mouse neutrophil collagenase: Demonstration of shared negative regulatory pathways for neutrophil secondary granule protein gene expression.
Blood
91:2517, 1998[Abstract/Free Full Text]
41.
Lievens PMJ, Donady JJ, Tufarelli C, Neufeld EJ:
Repressor activity of CCAAT displacement protein in HL60 myeloid leukemia cells.
J Biol Chem
270:12745, 1995[Abstract/Free Full Text]
42.
Boxer LA, Coates Th D, Haak RA, Wolach JB, Hoffstein S, Baehner RL:
Lactoferrin deficiency associated with altered granulocyte function.
N Engl J Med
307:404, 1982[Medline]
[Order article via Infotrieve]
43.
Eisenhauer PB, Lehrer R:
Mouse neutrophils lack defensins.
Infect Immun
60:3446, 1992[Abstract/Free Full Text]
44.
Gudmunsson H, Agerberth B, Odeberg J, Bergman Th, Olsson B, Salcedo R:
The human gene FALL 39 and processing of the cathelin precursor to the antibacterial peptide LL37 in granulocytes.
Eur J Biochem
238:325, 1996[Medline]
[Order article via Infotrieve]
45.
Sorensen O, Arnlijots K, Cowland JB, Bainton DF, Borregard N:
The human antibacterial Cathelicidin, hCAP-18, is synthesized in myelocytes and metamyelocytes and localized to specific granules in neutrophils.
Blood
90:2796, 1997[Abstract/Free Full Text]
46.
Ghadially FN:
Ultrastructural Pathology of the Cell and Matrix (ed 4). (vol 2). Oxford, UK, Butterworth-Heinemann Medical, 1997, p 684
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
Related Letter in Blood Online:
-
The mouse basophil, a rare and rarely recognized granulocyte
- Ann M. Dvorak
Blood 2000 96: 1616-1617.
[Full Text]
[PDF]
This article has been cited by other articles:
|
|
|
|
 
O. Soehnlein, A. Zernecke, E. E. Eriksson, A. G. Rothfuchs, C. T. Pham, H. Herwald, K. Bidzhekov, M. E. Rottenberg, C. Weber, and L. Lindbom
Neutrophil secretion products pave the way for inflammatory monocytes
Blood,
August 15, 2008;
112(4):
1461 - 1471.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. P. Ward, M. Mendoza-Meneses, P. W. Park, and O. M. Conneely
Stimulus-Dependent Impairment of the Neutrophil Oxidative Burst Response in Lactoferrin-Deficient Mice
Am. J. Pathol.,
April 1, 2008;
172(4):
1019 - 1029.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Agrawal, W.-K. Hofmann, N. Tidow, M. Ehrich, D. v. d. Boom, S. Koschmieder, W. E. Berdel, H. Serve, and C. Muller-Tidow
The C/EBP{delta} tumor suppressor is silenced by hypermethylation in acute myeloid leukemia
Blood,
May 1, 2007;
109(9):
3895 - 3905.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Bedard and K.-H. Krause
The NOX Family of ROS-Generating NADPH Oxidases: Physiology and Pathophysiology
Physiol Rev,
January 1, 2007;
87(1):
245 - 313.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Talebian, Z. Li, Y. Guo, J. Gaudet, M. E. Speck, D. Sugiyama, P. Kaur, W. S. Pear, I. Maillard, and N. A. Speck
T-lymphoid, megakaryocyte, and granulocyte development are sensitive to decreases in CBF{beta} dosage.
Blood,
January 1, 2007;
109(1):
11 - 21.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y.-J. Lee, L. C. Jones, N. A. Timchenko, D. Perrotti, D. G. Tenen, and S. C. Kogan
CCAAT/enhancer binding proteins alpha and epsilon cooperate with all-trans retinoic acid in therapy but differ in their antileukemic activities
Blood,
October 1, 2006;
108(7):
2416 - 2419.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Moriuchi and H. Moriuchi
Induction of Lactoferrin Gene Expression in Myeloid or Mammary Gland Cells by Human T-Cell Leukemia Virus Type 1 (HTLV-1) Tax: Implications for Milk-Borne Transmission of HTLV-1
J. Virol.,
July 15, 2006;
80(14):
7118 - 7126.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Theilgaard-Monch, L. C. Jacobsen, M. J. Nielsen, T. Rasmussen, L. Udby, M. Gharib, P. D. Arkwright, A. F. Gombart, J. Calafat, S. K. Moestrup, et al.
Haptoglobin is synthesized during granulocyte differentiation, stored in specific granules, and released by neutrophils in response to activation
Blood,
July 1, 2006;
108(1):
353 - 361.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Nakajima, N. Watanabe, F. Shibata, T. Kitamura, Y. Ikeda, and M. Handa
N-terminal Region of CCAAT/Enhancer-binding Protein {epsilon} Is Critical for Cell Cycle Arrest, Apoptosis, and Functional Maturation during Myeloid Differentiation
J. Biol. Chem.,
May 19, 2006;
281(20):
14494 - 14502.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. F. Gombart, U. Krug, J. O'Kelly, E. An, V. Vegesna, and H. P. Koeffler
Aberrant expression of neutrophil and macrophage-related genes in a murine model for human neutrophil-specific granule deficiency
J. Leukoc. Biol.,
November 1, 2005;
78(5):
1153 - 1165.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Theilgaard-Monch, L. C. Jacobsen, T. Rasmussen, C. U. Niemann, L. Udby, R. Borup, M. Gharib, P. D. Arkwright, A. F. Gombart, J. Calafat, et al.
Highly glycosylated {alpha}1-acid glycoprotein is synthesized in myelocytes, stored in secondary granules, and released by activated neutrophils
J. Leukoc. Biol.,
August 1, 2005;
78(2):
462 - 470.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. F. Gombart, N. Borregaard, and H. P. Koeffler
Human cathelicidin antimicrobial peptide (CAMP) gene is a direct target of the vitamin D receptor and is strongly up-regulated in myeloid cells by 1,25-dihydroxyvitamin D3
FASEB J,
July 1, 2005;
19(9):
1067 - 1077.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Kim, S. Sharma, Y. Li, E. Cobos, J. J. Palvimo, and S. C. Williams
Repression and Coactivation of CCAAT/Enhancer-binding Protein {epsilon} by Sumoylation and Protein Inhibitor of Activated STATx Proteins
J. Biol. Chem.,
April 1, 2005;
280(13):
12246 - 12254.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Shiohara, A. F. Gombart, Y. Sekiguchi, E. Hidaka, S. Ito, T. Yamazaki, H. P. Koeffler, and A. Komiyama
Phenotypic and functional alterations of peripheral blood monocytes in neutrophil-specific granule deficiency
J. Leukoc. Biol.,
February 1, 2004;
75(2):
190 - 197.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
O. G. Ribeiro, D. A. Maria, S. Adriouch, S. Pechberty, W. H. K. Cabrera, J. Morisset, O. M. Ibanez, and M. Seman
Convergent alteration of granulopoiesis, chemotactic activity, and neutrophil apoptosis during mouse selection for high acute inflammatory response
J. Leukoc. Biol.,
October 1, 2003;
74(4):
497 - 506.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. D. Bjerregaard, J. Jurlander, P. Klausen, N. Borregaard, and J. B. Cowland
The in vivo profile of transcription factors during neutrophil differentiation in human bone marrow
Blood,
June 1, 2003;
101(11):
4322 - 4332.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Khanna-Gupta, T. Zibello, H. Sun, P. Gaines, and N. Berliner
Chromatin immunoprecipitation (ChIP) studies indicate a role for CCAAT enhancer binding proteins alpha and epsilon (C/EBPalpha and C/EBPepsilon ) and CDP/cut in myeloid maturation-induced lactoferrin gene expression
Blood,
May 1, 2003;
101(9):
3460 - 3468.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. F. Gombart, S. H. Kwok, K. L. Anderson, Y. Yamaguchi, B. E. Torbett, and H. P. Koeffler
Regulation of neutrophil and eosinophil secondary granule gene expression by transcription factors C/EBPepsilon and PU.1
Blood,
April 15, 2003;
101(8):
3265 - 3273.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B.-T. H. Truong, Y.-J. Lee, T. A. Lodie, D. J. Park, D. Perrotti, N. Watanabe, H. P. Koeffler, H. Nakajima, D. G. Tenen, and S. C. Kogan
CCAAT/Enhancer binding proteins repress the leukemic phenotype of acute myeloid leukemia
Blood,
February 1, 2003;
101(3):
1141 - 1148.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Q.-f. Wang and A. D. Friedman
CCAAT/enhancer-binding proteins are required for granulopoiesis independent of their induction of the granulocyte colony-stimulating factor receptor
Blood,
April 15, 2002;
99(8):
2776 - 2785.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Khanna-Gupta, T. Zibello, H. Sun, J. Lekstrom-Himes, and N. Berliner
C/EBPvarepsilon mediates myeloid differentiation and is regulated by the CCAAT displacement protein (CDP/cut)
PNAS,
July 3, 2001;
98(14):
8000 - 8005.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. F. Gombart, M. Shiohara, S. H. Kwok, K. Agematsu, A. Komiyama, and H. P. Koeffler
Neutrophil-specific granule deficiency: homozygous recessive inheritance of a frameshift mutation in the gene encoding transcription factor CCAAT/enhancer binding protein-{epsilon}
Blood,
May 1, 2001;
97(9):
2561 - 2567.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. A. Lekstrom-Himes
The Role of C/EBP{{varepsilon}} in the Terminal Stages of Granulocyte Differentiation
Stem Cells,
February 1, 2001;
19(2):
125 - 133.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
A. M. Dvorak
The mouse basophil, a rare and rarely recognized granulocyte
Blood,
August 15, 2000;
96(4):
1616 - 1617.
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Khanna-Gupta, T. Zibello, C. Simkevich, A. G. Rosmarin, and N. Berliner
Sp1 and C/EBP are necessary to activate the lactoferrin gene promoter during myeloid differentiation
Blood,
June 15, 2000;
95(12):
3734 - 3741.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION