|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 95 No. 1 (January 1), 2000:
pp. 48-55
CLINICAL OBSERVATIONS, INTERVENTIONS, AND THERAPEUTIC TRIALS
Changes in human immunodeficiency virus type 1 virus load
during mobilization and harvesting of hemopoietic progenitor cells
Thomas B. Campbell,
Anne Sevin,
Robert W. Coombs,
Gregory C. Peterson,
Mary Rosandich,
Daniel R. Kuritzkes,
Jeannette Mladenovic,
Alan Landay,
Roberta Wong,
Daniel Ambruso,
Steve Miles,
Roger J. Pomerantz,
Robert T. Schooley, and
the Adult AIDS Clinical Trials Group 285 Study Team
From the University of Colorado Health Sciences Center and Bonfils
Blood Center, Denver, CO; Harvard School of Public Health, Boston, MA;
University of Washington School of Medicine, Seattle, WA;
Rush-Presbyterian/St. Lukes Medical Center, Chicago, IL; Amgen, Inc.,
Thousand Oaks, CA; University of California Los Angeles School of
Medicine, Los Angeles, CA; and Center for Human Virology, Jefferson
Medical College of Thomas Jefferson University Hospital, Philadelphia,
PA.
 |
Abstract |
Genetic modification of hemopoietic progenitor cells ex vivo,
followed by the infusion of the genetically modified cells into the
human immunodeficiency virus-1 (HIV-1) infected donor, has been
proposed as a treatment for HIV-1 infection. The current study was
undertaken to evaluate the effect of hemopoietic stem cell mobilization
and harvesting on HIV-1 replication in persons with HIV-1 infection.
Eighteen HIV-1-infected persons received recombinant granulocyte
colony-stimulating factor (G-CSF; Filgrastim) 10 µg/kg
per day, for 7 days. On days 4 and 5, peripheral blood mononuclear
cells were harvested by leukapheresis. The CD4+ lymphocyte count at
entry was >500/µL for 6 subjects, 200 to 500/µL for 6 subjects,
and <200/µL for 6 subjects. For 9 of 18 subjects, plasma HIV-1 RNA
levels increased 4- to 100-fold (>0.6 log10) above
baseline between days 4 and 7 and returned to baseline by day 27. Significant increases of plasma HIV-1 RNA levels occurred in 5 subjects
despite 3-drug antiretroviral therapy. Changes in CD4+ and CD34+
cells during mobilization and harvesting were similar in all subjects whether they had or did not have increased plasma HIV-1 RNA levels. Thus, mobilization and harvesting of bone marrow progenitor cells from persons infected with HIV-1 induced a transient increase in
viral replication in some patients but was not associated with adverse
effects. (Blood. 2000;95: 48-55)
© 2000 by The American Society of Hematology.
 |
Introduction |
Therapies that inhibit human immunodeficiency virus-1
(HIV-1) protease provide potent inhibition of viral replication in
HIV-1-infected persons1,2 and, when used in combination
with inhibitors of HIV-1 reverse transcriptase, provide effective
treatment of HIV-1 infection.3 Although treatment of HIV-1
infection with combinations of protease inhibitors and reverse
transcriptase inhibitors often leads to effective suppression of viral
replication and at least partial reversal of HIV-1-related
immunosuppression,4 available treatments do not result in
HIV-1 eradication.5,6 Because long-term therapy with
antiretroviral regimens may be limited by toxicities and by the
eventual emergence of resistant viruses7 and because the
long-term benefits of available antiretroviral treatments are unknown,
additional strategies for the treatment of HIV-1 infection are needed.
It has been proposed that HIV-1 infection could be treated by the
genetic modification of HIV-1 host cells to confer resistance to
infection by HIV-1.8 One proposed strategy for genetic
therapy for HIV-1 infection is the delivery of a gene that confers
resistance to HIV-1 infection to hemopoietic progenitor cells. This
approach requires 3 basic steps. First, hemopoietic stem cells are
harvested from the HIV-1 infected person. Second, the gene that confers resistance to HIV-1 infection is delivered to hemopoietic stem cells ex
vivo. Third, the genetically modified stem cells are infused into the
autologous HIV-1-infected person. Expansion and differentiation of the
progeny of the genetically modified stem cells in the HIV-1-infected
person would theoretically provide a population of CD4+ lymphocytes
resistant to HIV-1 infection, thereby inhibiting viral replication and
providing immune reconstitution.
For stem cell-based gene therapy of HIV-1 infection to be feasible, it
is first necessary to harvest safely adequate numbers of hemopoietic
progenitor cells from HIV-1 infected-persons. Mobilizing hemopoietic
progenitor cells with recombinant granulocyte colony-stimulating factor
(G-CSF; Filgrastim; Amgen, Thousand Oaks, CA) and harvesting the
mobilized cells by leukapheresis in persons with malignant diseases are
not associated with significant adverse events, and they provide
adequate quantities of progenitor cells for bone marrow reconstitution
after ablation chemotherapy.9-11 Preliminary studies have
found that hemopoietic progenitor cells can be harvested from HIV-1
infected-persons and that HIV-1-resistant genes can be effectively
delivered to the purified progenitor cells.12-14 Although
adverse effects of stem cell harvesting and mobilization on HIV-1
virus load have not been described, studies reported to date have
included only small numbers of HIV-1-infected persons and have not
included persons with advanced HIV-1 infection or persons with
AIDS-related illnesses.
The Adult AIDS Clinical Trials Group (ACTG) Protocol 285 was undertaken
to determine the safety and efficacy of stem cell mobilization with
G-CSF and harvesting by leukapheresis in persons with various stages of
HIV-1 infection. Detailed descriptions of the efficacy of stem cell
mobilization and harvesting from this group of research
subjects are forthcoming.44 In this article we describe the
effects of mobilizing and harvesting hemopoietic progenitor cells on
HIV-1 virus load in this research group of 18 infected persons.
 |
Methods |
Subject selection
To be eligible for participation in this study, subjects were
required to meet all of the following criteria: (1) HIV-1 infection documented by positive HIV-1 enzyme-linked immunosorbent assay and
confirmed by Western blot analysis, positive serum p24 antigen, positive HIV-1 culture, or second antibody test other than an enzyme-linked immunosorbent assay; (2) no antiretroviral therapy within
30 days before study entry for cohort 1 or stable antiretroviral therapy for at least 60 days before study entry for cohorts 2 and 3;
(3) minimum age of 18 years; (4) Karnofsky performance score of at
least 70; (5) venous access suitable for leukapheresis; (6) hemoglobin
count of at least 9.1 g/dL for men or at least 8.8 g/dL for women; (7)
absolute neutrophil count of at least 1000 cells/µL without the use
of G-CSF; (8) platelet count of at least 75 000/µL; (9) serum
aspartate transaminase level no more than 5× upper normal limit;
(10) serum creatinine level no more than 1.5× upper normal
limit; (11) willingness and ability to give informed consent; (12)
agreement to use barrier methods of birth control; and (13) negative
result of urine human chorionic gonadotropin pregnancy test within 14 days of study entry for women of childbearing potential. Subjects on
antiretroviral therapy at study entry were encouraged not to change
their antiretroviral regimen during the first 4 weeks after treatment.
Subjects who were not on antiretroviral therapy at study entry were
encouraged not to begin it during the first 4 weeks after treatment.
Potential subjects were excluded from participation in this study if
they met any of the following criteria: (1) malignant neoplastic
disease, past or present; (2) pregnancy; (3) known sensitivity to
proteins derived from Escherichia coli; (4) leukapheresis or
lymphapheresis within 180 days before study entry; (5) opportunistic infection within 14 days before study entry; (6) active alcohol or
substance abuse; (7) seizures within 1 year before study entry or
clinically significant central nervous system disease; (8) investigational antiretroviral therapy within 30 days before study entry; or (9) any medical condition that would interfere with evaluation of the subject.
The protocol was approved by the institutional review boards of the
University of Colorado Health Sciences Center, the Thomas Jefferson
University Hospital, and the University of California Los Angeles
Medical Center. Informed consent was obtained from all subjects before
their participation in this study.
Study design
At study entry, subjects were stratified into 1 of 3 cohorts by
baseline CD4+ lymphocyte count. Cohort 1 consisted of 6 persons with
>500 CD4+ lymphocytes/µL and without symptoms of HIV-1 infection. Cohort 2 consisted of 6 persons with 200 and 500 CD4+
lymphocytes/µL, with or without HIV-1-related symptoms but without
prior AIDS-defining illness. Cohort 3 consisted of 6 persons with
<200 CD4+ lymphocytes/µL, with or without AIDS-defining illness.
All subjects received daily subcutaneous injections of 10 µg/kg G-CSF
(Neupogen; Amgen) on study days 1 through 7. On days 4 and 5, peripheral blood mononuclear cells (PBMC) were harvested by
leukapheresis. Complete blood counts and lymphocyte subset analyses
were performed on days 3, 0, 4, 5, 6, 7, 10, and 27.
Quantitation of plasma HIV-1 RNA
Plasma specimens were obtained by venipuncture on days 3, 0, 4, 5, 6, 7, and 27 and stored at 70°C. The
amount of HIV-1 RNA in thawed plasma specimens was determined by the
Amplicor HIV-1 Monitor assay (Roche Molecular Systems, Indianapolis,
IN), a reverse transcription-polymerase chain reaction
(RT-PCR) assay with a lower limit of quantitation of 400 copies/mL (2.6 log10). Except for subject 620 733 (see Table
1), all plasma specimens obtained at
different time points from the patients were assayed together in a
batch. All plasma samples from subjects with <400 copies/mL by the
standard HIV-1 monitor assay at study entry were assayed in a batch
with the ultrasensitive HIV-1 Monitor assay (Roche Molecular Systems)
with a lower limit of quantitation of 50 copies/mL (1.7 log10). Because the 95% confidence interval for
interassay variation of plasma HIV-1 RNA quantitation by RT-PCR is
±0.5 log10,15,16 a significant change in
HIV-1 RNA level for each subject was defined as 0.6-log10
difference from baseline.
Culture of HIV-1 from leukapheresis products
HIV-1 was isolated from leukapheresis products obtained on study
days 4 and 5 according to the ACTG consensus protocol.17 Approximately 106 fresh PBMCs harvested by leukapheresis of
the HIV-1-infected patients were cocultured with an equal number of 3- to 4-day-old phytohemagglutinin-stimulated lymphoblasts obtained from
random HIV-1 seronegative donors. Fresh 3- to 4-day-old
phytohemagglutinin-stimulated lymphoblasts were added weekly, and
culture supernatants were monitored for p24 antigen production (Coulter
Diagnostics, Hialeah, FL) twice weekly. Cultures were considered
negative if p24 antigen was not detected after 30 days.
Quantitation of peripheral blood mononuclear cell HIV-1 DNA
An internal quantitation standard (IQS) plasmid (pIQSGAG) was
constructed by inserting a chimeric 251-nucleotide bp HIV-1 gag gene
fragment (position 1291-1542) into the plasmid pCR-Script Amp Sk+
(Stratagene, La Jolla, CA). The chimeric fragment contained a unique,
conserved probe region that consisted of a 33-bp sequence derived from
the Drosophila "white" locus18 and was
designed to replace the SK102 (position 1403-1435) probe region of the HIV-1 gag gene. The chimeric fragment was generated by first amplifying 2 separate products from the gag gene using gag primers gag 04 and
gag 0619 and primers FLYINTA
(5'-GCCGGATTGTAGTTGGTAGGACACTGGTTTTAA CATTTGCATGGCTGCTTG) and FLYINTB
(5'-TCCTACCAACTACAATCCGGCGGACTTAGATTGCATCCAGTGCATGCAG, which
contain both Drosophila and HIV-1 gag sequence. Product 1 (generated from gag 04 and FLYINTB) and product 2 (generated from gag
06 and FLYINTA) were then gel purified, mixed, and simultaneously extended and amplified to generate the full-length chimeric fragment that was used to generate pIQSGAG. The plasmid was linearized with
Xho I and diluted to appropriate concentrations. This plasmid served as a coamplified control and allowed for the amplification of a
product identical in size to that generated from proviral DNA, except
that it hybridized with the Fly-C probe (5'-GTCCTACCAA CTACAATCCGG) but not with the gag-specific GAGP1 probe
(5'-GAGGAAGCTGCAGAATG GGA).20
The PBMC was purified by Ficoll-Hypaque gradient sedimentation of whole
blood specimens obtained by venipuncture on days 3, 0, 4, 5, 6, 7, and 27. Purified PBMC was counted, and aliquots were
stored as either dry-cell pellets at 70°C or as viable cells in
dimethyl sulfoxide and liquid nitrogen. Dry pellets were used directly,
and viable cells were quickly thawed at 37°C and washed with
phosphate-buffered saline (PBS). Dry and viable cell pellets were
resuspended in 200 µL PBS. Total specimen DNA was extracted using
Qiagen Blood Kits (Qiagen, Santa Clara, CA). The amount of total DNA
was quantified using a DyNA Quant 200 fluorometer (Hoeffer Pharmacia
Biotech, San Francisco, CA), calibrated with a 100 ng/µL calf-thymus
DNA standard (Hoeffer Pharmacia Biotech). DNA was diluted to 20 ng/µL, and 50 µL (1 µg) was used in each PCR reaction. Samples
from individual subjects were run in batch to minimize intrasubject variability.
For each amplification reaction, 1 µg specimen DNA was used. For each
specimen 5 reactions were performed with varying amounts (0-10 000
copies) of the IQS. Biotin-labeled primers SK462 and SK43121 were custom synthesized by Gibco BRL (Gaithersburg, MD) and used to amplify a portion of both the specimen-associated HIV-1
gag gene and the IQS. Each 100-µL reaction contained 10 mmol/L Tris-HCl, pH 8.3, 50 mmol/L KCl, 1.5 mmol/L
MgCl2, 0.001% gelatin, 150 µmol/L dNTPS, 200 µmol/L
dUTP, 2.5 U Taq Polymerase (Perkin Elmer, Foster City,
CA), 1 U heat-labile uracil-N-glycoslyase (Boehringer Mannheim,
Indianapolis, IN), and 1 µmol/L each of SK431 and SK462. Samples were
amplified in a Perkin Elmer 9600 thermocycler using the following
conditions (modified from Kwok and Sninsky21): 10 minutes
at 25°C; 5 cycles consisting of 10 seconds at 95°C, 10 seconds
at 55°C, and 10 seconds at 72°C; 35 cycles consisting of 10 seconds at 90°C, 10 seconds at 60°C, and 10 seconds at
72°C; 5 minutes at 72°C; and 2.5 minutes at 95°C.
The detection method was modified after Hockett et al.22
Briefly, 10-µL aliquots of the amplified product were transferred to
4 wells of a streptavidin-coated microtiter plate (Boehringer Mannheim)
containing 150 µL PBS and 0.01% Tween 20 and incubated at 42°C for 1 hour. The plates were washed once with PBS containing 0.01% Tween 20, denatured 2 minutes with 160 µL of denaturing solution, 50 mmol/L NaOH, 0.15 NaCl, 2 mmol/L EDTA, pH 8, followed by 2 more washes with the PBS-Tween 20 solution. The contents of 2 wells
were then hybridized at 42°C for 1 hour with 160 µL 7.5 nmol/L
GAGP1 (3' digoxigenin; custom synthesized by Genosys Biotechnologies, Woodlands, TX) in hybridization buffer (20%
formamide, 0.9 mol/L NaCl, 1.2 mol/L NaH2PO4, 6 mmol/L EDTA, and 50 ng/mL sheared herring sperm DNA) to detect
amplified specimen, and 2 wells were hybridized with 160 µL 7.5 nmol/L FLY-C (3' digoxigenin) in hybridization buffer to detect
amplified IQS. The well-plates were washed 3 times with
PBS-Tween and were incubated at 37°C for 1 hour with
anti-digoxigenin Fab conjugated with a diluted alkaline phosphatase
solution (3 U/20 mL in PBS, 1% bovine serum albumin, and 0.01%
NaN3), then washed 4 times with PBS-Tween and incubated with 1 mg/mL p-nitrophenyl phosphate solution (Kierkegaard and Perry, Gaithersburg, MD) for 15 minutes; the absorbance was read at
405 nm. Copy number (HIV-1 DNA copies/µg PBMC DNA) was determined by linear regression from a plot of the log of absorbance of
HIV-1 gag/IQS versus the log of the nominal (input) IQS copy number.
The measured HIV-1 proviral DNA copy number was determined at the
equivalency intercept (ie, log absorbance HIV-1 gag/IQS = 0). The
copies of HIV-1 DNA/µg PBMC DNA were converted to copies of HIV-1
DNA/105 PBMC using 6.6 × 109 bp as an
estimate of the size of the human genome. To adjust for effects of
fluctuations in the numbers of circulating CD4+ lymphocytes, copies of
HIV-1 DNA/105 PBMC were divided by the fraction of whole
blood lymphocytes that were CD4+ to give copies of HIV-1
DNA/105 CD4+ lymphocytes. Use of this calculation assumed
that the fraction of CD4+ lymphocytes in purified PBMC was equal to
the fraction of whole blood lymphocytes that were CD4+. Because the
95% confidence interval for the interassay variation of the PCR method
used to quantify HIV-1 DNA is ±0.3 log10,20
a significant change in HIV-1 DNA was defined as 0.4
log10 change from baseline.
 |
Results |
Subjects
Eighteen HIV-1-infected-persons were enrolled in this study. Six
subjects were stratified into each cohort; their characteristics at
study entry are summarized in Table 1. All subjects were men, and the
median age of subjects in each cohort was similar. None of the subjects
in cohort 1 received antiretroviral therapy during the first 27 study
days. Although the entry criteria specified that subjects in cohort 2 be on stable antiretroviral therapy, an exception was made for subject
61 149 who did not receive antiretroviral therapy. Four subjects in
cohort 2 were administered 3-drug antiretroviral regimens that included
at least 1 inhibitor of HIV-1 protease, whereas subject 620 738 was
administered monotherapy with didanosine. All subjects in cohort 3 were
administered 3-drug antiretroviral regimens that included at least 1 protease inhibitor. All subjects received 10 µg/kg G-CSF on days 1 through 7 and underwent leukapheresis on days 4 and 5. Subject 61 148
(cohort 3) reported bone pain on days 3 and 4. The other subjects
reported no treatment-related side effects. After stem cell
mobilization and harvesting, CD4+ lymphocyte counts decreased
transiently on day 27 but returned to baseline by day 83.44
Stem cell mobilization and harvesting affects plasma HIV-1 RNA
levels
Plasma HIV-1 RNA levels were determined for all 18 subjects. Sixteen
of them had quantifiable HIV-1 RNA in at least 2 plasma samples
obtained during days 4 through 27. Viral RNA was not detected in any of
the specimens obtained from subject 610 020 by the ultrasensitive PCR
method (<1.7 log10 copies/mL), nor was it detected in 8 of 9 specimens from subject 620 736 by the standard PCR method (<2.6 log10 copies/mL; sufficient amounts of plasma for repeat
analysis of this subject's specimens with the ultrasensitive PCR assay were not available).
The change from baseline for plasma HIV-1 RNA levels (Figure
1) was determined for 16 subjects for whom
virus RNA could be detected on at least 2 occasions by subtracting the
baseline level of HIV-1 RNA (Table 1) from the level on days 4, 5, 6, 7, and 27. To avoid the effects of changes in antiretroviral therapy on
HIV-1 virus load, this analysis was limited to the first 27 study days.
For the 16 subjects with measurable plasma HIV-1 RNA levels, the median
viral RNA increased to 0.3 log10 copies/mL above baseline
on day 5. Increases above baseline were statistically significant on
days 5 and 7 (P = .038 and .0495, respectively, using the
Bonferroni adjustment for performing 5 separate tests; 2-tailed
Wilcoxon signed rank test for paired data). On day 6 the increase above
baseline approached significance (P = .0565). Plasma HIV-1
RNA levels were not significantly different from baseline on days 4 or
27 (P > .1). When the data were analyzed for each cohort,
similar trends were noted but statistically significant differences
were not found.

View larger version (33K):
[in this window]
[in a new window]
| Fig 1.
Changes in plasma HIV-1 virus load during mobilization
and harvesting of stem cells for individual subjects.
(A) Cohort 1. (B) Cohort 2. (C) Cohort 3. (vertical dotted lines)
Granulocyte colony-stimulating factor was administered on days 1 through 7. (arrows) Leukapheresis was performed on days 4 and 5. For
subject 620 745 in cohort 1, a day-27 plasma sample was unavailable.
Levels of plasma HIV-1 RNA for subjects 610 020 and 620 736 were
below the limit of detection and are not shown.
|
|
For 9 of 18 subjects in the 3 cohorts, HIV-1 RNA levels increased to
>0.6 log10 copies/mL (4-fold) above baseline at least once during study days 4 through 7 (Figure 1). On day 6 or 7, 3 subjects (620 745, 61 147, and 61 150; Figures 1A, 1B, 1C) had a 1.0 to 1.1 log10 copies/mL (10-fold) rise above baseline. The most striking changes in plasma HIV-1 RNA levels occurred for subject
610 051 (Figure 1B) who, while receiving antiretroviral therapy with
zidovudine, lamivudine, and indinavir, experienced a 2.1 log10 (126-fold) rise above baseline on study day 5 that was followed by a return to baseline by day 27. Four subjects (620 495, 610 020, 620 736, and 061 150) had undetectable HIV-1 RNA
levels at study entry while on 3-drug antiretroviral therapy (Table 1).
Plasma HIV-1 RNA levels remained at baseline during G-CSF treatment for
subjects 610 020 and 620 736. Subject 620 495 had a maximum 0.6 log10 copies/mL above baseline in plasma RNA on day 5 but
returned to baseline on day 27 (Figure 1B). Despite effective
antiretroviral therapy at study entry, subject 61 150 experienced a
1.1 log10 rise in plasma HIV-1 RNA level on day 7 and
remained above baseline on days 27 and 55 (0.72 and 0.69 log10 above baseline, respectively). For 1 subject
(61 148) plasma viral RNA levels fell 1.3 log10 copies/mL
below baseline on day 6, transiently increased to 0.5 log10
above baseline on day 27 (Figure 1C), and fell below baseline on day
55. None of the subjects with elevated plasma HIV-1 levels reported
symptoms associated with increased HIV-1 replication (eg, fever, night
sweats, lymphadenopathy).
Comparison of subjects with and without increased HIV-1 RNA levels
during stem cell harvesting and mobilization
To evaluate the factors that led to increased HIV-1 RNA levels
during stem cell mobilization and harvesting, the characteristics of 9 subjects who had significant increases in HIV-1 RNA level ( 0.6
log10) during days 4 through 7 were compared with 9 subjects who did not have significant increases in HIV-1 RNA level
(<0.6 log10) during this period (Table
2). Subjects in whom plasma HIV-1 RNA
levels increased to >0.6 log10 above baseline were not more likely to be in either of the 3 cohorts. Characteristics at study
entry (age, baseline CD4 cell count, baseline HIV-1 RNA level, and
concurrent antiretroviral therapy) were similar for subjects with or
without increased HIV-1 RNA levels. The response of subjects to G-CSF
mobilization (maximum peripheral CD4+ lymphocyte count, relative change
of CD4+ lymphocytes from baseline, and the maximum peripheral CD34+
cell count) was also similar in both groups. To assess whether subjects
with increased plasma HIV-1 RNA levels had increased numbers of
productively infected cells in the peripheral circulation, the PBMC
collected by leukapheresis on days 4 and 5 was cultured for infectious
HIV-1. The frequency of recovery of infectious HIV-1 from PBMC
harvested by leukapheresis on either day 4 or day 5 was similar for
both groups of subjects (4 of 9 vs. 5 of 9; Table 2).
View this table:
[in this window]
[in a new window]
|
Table 2.
Comparison of subjects with and without increases in
HIV-1 virus load during stem cell mobilization and harvesting
|
|
Stem cell mobilization and harvesting affects the levels of HIV-1
DNA in CD4+ lymphocytes
Levels of HIV-1 DNA were quantified for all 18 subjects from
PBMC collected during stem cell mobilization and harvesting. Microscopic examination of Wright's stained purified PBMC obtained from 4 subjects (610 021, 610 051, 610 219, and 610 354) revealed that at baseline and after stem cell mobilization 95% to 98% and 80%
to 94%, respectively, of the cells in PBMC preparations were mononuclear cells. The levels of HIV-1 DNA were adjusted for the CD4+
lymphocyte count at each time point. In at least 2 PBMC samples obtained during days 4 through 27 (Table 1), 17 of the 18 subjects had
quantifiable HIV-1 DNA. It was not detected in any of the specimens
obtained from subject 61 146 (<0.9 log10
copies/105 CD4+ lymphocytes). For the other 17 patients,
HIV-1 DNA levels at baseline had inverse linear relationships to the
baseline CD4+ lymphocyte counts (Spearman's = 0.71;
P = .0047).
The HIV-1 DNA change from baseline was calculated by subtracting the
baseline level of HIV-1 DNA (Table 1) from the level on days 4, 5, 6, 7, and 27. To avoid confounding effects from changes in antiretroviral
therapy, this analysis was limited to the first 27 study days. In
contrast to the effects of stem cell harvesting and mobilization on
plasma HIV-1 RNA, the levels of HIV-1 DNA did not significantly
increase from baseline ( 0.4 log10 increase) at any time
during study days 4 through 7 (Figure 2). However, 6 subjects (61 144, 61 145, 061 150, 610 219, 620 733, and 620 743) had 0.5- to 0.9-log10 decreases from baseline
CD4+ lymphocyte HIV-1 DNA levels, and 1 subject (620 738) had more than a 1.0-log10 decrease during study days 4 through 7. Overall, significant decreases in the median level of viral DNA of 0.19 and 0.21 log10 copies/105 CD4+ lymphocytes
below baseline occurred on days 5 and 6, respectively (P = .01 for day 5 and P = .001 for day 6 using a
Bonferroni adjustment for multiple tests; 2-tailed Wilcoxon signed-rank
test for paired data). Changes in viral DNA levels from baseline on
days 4, 7, and 27 were not statistically significant
(Bonferroni-adjusted P = .24, P = .06 , and
P > .99, respectively).

View larger version (32K):
[in this window]
[in a new window]
| Fig 2.
Changes in CD4+ lymphocyte HIV-1 DNA during mobilization
and harvesting of stem cells for individual subjects.
(A) Cohort 1. (B) Cohort 2. (C) Cohort 3. (vertical dotted lines)
Granulocyte colony-stimulating factor was administered on days 1 through 7. (arrows) Leukapheresis was performed on days 4 and 5. For
subject 620 733 in cohort 1 and subject 061 144 in cohort 3, day-27
peripheral blood mononuclear cells samples were unavailable. The levels
of CD4+ lymphocyte HIV-1 DNA for subject 061 146 was below the limit
of detection at all time points and are not shown.
|
|
Relationship between plasma HIV-1 RNA and CD4+ lymphocyte HIV-1
DNA during stem cell mobilization and harvesting
The relationship between plasma HIV-1 RNA and CD4+ lymphocyte DNA
was determined for the 11 subjects who had measurable HIV-1 RNA levels
on study days 3 or 0 (subjects 610 219, 620 745, 610 345,
610 051, 620 738, 61 149, 61 147, 61 144, 620 743, 61 148, and
61 821; Table 1). At study entry, HIV-1 RNA levels in plasma before
stem cell harvesting and mobilization were directly related to HIV-1
DNA levels (Figure 3A). This relationship
existed despite a broad range of CD4+ lymphocyte counts and viral loads
for these 11 subjects. We therefore examined the relationship between
plasma HIV-1 RNA and HIV-1 DNA during study days 4 through 7. Fit of these data also found a linear relationship (Figure 3B) with a slope
(0.69) that was not significantly different from the slope observed at
baseline (0.73; P = .83). However, the y-intercept (2.4 log10 copies/mL) was 0.6 log10 greater than at
baseline (1.8 log10 copies/mL; P = .004) (compare
Figures 3A and 3B). The slopes of both regression analyses
were heavily dependent on the data from a single subject (61 144).
Removal of this subject from both regression analyses did not change
the conclusion that the slopes of both regression analyses were not
significantly different (P = .95) and that there was a
significant increase in the y-intercept (+0.4 log10;
P = .029) for study days 4 through 7.

View larger version (18K):
[in this window]
[in a new window]
| Fig 3.
Correlation of plasma HIV-1 RNA levels with CD4+
lymphocyte HIV-1 DNA levels.
(A) Relationship of plasma HIV-1 RNA to CD4+ lymphocyte HIV-1 DNA
levels before stem cell mobilization and harvesting. (solid line) Fit
of data by linear regression (P < .0001;
r = 0.79). (B) Relationship of plasma HIV-1 RNA levels to the
level of CD4+ lymphocyte HIV-1 DNA during stem cell mobilization and
harvesting (days 4 through 7) for each subject. (solid line) Fit of
data by linear regression (P < .0001; r = 0.68).
(dashed lines) 95% confidence intervals for the regressions. This
analysis used only data pairs for which quantifiable values of both
HIV-1 RNA and DNA levels were available.
|
|
 |
Discussion |
The plasma HIV-1 RNA level is a sensitive marker of HIV-1
replication that predicts disease progression and response to antiviral therapy in infected persons.23-29 Half the subjects who
underwent stem cell mobilization by G-CSF and harvesting by
leukapheresis had transient increases in plasma HIV-1 RNA levels that
exceeded the variability of this assay. Thus, these subjects had
significant increases in HIV-1 replication. This finding has not been
reported previously, and it contradicts a previous report that stem
cell mobilization and harvesting did not activate HIV-1
replication.12 In the previous study, treatment of 7 HIV-1-infected subjects with G-CSF, 10 µg/kg per day for 6 consecutive days, followed by leukapheresis on day 6, did not affect
serum p24 antigen levels. However, the serum p24 antigen level is an
insensitive marker of HIV-1 replication and disease
progression,30-32 and increases in HIV-1 replication that
produce changes in plasma HIV-1 RNA do not always produce measurable
changes in serum p24 antigen.33 Thus, it is likely that the
use of a sensitive marker of HIV-1 replication in the current study
allowed for the detection of an effect on viral replication that was
previously unnoticed.
The magnitude of changes in HIV-1 RNA levels that occurred in the
subjects in the current study are comparable to those observed after
immunization with recall antigen,34 influenza
vaccine,35 and IL-2 injection33 and during
AIDS-related opportunistic infection.36 The results of
these studies suggest that immune stimulation leads to enhanced HIV-1
replication. Treatment of HIV-1 infection with 3-drug combinations that
include an HIV-1 protease inhibitor effectively suppresses viral
replication by preventing de novo infection. However, populations of
cells that are latently infected with HIV-1 persist despite effective
therapy,5,6 and available antiretroviral therapies do not
prevent the activation of proviral gene expression in latently infected cells.
In the current study, transient increases in plasma HIV-1 RNA levels
occurred in 5 subjects despite treatment with potent 3-drug regimens.
The finding that HIV-1 RNA levels promptly returned to baseline by day
27 for 4 of these 5 subjects suggests that stem cell mobilization and
harvesting stimulated viral gene expression in a population of latently
infected cells and that the "breakthrough" virus remained
sensitive to the antiretroviral agents in use at the time. It is
unlikely that stem cell harvesting and mobilization fostered the
replication of antiretroviral, drug-resistant virus in these 4 subjects. However, 1 subject (61 150) who had undetectable HIV-1 RNA
at study entry experienced a sustained and unresolved increase in HIV-1
RNA level. It is possible that the breakthrough virus acquired
mutations that confer resistance to the antiretroviral agents in use.
Analyses are planned to determine whether the virus that emerged during
stem cell mobilization and harvesting had reduced susceptibility to
antiviral agents.
The factors associated with increased HIV-1 replication during stem
cell mobilization and harvesting are not evident. Subjects who
experienced increased HIV-1 RNA levels were similar to those subjects
in whom plasma RNA levels did not increase from baseline by all
comparisons. However, the relatively small number of subjects in our
study limits the strength of these comparisons. In 2 subjects (610 051, 61 147) (Figure 1), significant increases in plasma HIV-1
RNA were first apparent on day 4, before the first leukapheresis. This
suggests that mobilization with G-CSF, not harvesting with leukapheresis, caused increased viral replication in these subjects. Because treatment of neutropenia in persons with HIV-1 infection with
G-CSF at doses of 5 µg/kg per day or less does not affect plasma
HIV-1 RNA levels,37,38 G-CSF may have a dose-dependent effect on HIV-1 replication. Given that all subjects in the current study underwent stem cell harvesting and mobilization, we cannot exclude the possibility that the combination of treatment with G-CSF and leukapheresis activated HIV-1 replication.
At study entry the median level of HIV-1 DNA in circulating CD4+
lymphocytes ranged from 1 copy/1000 cells for subjects with early-stage
HIV-1 infection (cohort 1) to 1 copy/100 cells for subjects with
advanced HIV-1 infection (cohort 3). This finding is consistent with
previous estimates of the frequency of HIV-1-infected cells in the
circulating CD4+ cells of HIV-1-infected persons.39-41 In
contrast to the effect on plasma HIV-1 RNA levels, the levels of HIV-1
DNA in circulating CD4+ lymphocytes did not increase during stem cell
mobilization and harvesting. Rather, HIV-1 DNA levels decreased during
treatment and returned to baseline within 3 weeks of treatment
discontinuation. The cause of decreased HIV-1 DNA levels during stem
cell harvesting and leukapheresis is unknown, but possible explanations
include clearance of productively infected cells by the immune system,
mobilization of uninfected CD4+ lymphocytes to the circulatory
compartment, removal of HIV-1-infected cells during leukapheresis, and
cytopathic effects from the increased HIV-1 replication that occurred
during stem cell harvesting and mobilization.
At study entry, a linear relationship between the plasma HIV-1 RNA
level and the HIV-1 DNA level in circulating CD4+ lymphocytes existed.
This finding is consistent with a previously reported observation that
the levels of serum HIV-1 RNA are directly related to the number of
HIV-1-infected cells in the circulatory compartment, regardless of
disease state, and that PBMC and serum are closely related viral
compartments.42 It is important to note that our analysis
was limited to the 11 subjects with measurable levels of plasma HIV-1
RNA and PBMC HIV-1 DNA at baseline. Thus, the subjects in this subgroup
were not on maximally effective antiretroviral regimens. During stem
cell mobilization and harvesting, the linear relationship between
plasma HIV-1 RNA and PBMC DNA was maintained but included a
0.6-log10 upward shift in the curve. Therefore, within the
circulatory compartment, the ratio of cell-free virus to
HIV-1-infected cells increased. The increased ratio of cell-free virus
to infected cells is consistent with the observed overall increase in
plasma level of HIV-1 RNA (+0.3 log10 copies/mL) and the
concomitant overall decrease in the level of HIV-1 DNA in CD4+
lymphocytes ( 0.2 log10 copies/105
cells). These findings provide additional evidence that the increased plasma HIV-1 RNA levels that occurred during stem cell harvesting and
mobilization resulted from stimulated production of HIV-1 from a priori
infected cells and did not result from mobilization of HIV-1- infected
cells to the circulatory compartment.
Recent studies have used mobilized hemopoietic progenitor cells
harvested from HIV-1-infected persons to demonstrate the feasibility of gene therapy approaches to the treatment of HIV-1
infection,13,43 and studies to evaluate the safety of
autologous transplantation of genetically modified progenitor cells are
in progress. In the current study we observed that stem cell
mobilization and harvesting caused a previously undescribed stimulation
of HIV-1 replication in infected persons. It is important to note that
for most subjects plasma HIV-1 RNA returned to near baseline levels
within 3 weeks after treatment was discontinued and that increased
HIV-1 replication was not associated with any untoward effects. The
increased viral replication did not affect changes in the CD4+
lymphocyte count or in the ability to mobilize CD34+ cells. Therefore,
the results of our study do not preclude further investigations that
use this approach to collect hemopoietic stem cells from
HIV-1-infected persons. However, investigators and HIV-1-infected
subjects who participate in stem cell mobilization and harvesting
studies should be aware of the possibility that HIV-1 replication could
be stimulated. Careful monitoring of HIV-1 virus load should be part of
future studies that use this technology.
 |
Acknowledgments |
The authors thank the other members of the ACTG 285 Study Team for
their contributions: Larry Fox, Dawn Bell, Rebecca Betensky, Simon
Chiu, Jim Leone, Janice Jacovini, and Scharla Estep Riley. They also
thank Amgen, Inc, for supplying Filgrastim for use in this study, and
they thank Monique Givens, Tiffany Kirkbride, and David Shuggarts for
the HIV-1 cultures.
 |
Footnotes |
Submitted March 1, 1999; accepted August 3, 1999.
Supported by grants from the Department of Health and Human Services to
the Adult AIDS Clinical Trials Units (AI32770), the University of
Colorado General Clinical Research Center (RR0051), and the University
of Colorado Cancer Center Flow Cytometry Core Laboratory (CA46934);
by a Virology Advanced Technology Laboratory Award from the Adult ACTG
(AI38858), University of Washington CFAR (AI-30731); and by Amgen, Inc.
Reprints: Thomas B. Campbell, Campus Box B-168,
University of Colorado Health Sciences Center, 4200 East Ninth Avenue, Denver, CO 80262; e-mail: thomas.campbell{at}uchsc.edu.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
 |
References |
1.
Danner SA, Carr A, Leonard JM, et al.
A short-term study of the safety, pharmacokinetics, and efficacy of ritonavir, an inhibitor of HIV-1 protease.
N Engl J Med.
1995;333:1528-1533[Abstract/Free Full Text].
2.
Markowitz M, Saag M, Powderly WG, et al.
A preliminary study of ritonavir, an inhibitor of HIV-1 protease, to treat HIV-1 infection.
N Engl J Med.
1995;333:1534-1539[Abstract/Free Full Text].
3.
Collier AC, Coombs RW, Schoenfeld DA, et al.
Treatment of human immunodeficiency virus infection with saquinavir, zidovudine, and zalcitabine.
N Engl J Med.
1996;334:1011-1018[Abstract/Free Full Text].
4.
Autran B, Carcelain G, Li TS, et al.
Positive effects of combined antiretroviral therapy on CD4+ T cell homeostasis and function in advanced HIV disease.
Science.
1997;277:112-116[Abstract/Free Full Text].
5.
Wong JK, Hazareh M, Gunthard HF, et al.
Recovery of replication-competent HIV despite prolonged suppression of plasma viremia.
Science.
1997;278:1291-1295[Abstract/Free Full Text].
6.
Finzi D, Hermankova M, Pierson T, et al.
Identification of a reservoir for HIV-1 in patients on highly active antiretroviral therapy.
Science.
1997;278:1295-1300[Abstract/Free Full Text].
7.
Molla A, Korneyeva M, Gao Q, et al.
Ordered accumulation of mutations in HIV protease confers resistance to ritonavir.
Nat Med.
1996;2:760-766[Medline]
[Order article via Infotrieve].
8.
Friedman AD, Triezenberg SJ, McKnight SL.
Expression of a truncated viral trans-activator selectively impedes lytic infection by its cognate virus.
Nature.
1988;335:452-454[Medline]
[Order article via Infotrieve].
9.
Feremans W, Le Moine F, Ravoet C, et al.
Optimal blood stem cell mobilization using 10 micrograms/kg granulocyte colony-stimulating factor (G-CSF) alone for high-dose melphalan intensification in multiple myeloma: an intrapatient controlled study.
Am J Hematol.
1994;47:135-138[Medline]
[Order article via Infotrieve].
10.
Shpall EJ, Jones RB, Bearman SI, et al.
Transplantation of CD34+ hematopoietic progenitor cells.
J Hematother.
1994;3:145-147[Medline]
[Order article via Infotrieve].
11.
Schiller G, Vescio R, Freytes C, et al.
Transplantation of CD34+ peripheral blood progenitor cells after high-dose chemotherapy for patients with advanced multiple myeloma.
Blood.
1995;86:390-397[Abstract/Free Full Text].
12.
Slobod KS, Bennett TA, Freiden PJ, et al.
Mobilization of CD34+ progenitor cells by granulocyte colony-stimulating factor in human immunodeficiency virus type 1-infected adults.
Blood.
1996;88:3329-3335[Abstract/Free Full Text].
13.
Bauer G, Valdez P, Kearns K, et al.
Inhibition of human immunodeficiency virus-1 (HIV-1) replication after transduction of granulocyte colony-stimulating factor-mobilized CD34+ cells from HIV-1-infected donors using retroviral vectors containing anti-HIV-1 genes.
Blood.
1997;89:2259-2267[Abstract/Free Full Text].
14.
Junker U, Moon JJ, Kalfoglou CS, et al.
Hematopoietic potential and retroviral transduction of CD34+ Thy-1+ peripheral blood stem cells from asymptomatic human immunodeficiency virus type-1-infected individuals mobilized with granulocyte colony-stimulating factor.
Blood.
1997;89:4299-4306[Abstract/Free Full Text].
15.
Lin HJ, Myers LE, Yen-Lieberman B, et al.
Multicenter evaluation of quantification methods for plasma human immunodeficiency virus type 1 RNA.
J Infect Dis.
1994;170:553-562[Medline]
[Order article via Infotrieve].
16.
Raboud JM, Montaner JSG, Conway B, et al.
Variation in plasma RNA levels, CD4 cell counts, and p24 antigen levels in clinically stable men with human immunodeficiency virus infection.
J Infect Dis.
1996;174:191-194[Medline]
[Order article via Infotrieve].
17.
Hollinger FB, Bremer JW, Myers LE, Gold JWM, McQuay L, and the NIH/NIAD/DAIDS/ACTG/Virology Laboratories.
Standardization of sensitive human immunodeficiency virus coculture procedures and establishment of a multicenter quality assurance program for the AIDS Clinical Trials Group.
J Clin Microbiol.
1992;30:1787-1794[Abstract/Free Full Text].
18.
Cone RW, Hobson AC, Huang MW.
Coamplified positive control detects inhibition of polymerase chain reactions.
J Clin Microbiol.
1992;30:3185-3189[Abstract/Free Full Text].
19.
Piatak M, Luk K, Williams B, Lifson JD.
Quantitative competitive polymerase chain reaction for accurate quantitation of HIV DNA and RNA species.
Biotechniques.
1993;14:70-81[Medline]
[Order article via Infotrieve].
20.
Coombs RW, Peterson G.
Estimates of HIV-1 proviral DNA copy number using a novel quantitative-competitive PCR enzyme immunoassay (QC-PCR-EIA) [abstract]. Keystone Symposia: HIV Pathogensis and Treatment.; 1998:49
21.
Kwok S, Sninsky JJ.
PCR detection of human immunodeficiency virus type 1 proviral DNA sequences. In:
Persing DH,Smith TF,Smith FC,Tenover JJ,White TJ, eds.
Diagnostic Molecular Biology: Principles and Applications. Washington, DC: ASM Press; 1993:309-315.
22.
Hockett RD, Janowski KM, Bucy RP.
Simultaneous quantitation of multiple cytokine mRNAs by RT-PCR utilizing plate based EIA methodology.
J Immunol Methods.
1995;187:273-285[Medline]
[Order article via Infotrieve].
23.
Mellors JW, Kingsley LA, Rinaldo CR, et al.
Quantitation of HIV-1 RNA in plasma predicts outcome after seroconversion.
Ann Intern Med.
1995;122:573-579[Abstract/Free Full Text].
24.
Yerly S, Kaiser L, Mermillod B, Baumberger C, Hirschel B, Perin L.
Response of HIV RNA to didanosine as a predictive marker of survival.
AIDS.
1995;9:159-163[Medline]
[Order article via Infotrieve].
25.
Havlir D, McLaughlin MM, Richman DD.
A pilot study to evaluate the development of resistance to nevirapine in asymptomatic human immunodeficiency virus-infected patients with CD4 cell counts of >500/mm3: AIDS clinical trials group protocol 208.
J Infect Dis.
1995;172:1379-1383[Medline]
[Order article via Infotrieve].
26.
O'Brien WA, Hartigan PM, Martin D, et al.
Changes in plasma HIV-1 RNA and CD4+ lymphocyte counts and the risk of progression to AIDS.
N Engl J Med.
1996;334:426-431[Abstract/Free Full Text].
27.
Mellors JW, Rinaldo CR, Gupta P, White RM, Todd JA, Kingsley LA.
Prognosis in HIV-1 infection predicted by the quantity of virus in plasma.
Science.
1996;272:1167-1170[Abstract].
28.
Katzenstein DA, Hammer SM, Hughes MD, et al.
The relation of virologic and immunologic markers to clinical outcomes after nucleoside therapy in HIV-infected adults with 200 to 500 CD4 cells per cubic millimeter.
N Engl J Med.
1996;335:1091-1098[Abstract/Free Full Text].
29.
Coombs RW, Welles SL, Hooper C, et al.
Association of plasma human immunodeficiency virus type 1 RNA level with risk of clinical progression in patients with advanced infection.
J Infect Dis.
1996;174:704-712[Medline]
[Order article via Infotrieve].
30.
Fahey JL, Taylor JMG, Detels R, et al.
The prognostic value of cellular and serologic markers in infection with human immunodeficeincy virus type 1.
N Engl J Med.
1990;322:166-172[Abstract].
31.
Piatak M, Saag MS, Yang LC, et al.
High levels of HIV-1 in plasma during all stages of infection determined by competitive PCR.
Science.
1993;259:1749-1754.
32.
Van Kerckhoven I, Fransen K, Peeters M, De Beenhouwer H, Piot P, Van Der Groen G.
Quantification of human immunodeficiency virus in plasma RNA PCR, viral culture, and p24 antigen detection.
J Clin Microbiol.
1994;32:1669-1673[Abstract/Free Full Text].
33.
Kovacs JA, Baseler M, Dewar RJ, et al.
Increases in CD4+ lymphocytes with intermittent courses of interleukin-2 in patients with human immunodeficiency virus infection.
N Engl J Med.
1995;332:567-575[Abstract/Free Full Text].
34.
Stanley SK, Ostrowski MA, Justement JS, et al.
Effect of immunization with a common recall antigen on viral expression in patients infected with human immunodeficiency virus type 1.
N Engl J Med.
1996;334:1222-1230[Abstract/Free Full Text].
35.
Staprans SI, Hamilton BL, Follansbee SE, et al.
Activation of virus replication after vaccination of HIV-1-infected individuals.
J Exp Med.
1995;182:1727-1737[Abstract/Free Full Text].
36.
Donovan RM, Bush CE, Markowitz NP, Baxa DM, Saravolatz LD.
Changes in virus load markers during AIDS-associated opportunistic diseases in human immunodeficiency virus-infected persons.
J Infect Dis.
1996;174:401-403[Medline]
[Order article via Infotrieve].
37.
Nielsen SD, Dam-Larsen S, Nielsen C, Wantzia P, Mathiesen L, Hansen JE.
Recombinant human granulocyte colony-stimulating factor increases circulating CD34-postive cells in patients with AIDS.
Ann Hematol.
1997;74:215-220[Medline]
[Order article via Infotrieve].
38.
Kuritzkes DR, Parenti D, Ward DJ, et al.
Filgrastim prevents severe neutropenia and reduces infective morbidity in patients with advanced HIV infection: results of a randomized, multicenter, controlled trial.
AIDS.
1998;12:65-74[Medline]
[Order article via Infotrieve].
39.
Schnittman SM, Psallidopoulos MC, Lane HC, et al.
The reservoir for HIV-1 in human peripheral blood is a T cell that maintains expression of CD4.
Science.
1989;245:305-308[Abstract/Free Full Text].
40.
Psallidopoulos MC, Schnittman SM, Thompson LM, et al.
Integrated proviral human immunodeficiency virus type 1 is present in CD4+ peripheral blood lymphocytes in healthy seropositive individuals.
J Virol.
1989;63:4626-4631[Abstract/Free Full Text].
41.
Wood R, Dong H, Katzenstein DA, Merigan TC.
Quantification and comparison of HIV-1 proviral load in peripheral blood mononuclear cells and isolated CD4+ T cells.
J Acquir Immune Defic Syndr Hum Retroviral.
1993;6:237-240.
42.
Blaak H, de Wolf F, van `t Wout, et al.
Temporal relationship between human immunodeficiency virus type 1 RNA levels in serum and cellular infectious load in peripheral blood.
J Infect Dis.
1997;176:1383-1387[Medline]
[Order article via Infotrieve].
43.
Woffendin C, Ranga U, Yang Z, Xu L, Nabel GJ.
Expression of a protective gene prolongs survival of T cells in human immunodeficiency virus-infected patients.
Proc Natl Acad Sci U S A.
1996;93:2889-2894[Abstract/Free Full Text].
44. Schooley RT, Mladenovic J, Ambovic D, et al. Reduced mobilization of
CD34+ stem cells in advanced HIV-1 disease. J Infect Dis. In press.

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
|
|