|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 95 No. 1 (January 1), 2000:
pp. 352-359
TRANSPLANTATION
Reconstitution of T-cell receptor repertoire diversity following
T-cell depleted allogeneic bone marrow transplantation is related to
hematopoietic chimerism
Catherine J. Wu,
Antoinette Chillemi,
Edwin P. Alyea,
Enrica Orsini,
Donna Neuberg,
Robert
J. Soiffer, and
Jerome Ritz
From the Center for Hematologic Oncology and Department of
Biostatistics, Dana-Farber Cancer Institute; Department of Medicine,
Brigham and Women's Hospital, Harvard Medical School, Boston, MA.
 |
Abstract |
CDR3 spectratyping was used to analyze the complexity of the T-cell
repertoire and to define the mechanisms and kinetics of the
reconstitution of T-cell immunity after allogeneic bone marrow transplantation (BMT). This method, which is based on polymerase chain
reaction amplification of all CDR3 regions using the T-cell receptor
(TCR) V genes, was used to examine serial samples of peripheral
blood lymphocytes from 11 adult patients with chronic myelogenous
leukemia (CML) who underwent T-cell-depleted allogeneic BMT. In
contrast to 10 normal donors who display highly diverse and polyclonal
spectratypes, patient samples before and early after BMT revealed
markedly skewed repertoires, consisting of absent, monoclonal, or
oligoclonal profiles for the majority of V subfamilies. To quantify
changes in TCR repertoire over time, we established an 8-point scoring
system for each V subfamily. The mean complexity score for patient
samples before transplant (130.8) was significantly lower than that for
normal donors (183; P = 0.0007). TCR repertoire complexity
was abnormal in all patients at 3 months after BMT (mean
score = 87). Normalization of repertoire began in 4 patients at 6 months after BMT, but the majority of patients continued to display
abnormal repertoires for up to 3 years after BMT. To determine whether
the reconstituted T-cell repertoire was derived from the donor or
recipient, unique microsatellite loci were examined to establish
chimeric status. At 3 months after BMT, 7 patients demonstrated mixed
chimerism; 4 had complete donor hematopoiesis (CDH). CDH strongly
correlated with likelihood of restoration of T-cell repertoire
complexity (P = 0.003). In contrast, patients who
demonstrated persistence of recipient hematopoiesis failed to
reconstitute a diverse TCR repertoire. These findings suggest that the
reconstitution of a normal T-cell repertoire from T-cell progenitors in
adults is influenced by interactions between recipient and donor
hematopoietic cells. (Blood. 2000;95: 352-359)
© 2000 by The American Society of Hematology.
| |
Introduction |
The generation and maintenance of a diverse T-cell
repertoire is a critical element of immune competence. In normal
development, thymic processing of T-cell progenitors results in a broad
array of naïve T cells that remain present for much of the
lifetime of an individual. Although thymic processing is thought to
continue in normal adults, thymic involution occurs in all individuals and results in a marked decrease in the processing and generation of
naïve T cells. How the T-cell repertoire is generated and maintained after myeloablative therapy and allogeneic bone marrow transplantation (BMT) is not well understood. After conventional transplantation with marrow containing relatively large numbers of
normal donor lymphocytes, T-cell reconstitution is at least in part
derived from the expansion of mature donor T cells. However, T-cell
reconstitution also occurs after transplantation of T-cell-depleted marrow, which contains few, if any mature differentiated T cells. In
both instances, T-cell function remains compromised for prolonged periods of time. This clinical observation suggests that the process of
regeneration of a diverse T-cell repertoire is a relatively slow one in
adult individuals.
Following allogeneic BMT, regeneration of T-cell populations with a
diverse repertoire can occur by at least 2 mechanisms. One mechanism is
a thymic-dependent pathway, which presumably involves both negative and
positive selection and recapitulates fetal ontogeny. Alternatively,
regeneration of peripheral T cells may occur through thymic-independent
mechanisms. Mackall et al. have examined the regeneration of CD4+
T cells after intensive chemotherapy, using CD45RA as a marker of
naïve cells generated by thymic-dependent pathways. Their
results suggest that although thymic-dependent regeneration of CD4+
cells occurs in children after chemotherapy, this process is much less
active in adults.1,2 After allogeneic BMT, Roux et al
detected increased numbers of CD45RO+ memory cells, a hallmark of T
cells that regenerate in the absence of a functioning
thymus.3 These findings support the notion that
thymic-independent pathways of T-cell regeneration are important and
that these "peripheral" pathways function primarily in adults.
The extensive diversity of the mature T-cell receptor (TCR) is
determined primarily by the complementarity-determining regions (CDR3)
of the TCR. The CDR3 play a key role in defining the specificity of
antigen recognition because these regions form the contact site for
binding to peptide major histocompatibility complexes (MHCs) expressed
by antigen-presenting cells. The CDR3 of both TCR and TCR genes
is generated by extensive rearrangement and fusion between the V, D,
and J segments and by random insertion and deletion of junctional
nucleotides, which yields final products that are quite heterogeneous
in size. As a result of these gene rearrangements, each T cell has a
unique TCR and the diversity of the T-cell repertoire at any specific
time can be characterized by the examination of CDR3 within that
population. The structure and sequence of the entire TCR V gene
family has been established,4 and polymerase chain reaction
(PCR) amplification of the V region has been previously described in
a technique called CDR3 spectratyping.5,6 Using this
technique, normal individuals demonstrate a highly diverse and
polyclonal TCR repertoire with a typically gaussian distribution of
CDR3 species of approximately 8 sizes for each V region. In
contrast, strong immune responses, such as acute graft-versus-host
disease (GVHD), solid organ transplant rejection, infection, and
autoimmune diseases, are associated with oligoclonal or monoclonal CDR3
patterns in peripheral blood as well as in the affected
tissue.7-15 Patients with hairy cell leukemia demonstrate gradual normalization of skewed TCR repertoires after several years of
treatment with interferon (IFN)-, and patients with HIV infection
normalize their T-cell repertoire following effective anti-retroviral
therapy.16 We previously used CDR3 spectratyping to
characterize the T-cell response after donor lymphocyte infusion (DLI).17 Patients with relapsed chronic myelogenous
leukemia (CML) after allogeneic BMT were found to have markedly
abnormal TCR repertoires but T-cell repertoire complexity was restored after DLI. Moreover, the response to DLI was associated with the appearance of new clonal T-cell populations in peripheral blood. Taken
together, these studies demonstrate that severe deficiencies in the
T-cell repertoire can be reversible and that CDR3 analysis provides a
sensitive method for characterization of the T-cell repertoire as well
as for following changes in individual patients over time.
In the present study, we used CDR3 spectratype analysis to examine the
kinetics of T-cell reconstitution following allogeneic BMT in patients
who received T-cell-depleted marrow from HLA-identical siblings.
T-cell repertoire was analyzed in 11 patients with CML at various
intervals up to 3 years after allogeneic BMT. This represents the
largest cohort to date of a homogeneous population of patients
undergoing this type of analysis. Because all the patients received
normal donor hematopoietic stem cells without mature T cells, these
patients provide the unique opportunity to examine peripheral T-cell
reconstitution in adults. None of these patients developed clinical
evidence of significant GVHD and thus the analysis was not complicated
by the effects of GVHD or by the administration of immunosuppressive
agents. When compared to normal donors, TCR V repertoires of all
patients were remarkably skewed at 3 months after transplant. By 6 to
12 months after BMT, several patients began to demonstrate gradual
restoration in the complexity of the T-cell repertoire. Reconstitution
of the T-cell repertoire appeared to occur only in patients who had
exclusively donor hematopoiesis. In contrast, patients who demonstrated
persistence of recipient hematopoiesis failed to reconstitute a diverse
TCR repertoire. These findings suggest that the reconstitution of a
normal T-cell repertoire from T-cell progenitors in adults is influenced by interactions between recipient and donor hematopoietic cells.
| |
Materials and methods |
Cell preparation
Heparinized blood samples from patients were obtained before and at
various times after transplant. Heparinized blood samples were also
obtained from 10 normal donors; 5 were HLA-identical sibling marrow
donors for CML patients, and 5 were sibling donors for patients with
multiple myeloma undergoing allogeneic BMT. Peripheral blood
mononuclear cells (PBMC) from normal donors and patients were isolated
by Ficoll/Hypaque density gradient centrifugation, cryopreserved with
10% dimethyl sulfoxide (DMSO), and stored in vapor phase liquid
nitrogen until the time of analysis.
Flow cytometric analysis
The PBMC (0.5-1 × 106) were incubated at 4°C
for 30 minutes with murine monoclonal antibodies specific for CD3, CD4,
CD8, and CD56 antigens conjugated to fluorescein or phycoerythrin
(Coulter Immunology, Hialeah, FL). Antibodies were used at 1:100
dilution, and cells were washed with phosphate-buffered saline followed by fixation with 2% paraformaldehyde. Immunophenotypic analysis of the
stained and fixed cells was performed on a Coulter EPICS XL Flow
Cytometer (Beckman Coulter, Hialeah, FL). Absolute number of cells per
lymphocyte subset was calculated as (% lymphocytes + monocytes + atypical lymphocytes) × (total peripheral white blood cells
number) × % positive cells determined by flow cytometry (FACS).
RNA extraction, reverse transcription, and PCR
RNA was extracted from 12 to 26 × 106 PBMC by
the single-step acid guanidinium thiocyanate/phenol/chloroform method
(RNA Stat-60 kit; Tel-test Inc, Friendswood, TX) according to the
manufacturer's protocol. First-strand cDNA was generated from 2 µg
total RNA using random hexanucleotides (Pharmacia LKB Biotechnology
Inc, Picscataway, NJ) and reverse transcriptase (Superscript; GIBCO BRL, Gaithersburg, MD). Each TCR V segment was amplified with one of
the V subfamily-specific primers as previously described and a C
primer recognizing both C1 and C2 regions in a 100-µL volume.6,18 The C primer was conjugated to fluorescent
dye 6-FAM (Applied Biosystems, Foster City, CA) for CDR3 analysis. Because of the large size of the V5 and V13 gene products, these V regions were amplified by 2 sets of non-overlapping primers, designated as V5.1, V5.2, V13.1, and V13.2. Thus, cDNA from each sample was amplified with a set of 26 primers spanning the entire
group of 24 TCR V subfamilies. Patients 3 and 7 had low lymphocyte
counts before transplant, and there were insufficient amounts of
starting material for the successful extraction of RNA and subsequent
reverse transcriptase-polymerase chain reaction (RT-PCR) amplification
of TCR CDR3 sequences at this particular time point.
Genomic DNA extraction
Genomic DNA was extracted from 3 to 10 × 106
PBMC or bone marrow according to the manufacturer's recommendations
(Wizard Genomic DNA Purification Kit, Promega, Madison, WI). Prior to
amplification, all DNA samples were quantitated by UV spectrophotometry
and diluted to working concentrations.
TCR chain CDR3 fragment size analysis
The size distribution of each fluorescent PCR product was determined
by electrophoresis on an automated 373 or 377 DNA sequencer (Applied
Biosystems, Foster City, CA) using a 4.75% or 4% polyacrylamide gel,
respectively, and data were analyzed by GeneScan software (Perkin Elmer
Cetus Instruments, Emeryville, CA). No differences in sensitivity of
detection of spectratype peaks or morphology of peaks were noted
between the 2 sequencing instruments (data not shown). Because the
position of the 5' and 3' primers is fixed, fragment size
differences within each V subfamily are entirely due to different
CDR3 lengths, reflecting junctional diversity and N-random nucleotide
insertions in the V-D-J region. Peaks corresponding to in-frame
transcripts are detected at 3 nucleotide intervals. A normal transcript
size distribution, reflecting polyclonal cDNA, contains 8 to 10 peaks
for each V subfamily.5 The appearance of dominant peaks
indicates the presence of excess cDNA of identical size, suggesting the
presence of an oligoclonal or clonal T-cell population. The absence of
any peaks after PCR amplification suggests the absence of any T cells
using a specific V subfamily of TCR genes.
Spectratype complexity scoring
The overall complexity within a V subfamily was determined by
counting the number of discrete peaks per subfamily. Subfamilies were
graded on a score of 0 to 8 based on the degree of complexity. Normal
complexity is characterized by a gaussian distribution of transcript
sizes, which reflects the presence of polyclonal cDNA species and
contains 8 to 10 peaks for each V subfamily. A score of 0 was
assigned if a subfamily was absent. A score of 1 was given if a
subfamily demonstrated only a single monoclonal peak. A score of 2 was
given for a biclonal profile. A subfamily was designated with a score
of 3 if 3 peaks were present and so on. Finally, a score of 8 denoted a
normal-appearing spectratype of 8 to 10 peaks with a complex, diverse,
and polyclonal appearance. The overall spectratype complexity score per
sample was calculated as the summation of the number of subfamilies
(ie, 26, because subfamilies 5 and 13 are represented by 2 sets of
primers) per score category, with a maximum possible score of 208 (8 × 26).
Hematopoietic chimerism assay
Genomic DNA was extracted from samples of each
donor-recipient pair before transplant and amplified by PCR with a
panel of 6 primer pairs specific for polymorphic microsatellite regions to identify an informative locus. Four of the 6 primer sequences have
been previously described and were designated as b7, h10, h12, and
h4.19 We found that these 4 primer sequences were not informative for some patients, and 2 additional primer pair sequences (designated as 3p2 and pi) were designed based on analysis of a linkage
map of the human genome characterizing microsatellites regions20 (Table 1) (Genosys
Biotechnologies, The Woodland, TX). As a modification of the technique
described by Oberkircher, we conjugated the 3' primer of each
pair to fluorescent 6-FAM or Hex dye (Genosys Biotechnologies, The
Woodland, TX). All reactions were performed in sterile autoclaved
0.5-mL microcentrifuge tubes containing 0.03 µg genomic DNA, 10 mM
Tris-HCl (pH 8.3), 1.5 mM Mg2Cl, 50 mM KCl, 0.01% (w/v)
gelatin, 200 µM each of deoxyguanosine triphosphate, deoxyadenosine
triphosphate, deoxythymidine triphosphate, and deoxycytidine
triphosphate, 0.5 U AmpliqTaq DNA polymerase (Perkin Elmer Cetus,
Norwalk, CT), and 10% DMSO. After initial denaturation of the DNA
template at 94°C for 5 minutes, each cycle consisted of
denaturation at 94°C for 60 seconds, primer annealing at 55°C
for 60 seconds, and primer extension at 72°C for 60 seconds for 40 cycles. A final 10-minute extension at 72°C followed the last
cycle. The amplification products were electrophoresed on an automated
373 or 377 DNA sequencer (Applied Biosystems, Foster City, CA) using a
4.75% or 4% polyacrylamide gel, respectively, and data were analyzed
by GeneScan software (Perkin Elmer Cetus Instruments). A locus was
defined as informative if analysis of recipient and donor samples
before transplant showed either a unique band for the recipient and a
unique band for the donor, or if it showed a unique band for the
recipient only. Once an informative locus was identified, genomic DNA
from subsequent samples after transplant samples at various time points
was amplified with that specific primer to follow hematopoietic
chimerism. On the occasion that the donor to a male patient was female,
male-specific primers to testis-determining factor (5'
primer GAATATTCCCGCTCTCCGGA; 3' primerGCTGGTGCTCCATTCTTGAG)
were used to detect chimerism.
Statistical analysis
Based on the spectratype complexity scores of 10 normal donors, we
established a score of 142, based on the 95% lower confidence interval, as the lower limit of normal. The Student t test was used to assess the difference in V complexity between the normal donors and the pretransplant profiles of the patients. We used the
Fisher exact test to assess the association between patient characteristics and the achievement of normal V complexity.
Spearman's rank correlation was used to examine the relationship
between complexity score and lymphocyte counts. Analyses were based on samples available before cytogenetic relapse.
| |
Results |
Patient characteristics
The clinical characteristics of the 11 patients studied are
summarized in Table 2. All patients, aged
31 to 57 years (median, 43 years), underwent allogeneic HLA-matched
sibling BMT at the Dana-Farber Cancer Institute between January 1990 and August 1993. Ten patients were in stable phase CML at the time of
transplantation; patient 1 was in accelerated phase CML after relapse
from his first BMT performed 5 years earlier. Only 2 patients received IFN- before BMT. Ten patients were conditioned with cyclophosphamide and total body irradiation (TBI); patient 1 received busulfan and
cyclophosphamide. Patients 2, 3, and 10 received splenic irradiation (750 cGy) just before conditioning. In each case, donor marrow was
depleted of CD6+ T cells as previously described.21
Phenotypic analysis of the marrow product revealed that CD3+ cells
constituted 10% to 27% of mononuclear cells prior to T-cell depletion
(mean, 2.35 × 107 CD3+ cells/kg). Following T-cell
depletion, marrows contained 0.1 to 1.5 × 106 CD3+
cells/kg (mean, 0.78 × 106). Patients received no
other immunosuppressive therapy to prevent GVHD after BMT.
Hematopoietic engraftment with donor cells was documented in each
patient. After transplantation, 9 patients received low-dose
interleukin-2 (IL-2) (3-6 × 105 U/m2/d)
for approximately 12 weeks beginning 3 months after BMT. None of the
patients developed greater than grade 1 acute GVHD after BMT, and none
received systemic immunosuppressive therapy after BMT. No patients
received IFN- after transplant. Patients 1 through 6 developed
evidence of cytogenetic relapse 6 to 36 months after transplantation.
Patients 7 through 11 have remained free of disease for 5 to 8 years
after transplantation.
Comparison of TCR V gene repertoire between normal individuals
(donors) and CML patients
To determine if there were differences in TCR V repertoire
diversity between normal individuals and patients with CML before transplantation, the pretransplant profiles of both populations were
compared. Profiles of 10 normal donors were examined, and consistent
with our previous observations, 7 donors demonstrated a completely
"normal" TCR repertoire profile based on the predominantly polyclonal distribution of spectratypes across every TCR V gene family17 (Figure 1A). However,
2 of the 10 normal individuals demonstrated 4 to 6 oligoclonal
subfamilies, and 1 donor had 4 monoclonal subfamilies. In reviewing the
clinical histories of each donor, they had no known concurrent
illnesses at the time of sample procurement. In contrast, the
pretransplant profiles of the 8 CML patients with samples available
were more heterogeneous. Some profiles appeared almost as complex and
diverse as those of the normals, whereas others demonstrated numerous
abnormalities. In the example shown in Figure 1B, V subfamilies 12, 21, and 24 were absent; V subfamilies 1, 10, 13.2, and 15 exhibited
monoclonal spikes, and subfamilies 8, 11, 13.1, 14, 16, 18, 20, and 23 demonstrated oligoclonal patterns.
To quantify changes in the TCR V gene repertoire, we created a
complexity scoring system, calculated from the summation of the number
of peaks visualized in each subfamily. The comparison of complexity
scores for all normal donors and CML patients before BMT is shown in
Figure 2. Of a maximum complexity score of
208, the mean score of 10 normal donors was 183 (SD 25), whereas the mean score of the CML patient samples was 131 (SD 25). This difference was highly statistically significant, P = 0.0007, by the
Student t test.
View larger version (13K):
[in this window]
[in a new window]
| Fig 2.
Comparison of spectratype complexity scores of
pretransplant recipients versus normal donors (P = 0.0007,
Student t test).
Mean complexity scores are denoted by the bar lines.
|
|
Evolution of TCR V spectratyping after transplantation
To guide the analysis of TCR repertoire, we initially evaluated the
reconstitution of T, B, and natural killer (NK) cells by
immunophenotypic analysis of PBMC after BMT (Figure
3). This analysis revealed the gradual
increase in total number of CD3+ T cells to a level of approximately
30% of PBMC by 3 to 6 months after BMT. The mean absolute number of
CD3+ cells increased from 412/µL at 3 months after BMT to 624/µL at
6 months after BMT. This was a statistically significant increase in
cell number (P = 0.03, Student t test). Closer
examination of the mononuclear cell phenotype revealed that CD56+ NK
cells contributed to the majority of the recovered lymphocytes during
the immediate posttransplant period, followed by a gradual fall in the
percentage of NK cells as the number of T cells increased. After
transplantation, CD8+ cells were also proportionally increased in
number, comprising approximately 40% of PBMC at 3 months after
transplant. CD4+ cells were proportionally low at early as well as late
time points and recovered slowly and gradually over time. At 3 months
after BMT, the average CD8+/CD4+ ratio was 4:1. At 6 months, the ratio
evolved to 3:1. At 12 months and thereafter, it was 1.5:1. No
differences in recovery of cell numbers in the various lymphocyte
subsets were noted between patients who later developed complete donor hematopoiesis (CDH) or mixed chimerism (MC) or who eventually relapsed
or remained in continuous remission.
View larger version (27K):
[in this window]
[in a new window]
| Fig 3.
Phenotypic analysis of lymphocyte subsets by (A)
percentage and (B) by absolute cell numbers at various times after
transplant.
|
|
We next examined changes in TCR V subfamily profiles at various
times after allogeneic BMT. Examples of spectratypes obtained at 3, 6, and 36 months after BMT for 2 patients are shown in Figures 4 and
5. These are
representative of the 2 patterns of repertoire evolution that emerged
in the analyses. In all patients, the early time points were remarkable
for the predominance of many monoclonal and biclonal peaks as well as
several absent subfamilies (see Figures 4A and 5A). At 6 months after
BMT, 7 patients continued to possess remarkably skewed and limited
repertoires (see Figure 5B), whereas 4 patients began to demonstrate
restoration in the complexity of many V subfamilies (see Figure 4B).
The TCR profiles of these latter 4 patients continued to normalize over
the course of 18 months (see Figure 4C). In contrast, 3 of the 7 patients of the former group continued to have evaluable samples at
later time points (18, 24, and 36 months) and had persistently skewed repertoires at these later times (see Figure 5C).
View larger version (242527K):
[in this window]
[in a new window]
| Fig 4.
TCR V repertoire profiles for patient 7 at (A) 3 months, (B) 6 months, and (C) 3 years after transplant.
|
|
View larger version (252424K):
[in this window]
[in a new window]
| Fig 5.
TCR V repertoire profiles of patient 3 at (A) 3 months, (B) 6 months, and (C) 3 years after transplant.
|
|
To quantify the changes in TCR V subfamilies over time, complexity
scores were assigned to each sample analyzed following transplantation
(Figure 6). Excluded from the analysis were
samples derived from time points after the diagnosis of relapse, as
defined by the presence of detectable cytogenetic disease. Because the number of mature CD3+ cells in the infused marrow product or in the
circulating blood might affect the degree of V complexity, we
examined whether V complexity score was correlated with the number
of circulating T cells in peripheral blood. By Spearman's rank
correlation, no relationship between complexity and absolute CD3+ cell
counts, calculated based on phenotypic analysis of PBMC from the same
time point and patient, but obtained from a separate sample, was seen.
Based on the analysis of 10 normal donors, we calculated a score of 142 to be the lower limit of the 95% confidence interval for the mean of
the normals. At 3 months after BMT, there was a dramatic decrease in
mean complexity score (87) in all patients, compared with pretransplant
scores. At 6 and 12 months, there was an overall increase in mean
complexity scores to 102 and 98, respectively. By 18 months after BMT
and thereafter, mean complexity scores (range, 134-140) approached the
score of 142, which was considered the lower limit of the normal range.
View larger version (15K):
[in this window]
[in a new window]
| Fig 6.
Evolution of spectratype complexity in 11 patients with
CML, following T-cell-depleted allogeneic BMT.
The dotted line denotes the lower limit of the 95% confidence interval
of normal range (142). The solid line represents the mean complexity
scores calculated from all 11 patients at various time
points, with the error bars representing the standard deviation.
|
|
Hematopoietic chimerism
To examine whether the reconstituted peripheral blood or marrow was
derived from donors or recipients, we analyzed microsatellite regions
of genomic DNA for the presence of male-specific markers to distinguish
between hematopoiesis of donor and recipient origin at serial time
points. Informative microsatellite regions were identified for 10 of 11 donor-recipient pairs. Chimerism for patient 6 was detected by PCR
analysis using male-specific primers to testis-determining factor. The
presence of a unique recipient microsatellite polymorphism or male
cells in patient samples was evidence of continued recipient
contribution to hematopoiesis. As summarized in Table
3, Patients 1, 3, 4, 5, and 6 all
demonstrated persistence of recipient-derived cells at each time point,
beginning at 3 months after BMT, the first time point we analyzed. In
contrast, patients 7, 9, 10, and 11 consistently demonstrated only
donor hematopoiesis at all time points. Patients 2 and 8 demonstrated MC at 3 months, had no evidence of recipient cells at 6 months, but
reverted to MC by 12 months after transplant.
TCR V complexity scores are associated with chimeric status
After determining that 4 patients (patients 7, 9, 10, 11) had CDH
and 7 patients had MC following transplantation, we examined whether
the presence of hematopoietic chimerism was associated with the
reconstitution of TCR diversity. When patients with CDH were compared
with those with MC, striking differences were seen in their complexity
scores over time (Figure 7). At 3 months
after transplant, samples from both groups of patients had abnormally low complexity scores. Scores remained low in the patients with MC, but
scores began to improve at 6 months after BMT in the patients with CDH.
By 24 months, the scores in CDH patients had normalized and they
remained normal at 36 months after BMT. In contrast, complexity scores
remained low in all MC patients who remained evaluable. Using the
Fisher exact test, we determined that patients with CDH are
statistically more likely to attain normalization of the V
repertoire than patients with MC (P = 0.003), with the differences becoming more evident 6 months or longer after
transplantation. These changes in V complexity scores were also
associated with relapse, because none of the patients with CDH relapsed
and 6 of 7 patients with MC relapsed after BMT. Of note, patient 8 is the only patient with MC who did not relapse, but has continued to have
abnormally low complexity scores for 5 years after BMT (data not
shown).
View larger version (19K):
[in this window]
[in a new window]
| Fig 7.
Evolution of spectratype complexity in patients with
mixed hematopoietic chimerism or complete donor hematopoiesis.
Open symbols around the dashed line represent the MC mean complexity
scores, and solid symbols around the solid line, the CDH mean
complexity scores. The dotted line denotes the lower limit of normal
range (142) of values defined by the 95% confidence interval of
results from 10 normal donors.
|
|
| |
Discussion |
Previous studies have suggested that after myeloablative therapy
reconstitution of the T-cell repertoire is derived primarily from
expansion of mature T cells present within the stem cell graft. In the
period of early reconstitution after autologous or allogeneic BMT,
these T cells are predominately CD45RO+ and do not represent
naïve CD45RA+ T cells.3,22,23 The T-cell repertoire
appears to be markedly abnormal within the first 3 months after
transplant in all patients, but deficiency of the repertoire appears to
be more extensive in patients who receive highly purified CD34+
progenitors or T-cell-depleted stem cells.24,25 Reconstitution of the TCR repertoire with CD45RA+ cells appears to
occur more rapidly in pediatric patients who likely retain more thymic
function than adult patients.1,2 However, little is known
about the mechanisms whereby the T-cell repertoire is reconstituted and
the factors that influence the extent of reconstitution from
undifferentiated lymphoid progenitors in either pediatric or adult patients.
We carried out the present studies to better define reconstitution of
T-cell immunity after allogeneic BMT. This analysis was undertaken in a
homogenous group of 11 adult patients with CML who received
myeloablative therapy followed by transplantation of T-cell-depleted
marrow from HLA-identical sibling donors. None of the patients received
immune suppressive therapy after BMT and none developed
clinically evident GVHD. We began by examining the kinetics of
recovery of phenotypically mature lymphoid cells and the major T-cell
subsets. These results are consistent with previously published reports
from our group as well as others demonstrating that CD56+ CD3 NK
cells are the first lymphoid cells to return, followed by CD8+ T
cells.26,27 By 6 to12 months after transplantation, all
patients attained relatively normal numbers of circulating CD3+ T
cells. However, the CD4+ T-cell population returned slowly in these
patients resulting in an inversion of the normal CD4/CD8 ratio for more
than 1 year after BMT.28-30 Our analysis
revealed a fairly uniform rate of recovery of phenotypically mature
lymphocytes among this group of relatively homogenous patients, irrespective of their eventual clinical outcome.
Having observed the reconstitution of phenotypically mature T cells in
peripheral blood, we next undertook an extensive analysis of CDR3
spectratypes to better characterize regeneration of TCR repertoire at
various times after BMT. We developed a quantitative scoring schema to
measure the degree of TCR repertoire deficiency in each sample and
found that there was a statistically significant difference between
normal donors and patients with CML before transplant
(P = 0.007). As expected, normal donors possess complex and
diverse spectratypes. In contrast, the spectratypes of the patients
with CML before transplant were quite heterogeneous. We did not find
this result surprising, because the patients presented with varying
severity of illness and had received different therapies for varying
periods of time before BMT. For example, patient 3 received IFN- for
4 years before transplant. Patient 1 had already had a prior BMT and
had a particularly low pretransplant complexity score of 97. Patient 7 had developed infectious hepatitis before transplant and also had a low
score of 119. The other patients presented with good to intermediate
prognosis stable phase CML and had pretransplant complexity scores
ranging from 133 to 179. Although our results indicate a statistically
significant difference between donors and patients with CML before
transplant, our analysis of a limited cohort of patients does not
clearly identify the cause of this difference. It is possible that the
presence of leukemia alone causes derangements in T-cell repertoire.
Alternately, the stage of disease, prior therapy, other concurrent
illnesses, or any combination of these factors may influence T-cell
repertoire. However, it is important to note that neither the degree of
CDR3 complexity of the donors nor of the patients before transplant appeared to correlate with eventual clinical outcome or the
reconstitution of T-cell repertoire after allogeneic BMT.
At 3 months after BMT, all patients had marked abnormalities in their
spectratypes, with many V subfamilies demonstrating monoclonal or
oligoclonal profiles, consistent with clonal expansion of distinct
T-cell populations. These clonally expanded cells may represent
expansion of peripheral T-cell populations in response to a stimulating
antigen, such as an infectious agent (although none of the patients had
evidence of an obvious infection) or alloantigen. Alternatively, these
may represent the peripheral clonal expansion of a limited number of T
cells that remained present in the marrow graft despite T-cell
depletion. By 6 months after transplant, 2 distinct patterns of
reconstitution of TCR repertoire became evident. Seven patients
continued to have markedly abnormal profiles and these abnormalities
persisted at later time points (12, 18, 24, and 36 months). In
contrast, 4 other patients began to demonstrate evidence of
normal, polyclonal expanded V subfamilies at 6 months after
transplant, with continued normalization of complexity at later time
points. In comparing these 2 groups of patients, clinical parameters
such as age, gender, number of mature CD3+ cells infused in the bone
marrow product, and presence of GVHD or cytomegalovirus infection could
not account for these differences. Moreover, 9 of the 11 patients had
received low-dose IL-2 for extended periods after BMT, but neither
treatment with IL-2 nor duration of IL-2 exposure appeared to affect
repertoire development (data not shown).
Although spectratyping allows the detection of subtle changes in the
T-cell repertoire, this method cannot discern the origin of the T cells
examined. We therefore complemented our analysis of TCR repertoire with
an examination of hematopoietic chimerism. It has previously been
established that patients can become mixed (donor/host) chimeras
after BMT and that MC occurs more frequently after T-cell-depleted
marrow transplants.31 When sensitive PCR-based methods are
used, MC has been estimated to occur in 80% to 90% of patients after
T-cell-depleted BMT.32,33 The presence of MC suggests that
recipient hematopoietic elements frequently survive the myeloablative
regimen. In our patients, PCR analysis of informative microsatellite
polymorphisms or male-specific gene expression documented MC in 7 of 11 patients at 3 months after BMT. Although recipient cells were not
detected in all subsequent samples in some of these patients, each of
these individuals eventually developed stable MC. When the results of
the chimerism assays were correlated with the spectratyping analysis,
it became evident that none of the 7 patients with stable MC
demonstrated reconstitution of a normal TCR repertoire. In contrast,
normalization of the V repertoire was noted in each of the 4 patients who converted to CDH and persistent recipient hematopoiesis
could not be detected by PCR. This close correlation strongly suggests
that the persistence of recipient hematopoiesis affected the
reconstitution of a normal TCR repertoire after allogeneic BMT.
Although the persistence of recipient cells appears to influence the
reconstitution of a normal TCR repertoire, it is not known whether this
effect is due to the presence of either leukemic or normal
hematopoietic cells. Six of the 7 patients with MC later developed
cytogenetic relapse, and in these individuals, the presence of
recipient cells detectable by PCR may have reflected the presence of
leukemia cells rather than normal hematopoietic elements. Patient 8, however, has remained in cytogenetic remission for 8 years after BMT
despite the persistence of recipient cells detected by microsatellite
PCR. In this individual, recipient cells detected by PCR are not likely
to be derived from the CML clone and yet this patient has also not
demonstrated reconstitution of a normal TCR repertoire. The last sample
examined for TCR repertoire in this patient was obtained 5 years after
BMT and continued to demonstrate a markedly abnormal spectratype.
Although this finding has only been demonstrated in a single
individual, these results suggest that the presence of recipient cells,
regardless of leukemic or non-CML origin, has an important influence on
repertoire development after transplant.
In considering how the presence of recipient cells may affect T-cell
repertoire development, we may extrapolate from the experience with
well-defined murine models of peripheral T-cell repertoire development.
In thymectomized mice, maintenance of mature T cells in the peripheral
pool has been demonstrated to be an active process, requiring
continuous TCR ligation by MHC molecules.34,35 Moreover, affinity and duration of exposure to antigen can determine whether the
responding T-cell population is expanded or deleted.36,37 In our patients, the persistence of recipient cells results in the
continued presence of alloantigens (e.g., minor histocompatibility antigens [mHAgs]), unfamiliar to donor origin T-cell precursors. We
hypothesize that the persistent expression and presentation of
recipient mHAgs may exert a profound effect on repertoire development, perhaps by causing expansion or deletion of reactive T cells resulting in a collapsed repertoire. Evidence suggests that such mHAgs play an
important role in the GVHD and graft-versus-leukemia
responses.38,39 Increasing numbers of mHAgs have recently
been identified, and though many mHAgs have ubiquitous tissue
distribution, it has been shown that the expression of some mHAgs is
restricted to hematopoietic cells and leukemia cells.40
Importantly, it has been recently demonstrated that specific cytotoxic
T lymphocytes can be generated against mHAgs from the blood of patients
with hematologic malignancies.40,41 Taken together, these
findings support the notion that mHAgs expressed in the recipient may
be important immunologic targets of the donor immune system and may also influence the reconstitution of T-cell repertoire after allogeneic BMT.
| |
Footnotes |
Submitted March 18, 1999; accepted August 25, 1999.
Supported by National Institutes of Health Grant AI29530.
E.P.A. is a special fellow of the Leukemia Society of America;
R.J.S. is a scholar in clinical research of the Leukemia Society of
America; C.J.W. is a physician postdoctoral fellow of the Howard Hughes
Medical Institute.
Reprints: Jerome Ritz, Dana-Farber Cancer Institute, 44 Binney St., Boston, MA 02115; e-mail: jerome_ritz{at}dfci.harvard.edu.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
| |
References |
1.
Mackall CL, Granger L, Sheard MA, Cepeda R, Gress RE.
T-cell regeneration after bone marrow transplantation: differential CD45 isoform expression on thymic-derived versus thymic-independent progeny.
Blood.
1993;82:2585-2594[Abstract/Free Full Text].
2.
Mackall CL, Fleisher TA, Brown MR, et al.
Age, thymopoiesis, and CD4+ T-lymphocyte regeneration after intensive chemotherapy.
N Engl J Med.
1995;332:143-149[Abstract/Free Full Text].
3.
Roux E, Helg C, Dumont-Girard F, Chapuis B, Jeannet M, Roosnek E.
Analysis of T cell repopulation after allogeneic bone marrow transplantation: significant differences between recipients of T cell depleted and unmanipulated grafts.
Blood.
1996;87:3984-3992[Abstract/Free Full Text].
4.
Rowen L, Koop BF, Hood L.
The complete 685-kilobase DNA sequence of the human T cell receptor locus.
Science.
1996;272:1755-1762[Abstract].
5.
Gorski J, Yassai M, Zhu X, Kissella B, Keever C, Flomenberg N.
Circulating T cell repertoire complexity in normal individuals and bone marrow recipients analyzed by CDR3 size spectratyping: correlation with immune status.
J Immunol.
1994;152:5109-5119[Abstract].
6.
Genevee C, Diu A, Nierat J, et al.
An experimentally validated panel of subfamily-specific oligonucleotide primers (V alpha 1-w29/Vbeta 1-w24) for the study of human T cell receptor variable V gene segment usage by polymerase chain reaction.
Eur J Immunol.
1992;22:1261-1269[Medline]
[Order article via Infotrieve].
7.
Dietrich PY, Caignard A, Lim A, et al.
In vivo T-cell clonal amplification at time of acute graft-versus-host disease.
Blood.
1994;84:2815-2820[Abstract/Free Full Text].
8.
Kubo K, Yamanaka K, Kiyoi H, et al.
Different T-cell receptor repertoires between lesions and peripheral blood in acute graft-versus-host disease after allogeneic bone marrow transplantation.
Blood.
1996;87:3019-3026[Abstract/Free Full Text].
9.
Masuko K, Kato SI, Hagihara M, et al.
Stable clonal expansion of T cells induced by bone marrow transplantation.
Blood.
1996;87:789-799[Abstract/Free Full Text].
10.
Silins SL, Cross SM, Krauer KG, Moss DJ, Schmidt CW, Misko IS.
A functional link for major TCR expansions in healthy adults caused by persistent Epstein-Barr virus infection.
J Clin Invest.
1998;102:1551-1558[Medline]
[Order article via Infotrieve].
11.
Sourdive DJD, Murali-Krishna K, Altman JD, et al.
Conserved T cell receptor repertoire in primary and memory CD8 T cell responses to an acute viral infection.
J Exp Med.
1998;188:71-82[Abstract/Free Full Text].
12.
Gran B, Gestri D, Sottini A, et al.
Detection of skewed T-cell receptor V-beta gene usage in the peripheral blood of patients with multiple sclerosis.
J Neuroimmunol.
1998;85:22-32[Medline]
[Order article via Infotrieve].
13.
Liu X, Chesnokova V, Forman SJ, Diamond DJ.
Molecular analysis of T-cell receptor repertoire in bone marrow transplant recipients: evidence for oligoclonal T-cell expansion in graft-versus-host disease lesions.
Blood.
1996;87:3032-3044[Abstract/Free Full Text].
14.
Kim G, Tanuma N, Kojima T, et al.
CDR3 size spectratyping and sequencing of spectratype-derived TCR of spinal cord T cells in autoimmune encephalomyelitis.
J Immunol.
1998;160:509-513[Abstract/Free Full Text].
15.
Douillard P, Josien R, Pannetier C, Bonneville M, Soulillou JP, Cuturi JP.
Selection of T cell clones with restricted TCR-CDR3 lengths during in vitro and in vivo alloresponses.
Int Immunol.
1998;10:71-83[Abstract/Free Full Text].
16.
Kluin-Nelemans HC, Kester MGD, Corput L, et al.
Correction of abnormal T-cell receptor repertoire during interferon-alpha therapy in patients with hairy cell leukemia.
Blood.
1998;91:4224-4231[Abstract/Free Full Text].
17.
Claret EJ, Alyea EP, Orsini E, et al.
Characterization of T cell repertoire in patients with graft-versus-leukemia after donor lymphocyte infusion.
J Clin Invest.
1997;100:855-866[Medline]
[Order article via Infotrieve].
18.
Choi YW, Kotzin B, Herron J, Callahan J, Marrack P, Kappler J.
Interaction of Staphylococcus aureus toxin superantigens with human T cells.
Proc Natl Acad Sci U S A.
1989;86:8941-8945[Abstract/Free Full Text].
19.
Oberkircher AR, Strout MP, Herzig GP, Fritz PD, Caligiuri MA.
Description of an efficient and highly informative method for the evaluation of hematopoietic chimerism following allogeniec bone marrow transplantation.
Bone Marrow Transplant.
1995;16:695-702[Medline]
[Order article via Infotrieve].
20.
Weissenbach J, Gyapay G, Dib C, et al.
A second-generation linkage map of the human genome.
Nature.
1992;359:794-801[Medline]
[Order article via Infotrieve].
21.
Soiffer RJ, Murray C, Mauch P, et al.
Prevention of graft-versus-host disease by selective depletion of CD6-positive T lymphocytes from donor bone marrow.
J Clin Oncol.
1992;10:1191-1200[Abstract].
22.
Sugita K, Soiffer RJ, Murray C, Schlossman SF, Ritz J, Morimoto C.
The phenotype and reconstitution of immunoregulatory T cell subsets after T cell-depleted allogeneic and autologous bone marrow transplantation.
Transplantation.
1994;57:1465-1473[Medline]
[Order article via Infotrieve].
23.
Dumont-Girard F, Roux E, van Lier RA, et al.
Reconstitution of the T-cell compartment after bone marrow transplantation: restoration of the repertoire by thymic emigrants.
Blood.
1998;92:4464-4471[Abstract/Free Full Text].
24.
Akatsuka Y, Cerveny C, Jansen JA.
T cell receptor clonal diversity following allogeneic marrow grafting.
Human Immunol.
1996;48:125[Medline]
[Order article via Infotrieve].
25.
Bomberger C, Singh-Jairam M, Rodey G, et al.
Lymphoid reconstitution after autologous PBSC transplantation with FACS-sorted CD34+ hematopoietic progenitors.
Blood.
1998;91:2588-2600[Abstract/Free Full Text].
26.
Ault KE, Antin JH, Ginsburg D.
Phenotype of recovering lymphoid cell populations after marrow transplantation.
J Exp Med.
1985;161:1483-1502[Abstract/Free Full Text].
27.
Soiffer RJ, Bosserman L, Murray C, Cochran K, Daley J, Ritz J.
Reconstitution of T cell function after CD6-depleted allogeneic bone marrow transplantation.
Blood.
1990;75:2076-2084[Abstract/Free Full Text].
28.
Keever CA, Small TN, Flomenberg N.
Immune reconstitution following bone marrow transplantation: comparison of recipients of T-cell depleted marrow with recipients of conventional marrow grafts.
Blood.
1989;73:1340-1350[Abstract/Free Full Text].
29.
Forman SJ, Nocker P, Gallagher M.
Pattern of T cell reconstitution following allogeneic bone marrow transplantation for acute hematological malignancy.
Transplantation.
1982;34:96-98[Medline]
[Order article via Infotrieve].
30.
Small TN, Papadopoulos EB, Boulad F, et al.
Comparison of immune reconstitution after unrelated and related T-cell-depleted bone marrow transplantation: effect of patient age and donor leukocyte infusions.
Blood.
1999;93:467-480[Abstract/Free Full Text].
31.
Roy DC, Tantravahi R, Murray C, et al.
Natural history of mixed chimerism after bone marrow transplantation with CD6-depleted allogeneic marrow: a stable equilibrium.
Blood.
1990;75:296-304[Abstract/Free Full Text].
32.
Bertheas MF, Maraninchi D, Lafage M, et al.
Partial chimerism after T-cell depleted allogeneic bone marrow transplantation in leukemic HLA-matched patients: a cytogenetic documentation.
Blood.
1988;72:89-93[Abstract/Free Full Text].
33.
Lawler M, Humphries P, McCann SR.
Evaluation of mixed chimerism by in vitro amplification of dinucleotide repeat sequences using the polymerase chain reaction.
Blood.
1991;77:2504-2514[Abstract/Free Full Text].
34.
Rocha B, von Boehmer H.
Peripheral selection of the T cell repertoire.
Science.
1991;251:1225-1228[Abstract/Free Full Text].
35.
Tanchot C, Rocha B.
The organization of mature T-cell pools.
Immunol Today.
1998;19:575-579[Medline]
[Order article via Infotrieve].
36.
Rocha B, Grandien A, Freitas AA.
Anergy and exhaustion are independent mechanisms of pe-ripheral T cell tolerance.
J Exp Med.
1995;181:993-1003[Abstract/Free Full Text].
37.
Ghendler Y, Teng M, Liu J, et al.
Differential thymic selection outcomes stimulated by focal structural alteration in peptide/major histocompatibility complex ligands.
Proc Natl Acad Sci U S A.
1998;95:10,061-10,066[Abstract/Free Full Text].
38.
Goulmy E, Schipper R, Pool J, et al.
Mismatches of minor histocompatibility antigens between HLA-identical donors and recipients and the development of graft-versus-host disease after bone marrow transplantation.
N Engl J Med.
1996;334:281-285[Abstract/Free Full Text].
39.
Goulmy E.
Human minor histocompatibility antigens: new concepts for marrow transplantation and adoptive immunotherapy.
Immunol Rev.
1997;157:125-140[Medline]
[Order article via Infotrieve].
40.
Warren EH, Greenberg PD, Riddell SR.
Cytotoxic T-lymphocyte-defined human minor histocompatibility antigens with a restricted tissue distribution.
Blood.
1998;91:2197-2207[Abstract/Free Full Text].
41.
Dolstra H, Fredrix H, Maas F, et al.
A human minor histocompatibility antigen specific for B cell acute lymphoblastic leukemia.
J Exp Med.
1999;189:301-308[Abstract/Free Full Text].
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
P. Truong and D. B. McGavern
A Novel Virus Carrier State to Evaluate Immunotherapeutic Regimens: Regulatory T Cells Modulate the Pathogenicity of Antiviral Memory Cells
J. Immunol.,
July 15, 2008;
181(2):
1161 - 1169.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. W. Rossi, L. T. Jeker, T. Ueno, S. Kuse, M. P. Keller, S. Zuklys, A. V. Gudkov, Y. Takahama, W. Krenger, B. R. Blazar, et al.
Keratinocyte growth factor (KGF) enhances postnatal T-cell development via enhancements in proliferation and function of thymic epithelial cells
Blood,
May 1, 2007;
109(9):
3803 - 3811.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Fozza, E. Nadal, M. Longinotti, and F. Dazzi
T-cell receptor repertoire usage after allografting differs between CD4+CD25+ regulatory T cells and their CD4+CD25 counterpart
Haematologica,
February 1, 2007;
92(2):
206 - 214.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. G. Meyer, C. M. Britten, D. Wehler, K. Bender, G. Hess, A. Konur, U. F. Hartwig, T. C. Wehler, A. J. Ullmann, C. Gentilini, et al.
Prophylactic transfer of CD8-depleted donor lymphocytes after T-cell-depleted reduced-intensity transplantation
Blood,
January 1, 2007;
109(1):
374 - 382.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. E. Albers, C. Visus, T. Tsukishiro, R. L. Ferris, W. Gooding, T. L. Whiteside, and A. B. De Leo
Alterations in the T-Cell Receptor Variable {beta} Gene-Restricted Profile of CD8+ T Lymphocytes in the Peripheral Circulation of Patients with Squamous Cell Carcinoma of the Head and Neck
Clin. Cancer Res.,
April 15, 2006;
12(8):
2394 - 2403.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K.-i. Yamanaka, R. Clark, B. Rich, R. Dowgiert, K. Hirahara, D. Hurwitz, M. Shibata, N. Mirchandani, D. A. Jones, D. S. Goddard, et al.
Skin-derived interleukin-7 contributes to the proliferation of lymphocytes in cutaneous T-cell lymphoma
Blood,
March 15, 2006;
107(6):
2440 - 2445.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K.-i. Yamanaka, R. Clark, R. Dowgiert, D. Hurwitz, M. Shibata, B. E. Rich, K. Hirahara, D. A. Jones, S. Eapen, H. Mizutani, et al.
Expression of Interleukin-18 and Caspase-1 in Cutaneous T-Cell Lymphoma
Clin. Cancer Res.,
January 15, 2006;
12(2):
376 - 382.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K.-i. Yamanaka, N. Yawalkar, D. A. Jones, D. Hurwitz, K. Ferenczi, S. Eapen, and T. S. Kupper
Decreased T-Cell Receptor Excision Circles in Cutaneous T-Cell Lymphoma
Clin. Cancer Res.,
August 15, 2005;
11(16):
5748 - 5755.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. M. Sloand, L. Mainwaring, M. Fuhrer, S. Ramkissoon, A. M. Risitano, K. Keyvanafar, J. Lu, A. Basu, A. J. Barrett, and N. S. Young
Preferential suppression of trisomy 8 compared with normal hematopoietic cell growth by autologous lymphocytes in patients with trisomy 8 myelodysplastic syndrome
Blood,
August 1, 2005;
106(3):
841 - 851.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. D. Shultz, B. L. Lyons, L. M. Burzenski, B. Gott, X. Chen, S. Chaleff, M. Kotb, S. D. Gillies, M. King, J. Mangada, et al.
Human Lymphoid and Myeloid Cell Development in NOD/LtSz-scid IL2R{gamma}null Mice Engrafted with Mobilized Human Hemopoietic Stem Cells
J. Immunol.,
May 15, 2005;
174(10):
6477 - 6489.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
X. Chen, R. Barfield, E. Benaim, W. Leung, J. Knowles, D. Lawrence, M. Otto, S. A. Shurtleff, G. A. M. Neale, F. G. Behm, et al.
Prediction of T-cell reconstitution by assessment of T-cell receptor excision circle before allogeneic hematopoietic stem cell transplantation in pediatric patients
Blood,
January 15, 2005;
105(2):
886 - 893.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Lu, A. Basu, J. J. Melenhorst, N. S. Young, and K. E. Brown
Analysis of T-cell repertoire in hepatitis-associated aplastic anemia
Blood,
June 15, 2004;
103(12):
4588 - 4593.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Yawalkar, K. Ferenczi, D. A. Jones, K. Yamanaka, K.-Y. Suh, S. Sadat, and T. S. Kupper
Profound loss of T-cell receptor repertoire complexity in cutaneous T-cell lymphoma
Blood,
December 1, 2003;
102(12):
4059 - 4066.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Rivera, C.-C. Chen, J. P. Dougherty, A. Ben-Nun, and Y. Ron
Host stem cells can selectively reconstitute missing lymphoid lineages in irradiation bone marrow chimeras
Blood,
June 1, 2003;
101(11):
4347 - 4354.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Orsini, R. Bellucci, E. P. Alyea, R. Schlossman, C. Canning, S. McLaughlin, P. Ghia, K. C. Anderson, and J. Ritz
Expansion of Tumor-specific CD8+ T Cell Clones in Patients with Relapsed Myeloma after Donor Lymphocyte Infusion
Cancer Res.,
May 15, 2003;
63(10):
2561 - 2568.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Sarzotti, D. D. Patel, X. Li, D. A. Ozaki, S. Cao, S. Langdon, R. E. Parrott, K. Coyne, and R. H. Buckley
T Cell Repertoire Development in Humans with SCID After Nonablative Allogeneic Marrow Transplantation
J. Immunol.,
March 1, 2003;
170(5):
2711 - 2718.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. P. Hochberg, D. B. Miklos, D. Neuberg, D. A. Eichner, S. F. McLaughlin, A. Mattes-Ritz, E. P. Alyea, J. H. Antin, R. J. Soiffer, and J. Ritz
A novel rapid single nucleotide polymorphism (SNP)-based method for assessment of hematopoietic chimerism after allogeneic stem cell transplantation
Blood,
January 1, 2003;
101(1):
363 - 369.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Konno, K. Okada, K. Mizuno, M. Nishida, S. Nagaoki, T. Toma, T. Uehara, K. Ohta, Y. Kasahara, H. Seki, et al.
CD8alpha alpha memory effector T cells descend directly from clonally expanded CD8alpha +beta high TCRalpha beta T cells in vivo
Blood,
December 1, 2002;
100(12):
4090 - 4097.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Eyrich, T. Croner, C. Leiler, P. Lang, P. Bader, T. Klingebiel, D. Niethammer, and P. G. Schlegel
Distinct contributions of CD4+ and CD8+ naive and memory T-cell subsets to overall T-cell-receptor repertoire complexity following transplantation of T-cell-depleted CD34-selected hematopoietic progenitor cells from unrelated donors
Blood,
August 13, 2002;
100(5):
1915 - 1918.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Zorn, K. S. Wang, E. P. Hochberg, C. Canning, E. P. Alyea, R. J. Soiffer, and J. Ritz
Infusion of CD4+ Donor Lymphocytes Induces the Expansion of CD8+ Donor T Cells with Cytolytic Activity Directed against Recipient Hematopoietic Cells
Clin. Cancer Res.,
July 1, 2002;
8(7):
2052 - 2060.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Bellucci, E. P. Alyea, E. Weller, A. Chillemi, E. Hochberg, C. J. Wu, C. Canning, R. Schlossman, R. J. Soiffer, K. C. Anderson, et al.
Immunologic effects of prophylactic donor lymphocyte infusion after allogeneic marrow transplantation for multiple myeloma
Blood,
May 29, 2002;
99(12):
4610 - 4617.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Talvensaari, E. Clave, C. Douay, C. Rabian, L. Garderet, M. Busson, F. Garnier, D. Douek, E. Gluckman, D. Charron, et al.
A broad T-cell repertoire diversity and an efficient thymic function indicate a favorable long-term immune reconstitution after cord blood stem cell transplantation
Blood,
February 15, 2002;
99(4):
1458 - 1464.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. T. Ho and R. J. Soiffer
The history and future of T-cell depletion as graft-versus-host disease prophylaxis for allogeneic hematopoietic stem cell transplantation
Blood,
December 1, 2001;
98(12):
3192 - 3204.
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. P. Hochberg, A. C. Chillemi, C. J. Wu, D. Neuberg, C. Canning, K. Hartman, E. P. Alyea, R. J. Soiffer, S. A. Kalams, and J. Ritz
Quantitation of T-cell neogenesis in vivo after allogeneic bone marrow transplantation in adults
Blood,
August 15, 2001;
98(4):
1116 - 1121.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction
