|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 95 No. 1 (January 1), 2000:
pp. 128-137
HEMATOPOIESIS
Distinct signals control the hematopoiesis of lymphoid-related
dendritic cells
Anne Galy,
Indu Christopherson,
Guido Ferlazzo,
Guo Liu,
Hergen Spits, and
Katia Georgopoulos
From the Barbara Ann Karmanos Cancer Institute, Wayne State
University, Detroit, MI; Netherlands Cancer Institute, Amsterdam, The
Netherlands; Cutaneous Biology Research Center, Harvard Medical School,
Massachusetts General Hospital, Charlestown, MA.
 |
Abstract |
The molecular and cellular requirements for the development of
different populations of human dendritic cells (DC) were studied. Conditions were defined that support DC production from lymphoid progenitors but that fail to induce DC formation from peripheral monocytes. The production of these lymphoid-related DC was severely blocked when hematopoietic progenitors overexpressed Ik7, a mutant dominant-negative Ikaros protein. In contrast, Ik7 did not block the
formation of DC in conditions supporting the development of monocyte-derived DC. Furthermore, Ik7 did not block the formation of
monocyte/macrophages and enhanced granulopoiesis. One of the molecular
mechanisms mediated by Ik7 appears to be down-regulation of the
flt3-receptor mRNA. Thus, distinct signals control the formation of DC
demonstrating that some aspects of DC diversity are determined in part
by distinct molecular cues at the hematopoietic level. (Blood.
2000;95:128-137)
© 2000 by The American Society of Hematology.
| |
Introduction |
Dendritic cells (DC) are rare cells that are
principally involved in the presentation of antigen and stimulation of
lymphocytes.1 Variations among the tissue distribution of
DC and differences in their phenotype and function indicate the
existence of a heterogeneous population of DC (reviewed in reference
2). Recently, it has been recognized that various populations of DC in
mice or man are able to induce distinct types of immune
responses,3-5 prompting questions about the role of their
origin in determining functional heterogeneity. An important question
is how this heterogeneity arises at the developmental level.
Ample evidence suggests that DC receive an array of stimuli that can
change their activation, migration, or survival.6-9 Although some of these signals regulate DC development at relatively late stages, the molecules involved in the control of the early stages
of DC formation are not entirely well defined. Understanding this
process is complicated by the existence of several types of DC
precursors. Peripheral monocytes (CD14+
CD34 )10,11 and hematopoietic progenitors
(CD14CD34+)12,13 are both
able to generate DC. Yet, the development of the more primitive
hematopoietic progenitors into DC does not entirely overlap with that
of monocytes; therefore, it was suggested that different pathways of DC
hematopoiesis may exist.14
Lymphoid progenitors can give rise to the so-called lymphoid-related
DC. Lymphoid progenitors with a relatively high ability to commit
toward differentiation into lymphocytes but also capable of
differentiating into DC are found in the thymus or bone marrow (BM) of
mice and humans.15-18 In mice, the differentiation
requirements for lymphoid-related DC are distinguishable from those of
other DC as determined, in part, by cytokine responses and reliance on
relB proteins.19-21 Yet, the molecular requirements
controlling the hematopoiesis of lymphoid-related DC have not been
entirely defined. We previously identified a human BM lymphoid
progenitor cell of phenotype CD34+ Lin
CD10+ that differentiates into all classes of lymphocytes
(T, B, natural killer [NK] lymphocytes) in the appropriate
experimental systems.16 Multipotential clones with B cell,
NK cell, and DC differentiation potential exist in this lymphoid
progenitor population, which is markedly depleted of precursors for
monocytes, macrophages, or myeloid cells16 and is therefore
more endowed with distinct developmental options than peripheral blood
monocytes. Consequently, lymphoid progenitors and
monocytes appear to each represent a prototypical DC precursor and the
signals regulating their respective developmental programs remain to be defined.
Little is known of the molecules that regulate the early stages of DC
development but the zing finger DNA-binding transcription factor Ikaros
has been implicated in DC hematopoiesis in mice. Homozygous mice for an
Ikaros null allele have severe alterations in B- and NK lymphoid-cell
development accompanied by specific alterations in T-cell development
and a strong reduction in numbers of DC in lymphoid
organs.22 Deletions of the DNA-binding domain from the
mouse germline that generate an Ikaros mutation with dominant-negative properties (DN-/-) cause more serious
lymphoid and DC defects.23,24 Proteins produced by the
dominant-negative locus can interact and interfere with proteins
produced by the wild-type Ikaros locus or with other family
members and compromise their activity.25-27 Hematopoietic defects in DN-/-animals include a severe block in
lymphopoiesis and a general depletion of DC in lymphoid organs although
monocytes are abundantly present.22,24 Yet,
DN-/-animals have DC in the skin, suggesting that several
signaling pathways, in which Ikaros is differentially involved,
regulate DC development in vivo. The human equivalent of Ikaros
was cloned and is highly homologous to its murine
counterpart.28 Ikaros mRNA is detectable in human
CD34+ cells,29 suggesting that Ikaros proteins
may play a role in human hematopoiesis. Based on the high conservation
between mouse and human Ikaros28,30 and almost
complete identity in the DNA-binding region and protein interaction
domains, we reasoned that murine dominant-negative proteins would
interfere with human Ikaros family members. One of these
dominant-negative proteins, Ik7, is the product of gene targeting
deletion of exons 3 and 4 causing a strong reduction in the DNA-binding
ability of heterocomplexes formed between Ik7 and other members of the
Ikaros family of proteins through their C-terminal zing finger
modules.25 Therefore, we used Ik7 in an overexpression
system to test the role of Ikaros proteins in human hematopoiesis.
To determine the different cellular and molecular requirements of human
DC hematopoiesis, we established contrasting culture systems that could
distinguish between the development of lymphoid progenitors and of
monocytes. The differential dependence for Ik7 was demonstrated by
retroviral-mediated gene transfer of Ik7 in multipotential
CD34+ progenitors. Therefore, we conclude that DC formation
occurs along several pathways involving distinct cells and signals.
Thus, DC heterogeneity is in part intrinsically determined at the
hematopoietic level and this decision involves the intimate interaction
between Ikaros family members.
| |
Materials and methods |
Source of cells
Human adult BM cells were isolated either from rib fragments removed
from patients undergoing thoracic surgery or from the residual cells of
screen filters after BM transfusion. Whole blood from normal volunteers
was obtained from the American Red Cross, Detroit, MI. Mobilized
peripheral blood (MPB) samples were obtained from patients with
metastatic stage IV breast cancer after consent. All tissues were
obtained according to institutional guidelines. Mononuclear cells (MNC)
d < 1.077g/mL were prepared from blood or BM by centrifugation
through Ficoll (Pharmacia) and cells were cryopreserved with 10%
dimethyl sulfoxide in liquid nitrogen.
Isolation of CD34+ progenitor cell subsets by flow
cytometry sorting
Frozen BM MNC were thawed in the presence of DNAse (100 U/mL) and
heparin (10 U/mL) (Sigma, St Louis, MO) and spun over a Ficoll gradient
to remove dead cells. Lineage-positive (Lin+) B cells, T
cells, phagocytes, and erythrocytes were removed with magnetic beads
(sheep anti-mouse Ig magnetic beads, Dynal Inc., Lake Success, NY)
following incubation with mouse monoclonal antibodies (mAbs) against
CD40 (G28.5), CD2 (RPA2.1), CD32 (IV3), CD143C10, and
glycophorin A (10F7MN) (ATCC and kind gift from Dr G. Aversa, Novartis,
Vienna, Austria). Remaining Lin-depleted cells were incubated with
fluorochrome-conjugated mAbs: sulforhodamine (SR) anti-CD34 (PR3, kind
gift of Dr B. Hill, SyStemix Inc., Palo Alto, CA), fluorescein
isothiocyanate (FITC) anti-CD3 (7D6, Caltag, Burlingame, CA), FITC
anti-CD15 (PR9, kind gift of Dr B. Hill), FITC anti-CD19 (HIB19,
Pharmingen, San Diego, CA), and phycoerythrin (PE) anti-CD10 (HI10a,
Pharmingen). Propidium iodide (PI) (Sigma) (5 µg/mL) was added to
enable the detection of live and dead cells. Some cells were stained
with irrelevant mAbs or with positive markers conjugated with each of
the fluorochromes to serve, respectively, as negative or compensation
controls. Cells were sorted on a Vantage sorter (Becton Dickinson, San
Jose, CA) using an Argon laser tuned to 488 nm and a dye pump laser
tuned to 590 to 600 nm. Electronic gating was set to select cells that
are PI, FITC (Lin), and
CD34+, separating them into CD10+ and
CD10 cell subsets. Reanalysis of sort purity showed > 95% purity in the CD34+ Lin
CD10 cell population, whereas CD34+
Lin CD10+ cells, being rare (1%-0% of
CD34+ cells16), were typically 50% to 85%
pure. When indicated, CD34+ Lin
CD10+ cells were run again on the sorter using the same
settings and gates to obtain a highly purified cell population.
Isolation of blood monocytes
Plastic adherence of about 4 × 107 MNC in 75 cm2 tissue culture flasks (Corning Costar Corp., Oneonta,
NY) in Dulbecco's modified Eagle's medium (Gibco, Gaithersburg, MD)
supplemented with 10% fetal calf serum (FCS) (Hyclone, Logan, UT) for
2 hours, was used to isolate adherent cells. After washing, adherent
cells were further incubated overnight in the same medium before being
washed and detached by incubation in ice-cold Ca++
Mg++-free phosphate-buffered saline (PBS) for 10 to 20 minutes and tapping. Flow cytometric analysis showed > 95%
CD14+ expression in the resulting population.
Dendritic cell cultures
Subsets of CD34+ Lin cells
(CD10+ or CD10 cells) or monocytes were
cultured in 24-well plates (Corning) in RPMI-1640 medium (Gibco)
containing 10% FCS, penicillin streptomycin (100 U/mL and 100 µg/mL,
respectively), L-glutamine (2 mM), 2-mercaptoethanol (2-ME)
2 × 105 mol/L, and cytokines at 37°C 5%
CO2 for the indicated periods of time. The
cytokine-containing medium was changed by demidepletion twice a week.
Cytokines
The following human recombinant cytokines were used: flt3-ligand
(F), c-kit ligand (K), granulocyte/macrophage colony-stimulating factor (GM-CSF; Gm) (kind gift of Dr B. Hill, SyStemix Inc) (25 ng/mL each), interleukin (IL)-4(4) (100 UI/mL)
(kind gift of Dr H. Yssel, DNAX, Palo Alto, CA), recombinant tumor
necrosis factor (rTNF)- (T) (25 ng/mL), IL-1 b(1) and
IL-7(7) (10 ng/mL each) (R&D Systems, Minneapolis, MN).
Flow cytometric analysis
Nonspecific Fc receptor binding was blocked after saturation with 1 mg/mL human gamma globulin for 10 minutes (Gamimune, Miles, Eckhart,
IL). Negative controls included directly labeled IgG1 and IgG2a
irrelevant mAbs. Compensation controls and negative controls were used
to determine the boundaries of regions in 2-color dot plots such that > 98% of the cells would be contained in the respective regions.
Analysis was performed on live cells (PI) using the
PC Lysis software (Becton Dickinson). Cells were stained with the
following mAbs: PE anti-CD1a (HIT2) (Pharmingen), PE anti-CD83 (HB15A)
(Immunotech), FITC anti-CD14 (PR4, kind gift of Dr B. Hill, Systemix
Inc.), or anti-CD14 (3C10, ATCC) detected with PE-conjugated goat
anti-mouse Ig (Chemicon, Temecula, CA).
Allogeneic T-cell stimulation
Purified allogeneic blood T cells (0.5 to
1 × 105 cells/well) were prepared by negative
selection after removal of B cells and phagocytes by incubation with
G28-5 and IV.3 mAbs and panning on plastic dishes coated with goat
anti-mouse immunoglobulins (Sigma). Nonadherent cells were further
depleted with sheep anti-mouse IgG-coated beads (Dynal) following
incubation with mAbs to HLA-DR, CD19 (Caltag), CD14, and CD15. The
resulting cell population routinely contained > 98.5%
CD3+ T cells. Purified T cells were incubated for 6 days in
96-well microtiter plates (Corning) in RPMI-1640 medium with 10% FBS, antibiotics, glutamine, and 2-ME at 37°C, 5% CO2 with
variable percentages of irradiated APC (4000 cGy with a
Cs137 source, JL Shepherd, San Fernando, CA). During the
last 18 hours of T-cell cultures, 1 µCi of 3H thymidine
(DuPont NEN, Boston, MA) was added to each well to determine cellular
incorporation after harvesting cells on glass fibers and liquid
scintillation counting. Results are expressed as average counts per
minute (cpm) of triplicate wells ± SD. Secretion of IL-2
was measured at day 5 after removing an aliquot in the culture
supernatant fluid that was analyzed by human IL-2-specific enzyme-linked immunosorbent assay (ELISA) (CYTImmune Sciences, College
Park, MD) according to manufacturer's instructions.
Retroviral-mediated delivery of Ik7
A bi-cistronic retroviral vector was used to express murine Ik7 and
enhanced green fluorescence protein (EGFP) in human cells. Characteristics of the vector have been reported31,32 but
briefly Ik7 was cloned from pCDM8Ik1/2 into LZRS-IRES EGFP using
standard techniques33 and sequenced to confirm that the
vector was in-frame and correctly oriented. The control plasmid vector
LZRS-IRES EGFP lacking Ik7 insert was also prepared. Virus-producing
cells were prepared by transfection of the respective plasmids into
Ampho- NX cells (kind gift from Dr G. Nolan, Stanford University,
Palo Alto, CA) and puromycin selection. Control and Ik7-containing
virus stocks of equivalent titers, around 5 × 105
CFU EGFP/mL were used. Titers were determined by infection of HCT116
cells colon carcinoma cells with dilutions of virus stocks in the
presence of 8 µg/mL protamine sulfate and measurement of EGFP+ cells by flow cytometry at 488 nm on the FL1 channel
of a Facscan (Becton Dickinson).
Reverse transcriptase-polymerase chain reaction analysis
Total RNA (RNA isolator, Genosys) was reverse-transcribed with MMLV
(200 U/reaction, Promega) and random hexamer priming (1nM/reaction), and cDNA was amplified with Taq polymerase (Perkin Elmer) for 30 cycles
(94°C/1 min; 55°C/2 min; 72°C/1 min) (Biometra personal cycler, Tampa, FL) in the presence of 2.5 mM MgCl2 and 0.25 µM each of the HEX2F 5' CCCCCTGTAAGCGATA
3' and EX7R 5'
GATGGCTTGGTCCATCACGTGGGGA 3' Ikaros
primers.28 Reverse transcriptase-polymerase chain reaction (RT-PCR) products were transferred on a nylon membrane (Hybond) and
probed with a 32P-labeled Ikaros-1 cDNA probe cloned from
human thymus in our laboratory. Multiple isoforms of Ikaros are
amplified by RT-PCR with HEX2F and EX7R primers. The mutant Ik7 is
recognized by a specific 467 bp size. To amplify mRNA for flt3/STK or
IL-2R genes, we used, respectively, 1 µM of each of these primers,
STK3 5' AAAGCATCCCAGTCAATCAG 3' and
STK4 5' GGTATCCATCCGAGAAACAG 3',
IL2R-3 5' CCAGCCTACCAACCTCACTC
3', and IL2R-4 5'
TCCAGCCAGAAATACACACA 3'. In all experiments we
verified the integrity and correct amount of cDNA by amplifying 2
microglobulin or GAPDH transcripts.
Methylcellulose colony-stimulating assays
Sorted CD34+ cell subsets were cultured for 1 to 2 1/2
weeks at 37°C, 5% CO2, at the density of 1500 to 2000 cells per 35 × 10 mm dishes (Corning) in 1.5 mL Methocult H4431
methylcellulose complete with erythropoietin and lymphocyte-conditioned
medium (Stem Cell Technologies Inc., Vancouver). Colonies were counted microscopically and representative colonies were picked, spun on
slides, and stained with Giemsa to determine the nature of cells in the colony.
| |
Results |
Production of lymphoid-related DC
Lymphoid-related DC can be generated from the CD34+
Lin CD10+ lymphoid progenitors found in
human BM.16 Growth and differentiation signals supporting
DC development from these cells can be provided by the combination of
cytokines flt3-ligand+c-kit ligand+GM-CSF+IL-1 +IL-7 (FKGm17) in
the absence of stroma.29 These cytokines have not been
traditionally used to generate DC in vitro and it is not known how
other hematopoietic progenitors respond. We therefore divided
uncommitted CD34+ Lin hematopoietic
progenitor (Lin cells lack lineage-specific antigens
CD2, CD14, CD19, or CD15 to exclude myeloid or lymphoid-committed
cells) into 2 subsets: CD34+ Lin
CD10+ cells representing 4.7% ± 3.5% of
CD34+ Lin cells and CD34+
Lin CD10 cells accounting for the
rest of CD34+ cells, that is, about 95%, and compared
their DC differentiation potential in FKGm17. DC were identified by
morphology, large size as measured by the flow cytometric forward and
side scatter (FSC, SSC) parameters, expression of cell surface antigens
such as CD1a or CD83, which are relatively specific for DC in these
culture conditions,34 and lack of markers specific for
other hematopoietic lineages such as CD14, a marker normally expressed
on monocytes (reviewed in reference 2). We also tested for a hallmark
property of DC, which is the ability to stimulate the proliferation and IL-2 secretion of allogeneic T cells in mixed leukocyte reaction (MLR).35 This DC activity correlates well with expression
of CD1a or CD83 on the cells in culture36 (and our own observations).
A limited cellular expansion was observed in cultures of
CD34+ Lin CD10+ cells
treated with FKGm17 over 2 weeks (1 to 18-fold, n = 5) with cells
rapidly differentiating, increasing in size, and acquiring dendrites as
early as day 4. After about a week, most of the cells were dendritic,
floating as aggregates (Figure 1A), and
most cells had large FSC and SSC characteristics (Figure
2A, left bottom panel). Around days 11 to
14, cells expressed high levels of surface CD1a with background levels
of CD14 in a similar fashion as DC. Two separate experiments
representative of 4 illustrate that the progeny of CD34+
Lin CD10+ cells has functional activity
in MLR stimulating detectable T-cell responses at
stimulator-to-responder concentrations of about 2% to 3%, which are
typically in the range of activity displayed by "professional"
antigen-presenting cells like DC (Figure 2B). No myeloid cells or
macrophages were visually recognizable at any time in cultures
initiated with highly purified (double-sorted) CD34+
Lin CD10+ cells (as in Figures 1A and
2A). The rapid and relatively uniform differentiation of these cells
into CD1a+ CD14DC indicates their
potential for a rapid commitment into DC. It is consistent with a high
degree of commitment in this population as already demonstrated in
other assays for NK, B-, and T-cell lineages.16,37
View larger version (104K):
[in this window]
[in a new window]
| Fig 1.
Cultures in FKGm17.
Phase contrast photomicrograph (20 × ) shows cultures of
CD34+ Lin CD10+ cells (A)
and CD34+ Lin CD10
cells (B) in FKGm17 at day 11.
|
|
View larger version (45K):
[in this window]
[in a new window]
| Fig 2.
Phenotype and function of CD34+ cell subset
progeny.
(A) Flow cytometric analysis of various cultures of
hematopoietic progenitor cell subsets. CD34+
Lin CD10+ cells in FKGm17 (left panel),
or CD34+ Lin CD10
cells in FKGm17 (middle panel), or CD34+
Lin CD10 cells in FKGmT4 (right
panel) were analyzed 2 weeks after the start of culture. The top row
shows background values and the middle row shows the correlated
expression of FITC-CD14 and PE-CD1a markers. Numbers indicate the
percentage of cells in the respective regions. The bottom row shows
forward scatter (FSC) and side scatter (SSC) characteristics of the
cells. (B) Two representative and distinct experiments show the
stimulation of purified allogeneic T cells in MLR with irradiated
progenies of CD34+ Lin CD10+
cells (closed circle) or of CD34+ Lin
CD10cells (open square) in MLR. Proliferation (left
panel) was measured by 3H-thymidine incorporation and IL-2
secretion in the medium (right panel) by ELISA.
|
|
In contrast, parallel cultures of CD34+
Lin CD10 cells expanded
abundantly in FKGm17 (11 to 135-fold in 2 weeks, n = 4)
differentiating into myeloid cells with large granular cytoplasm
(Figure 1B) and into monocytes expressing CD14 as detected by flow
cytometry (Figure 2A, middle panel). Some adherent cells were found and
most cells were single rather than aggregated, unlike in cultures of
CD10+ cells (Figure 1A). An abundant population of
medium-sized blasts (intermediate FSC and SSC) was recognizable by flow
cytometry (Figure 2A, middle panel, bottom row). A few aggregates of
cells resembling DC were seen and flow cytometric analysis detected 2.1% ± 1.5% (n = 4) cells with a CD1a+
CD14DC phenotype. Because there were few DC in these
cultures, little T-cell stimulatory activity was detected (Figure 2B),
but further purification by cell sorting confirmed that DC produced in
these cultures were active antigen-presenting cells (data not shown). Such scarcity of DC contrasted with the prominence of DC in cultures of
CD34+ Lin CD10+ cells
stimulated with FKGm17 and with the relatively high proportions of DC
that can be obtained in general by stimulating hematopoietic progenitors with cytokines other than FKGm17. The cytokines flt3-ligand + c-kit ligand + GM-CSF + TNF- + IL-4 (FKGmT4) have been effective at inducing DC differentiation of total CD34+ cells of
adult BM or of mobilized peripheral blood.11 These cytokines support the development of monocytes and also of their precursors because the cytokines TNF-+ GM-CSF+ c-kit ligand have been shown to support the CD14-dependent pathway of DC
differentiation14,38 and IL-4 induces the phenotypic
conversion of monocyte into DC.39 With these cytokines,
CD34+ Lin CD10 cells
produced about 25% to 40% CD1a+ CD14
DC thus demonstrating that this subset of CD34+
Lin CD10 cells is not devoid of
DC precursors (Figure 2A, right panel). These data suggest that DC
formation by hematopoietic progenitors is induced by distinct cytokine
signals. From CD34+ Lin
CD10+ cells, which are highly enriched in lymphoid
precursors,16 the FKGM17 cytokine signals induce DC
differentiation effectively.
Monocytes do not become DC in response to signals supporting
lymphoid-related DC
Peripheral blood monocytes, which represent prototypical DC
precursors, undergo a rapid phenotypic and functional conversion into
DC when cultured with cytokines such as FKGmT4 (Figure
3A and B). This in vitro differentiation
appears to involve almost all cells that acquire DC markers
synchronously.11 So, like lymphoid progenitors, blood
monocytes constitute a highly enriched, homogeneous, and rapidly
committing population of DC precursors. We examined if mature blood
monocytes could differentiate into DC with signals supporting
lymphoid-related DC development. The FKGm17 cytokines did not induce
the morphologic or phenotypical conversion of monocytes that is typical
of DC at any time point of culture (tested up to 3 weeks). Cells were
adherent and some resembled macrophages (not shown). Flow cytometric
analysis showed that most cells remained CD14 (Figure 3A) and these
cells were poor stimulators in MLR (Figure 3B). Monocytes from the
blood of 2 separate normal blood donors and a cancer patient treated with granulocyte colony-stimulating factor gave the same results. We
therefore conclude that the signals provided by the FKGm17 cytokines
are not able to trigger the DC phenotype and the functional conversion
of peripheral monocytes. Nevertheless, in the early hematopoietic
progenitor compartment, certain cells can respond to these signals by
differentiating into DC as well as cells responding to signals inducing
monocyte-derived DC formation. The heterogeneity in response that is
documented at the progenitor level is lost at the monocytic level, thus
indicating the existence of 2 distinct developmental pathways supported
by distinct signals. Two distinct prototypical DC precursors exist.
Lymphoid progenitors (CD34+ Lin
CD10+ BM cells) respond to cytokines such as FKGm17 and
differentiate along a lymphoid-related DC developmental pathway.
Monocytes and their precursors respond efficiently to cytokines such as
FKGmT4 and produce DC along a myeloid-related developmental pathway.
View larger version (31K):
[in this window]
[in a new window]
| Fig 3.
FKGm17 cytokines do not trigger DC conversion in
monocytes.
(A) This representative experiment of 3 shows the flow cytometric
correlation of CD14 and CD1a markers in cultures of peripheral blood
monocytes in FKGm17 or FKGmT4. (B) Proliferation of allogeneic T cells
in MLR measured by 3H-thymidine incorporation after
stimulation with various percentages of monocyte-derived DC generated
in FKGmT4 (closed squares) and monocyte-derived cells obtained in
FKGm17 (open circles).
|
|
Ik7 blocks lymphoid-related DC hematopoiesis
To further delineate the pathways that generate different DC at the
molecular level, we examined the molecular requirements involved in DC
differentiation from hematopoietic progenitors. A few molecules have
been implicated in the formation of DC and a good candidate is Ikaros,
a zing finger transcription factor critical for the development of
murine DC in lymphoid organs but not essential for the development of
skin DC or of monocytes.23 Because Ikaros mRNA is found in
human CD34+ cells,29 we assessed whether Ikaros
was important for the production of different DC populations by testing
the effects of a dominant negative Ikaros protein, Ik7. This mutant
form of Ikaros reduces the DNA-binding and transcriptional activity of
wild-type Ikaros proteins and of Ikaros family members25-27
and blocks lymphopoiesis and DC development when introduced in the
germline of mice.23 Retroviral-mediated gene transfer with
LZRS-based vectors was chosen to overexpress Ik7 in CD34+
BM cells, based on prior successful overexpression of a
dominant-negative transcription factor, Id3, into thymic
CD34+ cells.32 We constructed the bi-cistronic
LZRS-Ik7-IRES-EGFP retroviral vector encoding Ik7 and EGFP as well as
the control vector LZRS-IRES-EGFP encoding EGFP only. Total BM
CD34+ cells were infected with the respective viruses after
a short culture in IL-3, c-kit-ligand, and IL-6 as described for the
retroviral-mediated infection of primitive BM hematopoietic progenitors
with multilineage clonogenic potential.40 After infection,
cells were stained with anti-CD34 mAbs to re-isolate infected
hematopoietic progenitors and to test their differentiation potential
(Figure 4A). Controls consisted of
CD34+ EGFP cells retrieved from cultures
incubated with Ik7 or with control viruses. RT-PCR analysis confirmed
the presence of the Ik7 transcript specifically in CD34+
EGFP+ cells isolated from the Ik7-infected culture (Figure
4B). The DC differentiation potential of these different cell
populations was tested in response to different signals.
View larger version (29K):
[in this window]
[in a new window]
| Fig 4.
Analysis of Ik7-infected CD34+ cells.
(A) Representative flow cytometric analysis of CD34+ cells
cultured for a total of 4 days and having been infected with virus for
2 days (pre-sort). Reanalysis of CD34+
EGFP and EGFP+ cells from these cultures
(CD34+ E and CD34+
E+), which are being used to assay DC hematopoiesis. (B)
RT-PCR analysis of Ikaros mRNA in the sorted CD34+ cell
populations showing the presence of the multiple endogenous Ikaros
isoforms Ik1 (888 bp), Ik2/3 (630 bp), Ik4 (500 bp), and the 467 bp-specific product corresponding to Ik7. (C) Detection of DC activity
by MLR. Stimulator cells were obtained after Ik7 infection and culture
in FKGm17 of CD34+ EGFP+ cells (closed squares)
or CD34+ EGFP cells (open diamonds) and
the response of purified T cells was measured as CPM after
3H-thymidine incorporation.
|
|
Progenitors were stimulated by the cytokines FKGm17 to support
lymphoid-related DC development. Cells having the typical
characteristics of DC were not visible in Ik7-infected cultures
(Figures 4C and 5A and B). MLR showed an almost complete lack of T-cell
stimulatory activity by the progeny of Ik7-infected CD34+
cells, whereas the progeny of uninfected CD34+
EGFP cells contained DC activity (Figure 4C). Flow
cytometry only detected 0.2% to 0.7% cells expressing the DC markers
CD1a or CD83 above background in cultures of Ik7-infected cells (Table 1). Both markers were used to identify DC
separately in the same experiments. The small number of cells
expressing CD1a or CD83 often expressed lower levels of markers and may
not represent true DC. Other characteristics of DC such as CD11c
expression (not shown) or large FSC and SSC (Figure
5B) were markedly absent even at late time
points of culture (day 17). In contrast, the progeny of control
virus-infected CD34+ EGFP+ cells contained
spiky DC often aggregating in typical clusters and flow cytometry
detected the presence of 1% to 4% CD1a+ or
CD83+ cells (Figure 5A and B). Using flow cytometry, it was
determined that Ik7-infected cultures in FKGm17 contained about 5 times
less DC based on proportion of cells and produced about one third of the absolute numbers of DC in control cultures. The proportion and
absolute numbers of DC were respectively 16% ± 8% and 34% ± 15% (n = 4) of controls (Table 1). These differences between Ik7
cultures and their controls were statistically significant (P < 0.01, paired t test). The absence of DC in
Ik7-infected cultures was not caused solely by the process of
retroviral infection because DC were present in control-virus-infected
cultures. An effect of Ik7 virus supernatant was excluded because
EGFP cells exposed to this medium differentiated
into DC (Figure 5A). Noticeably, EGFP cultures
contained higher percentages of DC and of CD14+ cells than
EGFP+ cultures (both in Ik7 or control-virus conditions), a
phenomenon partly due to differences in calculating positive cells in
the dot plots but also possibly reflecting some effects of retroviral or of EGFP expression on hematopoietic cell differentiation. An inhibitory effect by cells growing in Ik7-infected cultures was ruled
out by testing CD34+ EGFP cells either
alone or mixed with Ik7-infected CD34+ EGFP+
cells and showing that DC production from EGFP cells
was not affected in mixed cultures (data not shown). The strong
reduction of DC in FKGm17 cultures infected by Ik7 was not caused by
the relative expansion of other cells because the total number of DC
was reduced compared to controls. These data strongly suggest that Ik7
severely blocked DC hematopoiesis from the lymphoid-related pathway.
View larger version (44K):
[in this window]
[in a new window]
| Fig 5.
Effects of Ik7 on DC differentiation.
Representative flow cytometric analyses of cultures of
CD34+ EGFP+ cells infected with control virus
(left panels) or of CD34+ EGFP+ cells infected
with Ik7 virus (middle panels) and of CD34+
EGFP control cells obtained from cultures infected
with Ik7-containing virus (right panels). Progenitor cells were
obtained as indicated in Figure 4 and cultured with different
cytokines. (A) Dot plots show the correlated expression of the CD1a
marker and EGFP correspond to 1 experiment where cells were cultured
for 7 days with FKGmT4 or FKGm17. (B) A separate experiment in which
cells were stimulated with FKGm17 for 11 days and analyzed for the
correlated expression of CD83, CD14, EGFP, FSC, and SSC parameters. In
all dot plots, the analysis is carried on live cells excluding
propidium iodide. Percentages of cells comprised within defined regions
are indicated on the plots.
|
|
The effects of Ik7 were also examined under conditions supporting
myeloid DC differentiation, which were obtained by culturing hematopoietic progenitors with the FKGmT4 cytokines. On stimulation with FKGmT4, Ik7-infected progenitors produced DC recognizable by their
morphology (not shown) and flow cytometric analysis detected 0.7% to
7% of cells expressing DC markers in a similar range to control
cultures (5%-11% DC) (Table 1). Results of 3 separate experiments
based on flow cytometric determination showed that Ik7-infected
cultures in FKGmT4 contained on average 57% ± 31% of the
proportion of DC and 110% ± 67% of absolute numbers of DC
relative to control cultures. There was no statistically
significant difference between Ik7 cultures grown in the presence of
FKGmT4 and their controls (P > 0.05, paired t
test). These results show that Ik7 did not block DC hematopoiesis in
the FKGmT4 conditions. Thus, the overexpression of Ik7 in
CD34+ cells blocked DC formation induced by conditions
supporting lymphoid-related DC but did not abrogate DC formation in
conditions supporting myeloid DC development. Therefore, we
identified new molecular requirements during the development of
different types of DC. This provides formal proof that there are
intrinsic molecular differences in DC progenitors and precursors able
to give rise to distinct developmental pathways of DC.
Other hematopoietic effects of Ik7 in FKGm17
Myeloid cells constitute the majority in cultures of hematopoietic
progenitors stimulated by FKGm17 and we examined the effects of Ik7 on
these cells. The proportion of CD33+ myeloid cells did not
appear to be affected by Ik7 (data not shown). The proportion of
CD14+ cells was reduced from 2- to 8-fold in cultures of
Ik7 infected cells compared to control-infected cells but the absolute
numbers were similar to those of control cultures. Thus the formation of CD14+ monocytic cells was not blocked. It is known that
CD14 can be modulated at the surface of cells by various
mechanisms41; therefore, we also measured the formation of
monocyte/macrophages in standard methylcellulose clonogenic cultures.
Results show that Ik7 infection did not significantly
(P > 0.05 in paired t test) affect the formation of
macrophage colonies or numbers of clonogenic precursors in the
different myeloid lineages (Table 2). When
cultures were analyzed at early times, we detected erythroid cells in
both control- and Ik7-infected cultures, indicating that there were
probably no major alterations in erythroid lineage differentiation by
Ik7 in vitro. The analysis was essentially focused on the later time points to examine the differentiation of myeloid colonies, particularly of macrophage colonies. We found that their number, size, and appearance were not affected significantly. We noticed, however, in
FKGm17-supported liquid cultures, that Ik7-infected cells expanded 5 to
10 times more than in EGFP+ control-infected cells. The
Ik7-infected cultures contained large amounts of granulocytic cells
recognized by their typical low FSC with high SSC (Figure 5B, lowest
middle panel) and by the presence of azurophilic secondary granules
strongly positive for myeloperoxidase (not shown). In one experiment,
we detected about 20% of myeloperoxidase-positive cells in Ik-7
infected cultures compared to only 6% to 10% in control cultures. In
addition, granulocytes in Ik7-infected cells had more secondary
granules than in control cultures, suggesting a possible effect of Ik7
on granulocyte maturation. We conclude that Ik7 did not block the
formation of the monocytic lineage. However, Ik7 had hematopoietic
effects on myeloid cells, enhancing granulopoiesis in vitro. Thus,
overexpression of Ik7 differentially affects myelopoiesis at the
granulocyte/monocyte developmental point.
Regulation of gene expression in CD34+ hematopoietic
progenitor cells by Ik7
The effects of Ik7 on DC hematopoiesis and on myelopoiesis suggest
that Ik7 controls the expression of genes involved in hematopoietic cell differentiation, prompting an analysis of cytokine receptor gene
expression by RT-PCR. The tyrosine kinase receptor flt3/STK is known to
be expressed by CD34+ hematopoietic progenitor
cells,42 to be critical for murine lymphopoiesis and
primitive stem cell activity,43 and to bind to flt3-ligand,
a cytokine promoting the expansion of DC in vivo.44 RT-PCR
analysis showed that Ik7-infected CD34+ cells expressed
markedly less flt3/STK mRNA than control-infected CD34+
cells (Figure 6). These reduced mRNA levels
were seen in 4 different experiments and we confirmed that equal
amounts of total RNA were analyzed by verifying equal amplification of
mRNA for housekeeping genes such as GAPDH (not shown). Another gene,
the IL-2 receptor gamma chain, was analyzed because, like flt3,
IL2-R is also critically important for lymphoid
development,45 but results showed no significant alteration
by Ik7 overexpression (Figure 6) and confirm the specific
down-regulation of flt-3 mRNA. Thus, overexpression of Ik7 affects gene
expression by interfering with proteins that normally govern
transcriptional regulation in hematopoietic cells. These results
suggest that the down-regulation of specific genes such as flt3/STK
receptor on hematopoietic progenitor cells constitute one of the
mechanisms responsible for the differential effects of Ik7 on
lymphoid-related DC hematopoiesis while retaining the production of DC
from the monocyte-derived pathway.
View larger version (63K):
[in this window]
[in a new window]
| Fig 6.
RT-PCR reaction.
One representative RT-PCR reaction of 4 shows a reduction in the levels
of mRNA for flt3/STK mRNA in Ik7-infected CD34+ cells
compared to control-infected CD34+ cells. The RNA was
obtained after flow cytometry sorting of the cells as in Figure 4. The
PCR product was blotted and hybridized with a 32P-labeled
cDNA probe. In this experiment, the same amount of cDNA was amplified
with primers specific for IL-2R and results show no significant
alteration of mRNA levels by Ik7.
|
|
| |
Discussion |
In this study we demonstrate that there are 2 distinct pathways
that give rise to populations of DC, which have their developmental origin in lymphoid progenitors or in myeloid precursor cells, respectively. We established their distinct cytokine requirements for differentiation and demonstrated that they exhibit differences at
the transcriptional level. The differential dependence of DC differentiation pathways for proteins of the Ikaros family of transcription factors suggests the existence of distinct programs of
gene expression that underlie these developmental processes.
Most of the culture conditions that have been defined for the
generation of human DC in vitro support the differentiation of
monocytes into DC.9,12,13,39,46,47 We provide evidence that
alternative signaling pathways are involved in the formation of
lymphoid-related DC suggesting that distinct molecular programs may
control their development. Lymphoid progenitors, unlike monocytes and
their precursors, can effectively develop in the FKGm17 conditions, and
therefore do so by using a different signaling system than these former
populations. Presumably, the cytokine flt-3-ligand and IL-7 are
important factors for lymphoid-related DC because they have
demonstrated positive effects in rodent systems.20,48 Overexpression of Ik7 blocks the signals provided by the FKGm17 cytokines to instruct DC differentiation. One of the molecular mechanisms by which Ik7 may act in that capacity is by down-regulating levels of Flt3 receptor mRNA. The mutant dominant-negative protein Ik7
is known to reduce the transcriptional activity of murine proteins with
which it associates and presumably does so with the human homologues.
This suggests the possibility that some members of the Ikaros family of
proteins may act as transcriptional regulators of the flt3/STK gene.
Already described partners of Ik7 include other Ikaros proteins as well
as the B-cell homologue Aiolos26 and Helios.27
Both Ikaros and the human homologue of Aiolos are found in
CD34+ cells (A. Galy, unpublished observations). Levels of
wild-type Ikaros mRNA are not significantly affected by Ik7 in
CD34+ cells (as seen in Figure 4), but it will have to be
determined how Ikaros family members and the genes that they control
are affected by Ik7 overexpression into DC.
Our results suggest that Ik7 differentially controls the hematopoiesis
of lymphoid progenitors and of myeloid progenitors, therefore
supporting the existence of 2 separate hematopoietic lineages of DC.
Lymphoid progenitors and monocytes represent 2 distinct DC
precursor/progenitor cells that appear to be unrelated based on the
inability of lymphoid progenitors to generate CD14+
monocytic cells in response to FKGm17 and because CD34+
Lin CD10+ lymphoid progenitors do not
survive in the presence of c-kit ligand and macrophage
colony-stimulating factor , cytokines that support monocytic
development (data not shown). The differential effect of Ik7 on the
development of lymphoid-related DC and on monocytes is compatible with
a hematopoietic lineage-specific alteration as was suggested by Ikaros
mutant mice lacking lymphocytes but having abundant numbers of
monocyte/macrophages.22,23 The differential effect of Ik7
on DC progenitors in FKGm17 and FKGmT4 conditions might therefore be
explained by a preferential response of distinct subsets of progenitor
populations to each of these signals.
An alternative interpretation for our results is that they show
distinct DC developmental options as the result of various signaling
pathways in DC progenitors. Understanding why FKGm17 cytokines fail to
support DC differentiation in monocytes might help explain the effects
of Ik7 on DC hematopoiesis. We noticed that CD1a+/low
CD14+ cells are being generated in FKGm17 cultures of
CD34+ Lin CD10 cells
(as seen in Figure 2A, middle panel), which appear to represent intermediate stages of DC development described in other
studies.38 Yet, most CD14+ cells or
CD1a+ CD14+ cells never become DC in FKGm17.
Cultures tested up to 18 days accumulated up to 75% CD14+
cells but still only contained about 0.1% DC as measured by CD1a expression (data not shown). We conclude that the FKGm17 conditions fail to provide the necessary signals to support the CD14+
cell-dependent DC developmental pathway that has been described in
other studies.14,38 It is possible that TNF- which was shown by antibody neutralization studies to be essential for the development of CD1a+ CD14+ cells into DC, is at
insufficient levels in the culture thus preventing their survival or
differentiation.38 The difference in signals provided by
FKGmT4 and FKGm17 may explain the different effects of Ik7. Indeed, we
were able to partially rescue DC formation in Ik7-infected FKGm17
cultures by adding TNF- thus mimicking most of the conditions found
in FKGMT4 cultures (A. Galy, unpublished observations). A consequence
of the existence of different signaling pathways in DC is the
prediction that several types of mature DC probably exist. Indeed
separate populations of DC have been described in mice with the
characterization of "lymphoid-related" DC expressing the CD8-
marker and of "myeloid-derived" DC, which are
CD8-. These DC differ not only at the level of
their phenotype but in their requirements for GM-CSF for growth and
differentiation,4,49 in transcription regulation underlined
by Rel/B molecules,21 and in the types of immune responses
that they elicit.4,5 Reconstitution experiments with thymic
or BM precursors have suggested that these 2 types of DC derive from
distinct hematopoietic precursors.50 Thus we propose
that at least 1 aspect contributing to the functional heterogeneity of
DC is determined by molecular events occurring at the hematopoietic
level. Overall, as a model, Ik7 overexpression appears to be useful to
understand the biology of the Ikaros family of molecules in human
cells. Granulopoiesis was enhanced by Ik7 during the in vitro period of
culture and these observations are compatible with the enlarged spleens
and extramedullary hematopoiesis described in DN-/- mutant
mice.23 Morphologic changes were seen in granulocytes suggesting a possible effect of Ik7 on their maturation with perhaps induction of some eosinophilic characteristics. Further studies, beyond
the scope of this paper, will be required to understand the effects of
Ik7 on this lineage of cells.
Altogether, our data indicate that the process of hematopoiesis in
human DC occurs along several possible developmental pathways regulated
by distinct signals. We conclude that different developmental lineages
of DC exist and that lymphoid-related DC constitute a separate entity.
The existence of non-overlapping signals and of distinct cellular
developmental pathways for DC hematopoiesis may have important
implications for the regulation of DC function and homeostasis. Most
likely, regulating DC formation in normal and pathologic circumstances
or for therapeutic purposes will be complex.
| |
Acknowledgments |
We acknowledge the support of the Flow Cytometry Core Facility at the
Karmanos Cancer Institute and are thankful to Dr Dan at Harper
Hospital, Detroit, for help with the cytology. Many thanks also to the
staff in the operating room and pathology at Harper Hospital for their
help in procurement of human rib marrow samples.
| |
Footnotes |
Submitted June 24, 1999; accepted August 28, 1999.
Supported by American Cancer Society grants, IRG162K and RPG-98-183-01.
Reprints: Anne Galy, Karmanos Cancer Institute, 110 Warren
Avenue, Detroit, MI 48201; e-mail: galya{at}kci.wayne.edu.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
| |
References |
1.
Banchereau J, Steinman R.
Dendritic cells and the control of immunity.
Nature.
1998;392:245-252[Medline]
[Order article via Infotrieve].
2.
Hart D.
Dendritic cells: unique leukocyte populations which control the primary immune response.
Blood.
1997;90:3245-3287[Free Full Text].
3.
Rissoan MC, Soumelis V, Kadowaki N, et al.
Reciprocal control of T helper cell and dendritic cell differentiation.
Science.
1999;283:1183-1186[Abstract/Free Full Text]
4.
Pulendran B, Smith J, Caspary G, et al.
Distinct dendritic cell subsets differentially regulate the class of immune response in vivo.
Proc Natl Acad Sci U S A.
1999;96:1036-1041[Abstract/Free Full Text].
5.
Maldonado-Lopez R, De Smedt T, Michel P, et al.
CD8a+ and CD8a- subclasses of dendritic cells direct the development of distinct T helper cells in vivo.
J Exp Med.
1999;189:587-592[Abstract/Free Full Text].
6.
Sallusto F, Lanzavecchia A.
Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin-4 and down-regulated by tumor necrosis factor .
J Exp Med
1994;179:1109-1118[Abstract/Free Full Text].
7.
de Saint-Vis B, Fugier-Vivier I, Massacrier C, et al.
The cytokine profile expressed by human dendritic cells is dependent on cell subtype and mode of activation.
J Immunol.
1998;160:1666-1676[Abstract/Free Full Text].
8.
Rescigno M, Martino M, Sutherland C, Gold M, Ricciardi-Castagnoli P.
Dendritic cell survival and maturation are regulated by different signaling pathways.
J Exp Med.
1998;188:2175-2180[Abstract/Free Full Text].
9.
Randolph GJ, Beaulieu S, Lebecque S, Steinman RM, Muller WA.
Differentiation of monocytes into dendritic cells in a model of transendothelial trafficking.
Science.
1998;282:480-483[Abstract/Free Full Text].
10.
Zhou LJ, Tedder TF.
CD14+ monocytes can differentiate into functionally mature CD83+ dendritic cells.
Proc Natl Acad Sci U S A.
1996;93:2588-2592[Abstract/Free Full Text].
11. Ferlazzo G, Klein J, Paliard X, Wei W, Galy A. Dendritic cells
generated from CD34+ progenitor cells with flt3-ligand, c-kit-ligand,
GM-CSF, IL-4 and TNF-a are functional antigen-presenting cells
resembling mature monocyte-derived DC. J Immunother. In
press.
12.
Caux C, Dezutter-Dambuyant C, Schrmitt D, Banchereau J.
GM-CSF and TNF- cooperate in the generation of dendritic Langerhans cells.
Nature.
1992;360:258-261[Medline]
[Order article via Infotrieve].
13.
Santiago-Schwarz F, Belilos E, Diamond B, Carsons SE.
TNF in combination with GM-CSF enhances the differentiation of neonatal cord blood stem cells into dendritic cells and macrophages.
J Leukoc Biol.
1992;52:274-281[Abstract].
14.
Caux C, Vanbervliet B, Massacrier C, et al.
CD34+ hematopoietic progenitors from human cord blood differentiate along two independent dendritic cell pathways in response to GM-CSF+TNF.
J Exp Med.
1996;184:695-706[Abstract/Free Full Text].
15.
Ardavin C, Wu L, Li C-L, Shortman K.
Thymic dendritic cells and T cells develop simultaneously in the thymus from a common precursor population.
Nature.
1993;362:761-763[Medline]
[Order article via Infotrieve].
16.
Galy A, Travis M, Cen D, Chen B.
Human T, B, natural killer and dendritic cells arise from a common bone marrow progenitor cell subset.
Immunity.
1995;3:459-473[Medline]
[Order article via Infotrieve].
17.
Res P, Martínez-Cáceres E, Jaleco AC, et al.
CD34+ CD38dim cells in the human thymus can differentiate into T, natural killer, and dendritic cells but are distinct from pluripotent stem cells.
Blood.
1996;87:5196-5206[Abstract/Free Full Text].
18.
Bjorck P, Kincade PW.
CD19+ Pro-B cells can give rise to dendritic cells in vitro.
J Immunol.
1998;161:5795-5799[Abstract/Free Full Text].
19.
Saunders D, Lucas K, Ismaili J, et al.
Dendritic cell development in culture from thymic precursor cells in the absence of granulocyte/macrophage colony stimulating factor.
J Exp Med.
1996;184:2185-2196[Abstract/Free Full Text].
20.
Pulendran B, Lingappa J, Kennedy M, et al.
Developmental pathways of dendritic cells in vivo. Distinct functions, phenotype, and localization of dendritic cell subsets in FLT3 ligand-treated mice.
J Immunol.
1997;159:2222-2231[Abstract/Free Full Text].
21.
Wu L, D'Amico A, Winkel K, Suter M, Lo D, Shortman K.
RelB is essential for the development of myeloid-related CD8alpha dendritic cells but not of lymphoid-related CD8alpha+ dendritic cells.
Immunity.
1998;9:839-847[Medline]
[Order article via Infotrieve].
22.
Wu L, Nichogiannopoulou A, Shortman K, Georgopoulos K.
Cell-autonomous defect in dendritic cell populations of Ikaros mutant mice point to a developmental relationship with the lymphoid lineage.
Immunity.
1997;7:483-492[Medline]
[Order article via Infotrieve].
23.
Georgopoulos K, Bigby M, Wang JH, et al.
The Ikaros gene is required for the development of all lymphoid lineages.
Cell.
1994;79:143-156[Medline]
[Order article via Infotrieve].
24.
Wang JH, Nichogiannopoulou A, Wu L, et al.
Selective defects in the development of the fetal and adult lymphoid system in mice with an Ikaros null mutation.
Immunity.
1996;5:537-549[Medline]
[Order article via Infotrieve].
25.
Sun L, Liu A, Georgopoulos K.
Zinc finger-mediated protein interactions modulate Ikaros activity, a molecular control of lymphocyte development.
EMBO J.
1996;15:5358-5369[Medline]
[Order article via Infotrieve].
26.
Morgan B, Sun L, Avithal N, et al.
Aiolos, a lymphoid restricted transcription factor that interacts with Ikaros to regulate lymphocyte differentiation.
EMBO J.
1997;16:2004-2013[Medline]
[Order article via Infotrieve].
27.
Kelley CM, Ikeda T, Koipally J, et al.
Helios, a novel dimerization partner of Ikaros expressed in the earliest hematopoietic progenitors.
Curr Biol.
1998;8:508-515[Medline]
[Order article via Infotrieve].
28.
Molnar A, Wu P, Largespada DA, et al.
The Ikaros gene encodes a family of lymphocyte restricted zinc finger DNA binding proteins, highly conserved in human and mouse.
J Immunol.
1996;156:585-592[Abstract].
29.
Galy A, Morel F, Hill B, Chen BP.
Hematopoietic progenitor cells of lymphocytes and dendritic cells.
J Immunother.
1998;21:132-141.
30.
Hansen JD, Strassburger P, Du Pasquier L.
Conservation of a master hematopoietic switch gene during vertebrate evolution: isolation and characterization of Ikaros from teleost and amphibian species.
Eur J Immunol.
1997;27:3049-3058[Medline]
[Order article via Infotrieve].
31.
Kinsella T, Nolan G.
Episomal vectors rapidly and stably produce high-titer recombinant retrovirus.
Hum Gene Ther.
1996;7:1405-1413[Medline]
[Order article via Infotrieve].
32.
Heemskerk M, Blom B, Nolan G, et al.
Inhibition of T cell and promotion of natural killer cell development by the dominant negative helix loop helix factor Id3.
J Exp Med.
1997;186:1597-1602[Abstract/Free Full Text].
33.
Ausubel F, Brent R, Kingston RE, et al.
In:
Janssen K, ed.
Current protocols in molecular biology. New York, NY: John Wiley & Sons; 1995
34.
Zhou LJ, Tedder TF.
Human blood dendritic cells selectively express CD83, a member of the immunoglobulin superfamily.
J Immunol.
1995;154:3821-3835[Abstract].
35.
Steinman RM.
The dendritic cell system and its role in immunogenicity.
Annu Rev Immunol.
1991;9:271-296[Medline]
[Order article via Infotrieve].
36.
Caux C, Massacrier C, Vanbervliet B, et al.
CD34+ hematopoeitic progenitors from human cord blood differentiate along two independent dendritic cell pathways in response to granulocyte-macrophage colony-stimulating factor plus tumor necrosis factor : II functional analysis.
Blood.
1997;90:1458-1470[Abstract/Free Full Text].
37.
Ryan DH, Nuccie BL, Ritterman I, Liesveld J, Abboud C, Insel R.
Expression of interleukin-7 receptor by lineage-negative human bone marrow progenitors with enhanced lymphoid proliferative potential and B-lineage differentiation capacity.
Blood.
1997;89:929-940[Abstract/Free Full Text].
38.
Santiago-Schwarz F, McCarthy M, Tucci J, Carsons S.
Neutralization of tumor necrosis factor activity shortly after the onset of dendritic cell hematopoiesis reveals a novel mechanism for the selective expansion of the CD14-dependent dendritic cell pathway.
Blood.
1998;92:745-755[Abstract/Free Full Text].
39.
Romani N, Gruner S, Brang D, et al.
Proliferating dendritic cell progenitors in human blood.
J Exp Med.
1994;180:83-93[Abstract/Free Full Text].
40.
Conneally E, Bardy P, Eaves CJ, et al.
Rapid and efficient selection of human hematopoietic cells expressing murine heat-stable antigen as an indicator of retroviral-mediated gene transfer.
Blood.
1996;87:456-464[Abstract/Free Full Text].
41.
Bazil V, Strominger J.
Shedding as a mechanism of down-modulation of CD14 on stimulated human monocytes.
J Immunol.
1991;147:1567-1574[Abstract].
42.
Small D, Levenstein M, Kim E, et al.
STK-1, the human homolog of Flk-2/Flt-3, is selectively expressed in CD34+ human bone marrow cells and is involved in the proliferation of early progenitor/stem cells.
Proc Natl Acad Sci U S A.
1994;91:459-463[Abstract/Free Full Text].
43.
Mackarehtschian K, Hardin JD, Moore KA, Boast S, Goff SP, Lemischka IR.
Targeted disruption of the Flk2/flt3 gene leads to deficiencies in primitive hematopoietic progenitors.
Immunity.
1995;3:147-161[Medline]
[Order article via Infotrieve].
44.
Maraskovsky E, Brasel K, Teepe M, et al.
Dramatic increase in the numbers of functionally mature dendritic cells in Flt3 ligand-treated mice: multiple dendritic cell subpopulations identified.
J Exp Med.
1996;184:1953-1962[Abstract/Free Full Text].
45.
DiSanto J, Muller W, Guy-Grand D, Fischer A, Rajewsky K.
Lymphoid development in mice with a targeted deletion of the interleukin 2 receptor gamma chain.
Proc Natl Acad Sci U S A.
1995;92:377-381[Abstract/Free Full Text].
46.
Siena S, Di Nicola M, Bregni M, et al.
Massive ex vivo generation of functional dendritic cells from mobilized CD34+ blood progenitors for anticancer therapy.
Exp Hematol.
1995;23:1463-1471[Medline]
[Order article via Infotrieve].
47.
Rosenzwajg M, Camus S, Guigon M, Gluckman J.
The influence of interleukin (IL)-4, IL-13, and Flt3 ligand on human dendritic cell differentiation from cord blood CD34+ progenitor cells.
Exp Hematol.
1998;26:63-72[Medline]
[Order article via Infotrieve].
48.
Varas A, Vicente A, Sacedon R, Zapata A.
Interleukin-7 influences the development of thymic dendritic cells.
Blood.
1998;92:93-100[Abstract/Free Full Text].
49.
Vremec D, Lieschke G, Dunn A, Robb L, Metcalf D, Shortman K.
The influence of granulocyte/macrophage colony-stimulating factor on dendritic cell levels in mouse lymphoid organs.
Eur J Immunol.
1997;27:40-44[Medline]
[Order article via Infotrieve].
50.
Wu L, Vremec D, Ardavin C, et al.
Mouse thymus dendritic cells: kinetics of development and changes in surface markers during maturation.
Eur J Immunol.
1995;25:418-425[Medline]
[Order article via Infotrieve].
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. Dijon, F. Bardin, A. Murati, M. Batoz, C. Chabannon, and C. Tonnelle
The role of Ikaros in human erythroid differentiation
Blood,
February 1, 2008;
111(3):
1138 - 1146.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Allman, M. Dalod, C. Asselin-Paturel, T. Delale, S. H. Robbins, G. Trinchieri, C. A. Biron, P. Kastner, and S. Chan
Ikaros is required for plasmacytoid dendritic cell differentiation
Blood,
December 15, 2006;
108(13):
4025 - 4034.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. McKenna, A.-S. Beignon, and N. Bhardwaj
Plasmacytoid Dendritic Cells: Linking Innate and Adaptive Immunity
J. Virol.,
January 1, 2005;
79(1):
17 - 27.
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Palamara, S. Meindl, M. Holcmann, P. Luhrs, G. Stingl, and M. Sibilia
Identification and Characterization of pDC-Like Cells in Normal Mouse Skin and Melanomas Treated with Imiquimod
J. Immunol.,
September 1, 2004;
173(5):
3051 - 3061.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Dai, N. J. Megjugorac, S. B. Amrute, and P. Fitzgerald-Bocarsly
Regulation of IFN Regulatory Factor-7 and IFN-{alpha} Production by Enveloped Virus and Lipopolysaccharide in Human Plasmacytoid Dendritic Cells
J. Immunol.,
August 1, 2004;
173(3):
1535 - 1548.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Movassagh, D. Laderach, and A. Galy
Proteins of the Ikaros family control dendritic cell maturation required to induce optimal Th1 T cell differentiation
Int. Immunol.,
June 1, 2004;
16(6):
867 - 875.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. J. Megjugorac, H. A. Young, S. B. Amrute, S. L. Olshalsky, and P. Fitzgerald-Bocarsly
Virally stimulated plasmacytoid dendritic cells produce chemokines and induce migration of T and NK cells
J. Leukoc. Biol.,
March 1, 2004;
75(3):
504 - 514.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Hartmann, B. Wollenberg, S. Rothenfusser, M. Wagner, D. Wellisch, B. Mack, T. Giese, O. Gires, S. Endres, and G. Hartmann
Identification and Functional Analysis of Tumor-Infiltrating Plasmacytoid Dendritic Cells in Head and Neck Cancer
Cancer Res.,
October 1, 2003;
63(19):
6478 - 6487.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Kerkmann, S. Rothenfusser, V. Hornung, A. Towarowski, M. Wagner, A. Sarris, T. Giese, S. Endres, and G. Hartmann
Activation with CpG-A and CpG-B Oligonucleotides Reveals Two Distinct Regulatory Pathways of Type I IFN Synthesis in Human Plasmacytoid Dendritic Cells
J. Immunol.,
May 1, 2003;
170(9):
4465 - 4474.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Yagi, S. Hibi, M. Takanashi, G. Kano, Y. Tabata, T. Imamura, T. Inaba, A. Morimoto, S. Todo, and S. Imashuku
High frequency of Ikaros isoform 6 expression in acute myelomonocytic and monocytic leukemias: implications for up-regulation of the antiapoptotic protein Bcl-XL in leukemogenesis
Blood,
February 15, 2002;
99(4):
1350 - 1355.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. N. Tucker, H. K. Jessup, H. Fujii, and C. B. Wilson
Enforced expression of the Ikaros isoform IK5 decreases the numbers of extrathymic intraepithelial lymphocytes and natural killer 1.1+ T cells
Blood,
January 15, 2002;
99(2):
513 - 519.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Tonnelle, F. Bardin, C. Maroc, A.-M. Imbert, F. Campa, A. Dalloul, C. Schmitt, and C. Chabannon
Forced expression of the Ikaros 6 isoform in human placental blood CD34+ cells impairs their ability to differentiate toward the B-lymphoid lineage
Blood,
November 1, 2001;
98(9):
2673 - 2680.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. M. Alonso-C., J. J. Munoz, and A. G. Zapata
Delineation of Intrathymic T, NK, and Dendritic Cell (DC) Progenitors in Fetal and Adult Rats: Demonstration of a Bipotent T/DC Intermediate Precursor
J. Immunol.,
October 1, 2001;
167(7):
3635 - 3641.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. K. Wesa and A. Galy
IL-1{beta} induces dendritic cells to produce IL-12
Int. Immunol.,
August 1, 2001;
13(8):
1053 - 1061.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Chaperot, N. Bendriss, O. Manches, R. Gressin, M. Maynadie, F. Trimoreau, H. Orfeuvre, B. Corront, J. Feuillard, J.-J. Sotto, et al.
Identification of a leukemic counterpart of the plasmacytoid dendritic cells
Blood,
May 15, 2001;
97(10):
3210 - 3217.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. Christopherson, M. Piechoki, G. Liu, S. Ratner, and A. Galy
Regulation of L-selectin expression by a dominant negative Ikaros protein
J. Leukoc. Biol.,
April 1, 2001;
69(4):
675 - 683.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
J. M.M. den Haan, S. M. Lehar, and M. J. Bevan
Cd8+ but Not Cd8- Dendritic Cells Cross-Prime Cytotoxic T Cells in Vivo
J. Exp. Med.,
December 18, 2000;
192(12):
1685 - 1696.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Canque, S. Camus, A. Dalloul, E. Kahn, M. Yagello, C. Dezutter-Dambuyant, D. Schmitt, C. Schmitt, and J. C. Gluckman
Characterization of dendritic cell differentiation pathways from cord blood CD34+CD7+CD45RA+ hematopoietic progenitor cells
Blood,
December 1, 2000;
96(12):
3748 - 3756.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction