|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, Vol. 95 No. 10 (May 15), 2000:
pp. 3094-3101
HEMATOPOIESIS
From the Center for Thrombosis and Vascular Research, Chemical
Safety and Applied Toxicology Laboratories, School of Safety Science,
The University of New South Wales; Kirin Brewery Co Ltd, Tokyo, Japan;
and the Department of Haematology, Prince of Wales Hospital, Sydney,
Australia.
Thrombopoietin (TPO), the specific cytokine that regulates platelet
production, is expressed in human bone marrow (BM), kidney, and liver.
There appears to be no regulation of TPO in the kidney and liver, but
TPO messenger RNA (mRNA) expression can be modulated in the stromal
cells of the BM. In this study, we used primary human BM stromal cells
as a model to study the regulation of TPO mRNA expression in response
to various platelet
Thrombopoietin (TPO), the ligand for c-Mpl, supports
megakaryocyte colony formation, increases megakaryocyte size and
ploidy, and is the most important regulator of platelet
production.1-4 TPO is produced in the liver3,5
and, to a lesser extent, in the kidney, spleen, and bone marrow
(BM).5,6 Because TPO is the physiologic regulator of
platelet production, circulating levels of TPO would be expected to
vary inversely with changes in platelet demand. At least 2 possible
mechanisms of TPO regulation by platelets have been suggested. One
proposed mechanism is that TPO gene expression is constant and that
serum levels are controlled by the platelet mass through uptake and
metabolism by means of binding to the Mpl receptor.7-11
Megakaryocyte mass may also be an important regulator of serum TPO
levels, since mice lacking the erythroid transcription factor NF-E2
have profound thrombocytopenia without concomitant elevated serum TPO
levels.12,13 Nagata et al14 also found a
relation between serum TPO concentration and megakaryocyte numbers in
BM and spleen in mice with acute thrombocytopenia. Alternatively, TPO
gene expression may be regulated by feedback control at the cellular
level and TPO messenger RNA (mRNA) levels may vary accordingly. McCarty
et al15 showed that administering antiplatelet antibodies
to mice resulted in increased TPO mRNA expression in the BM but no
noticeable differences in the kidney or liver. In addition, we
previously observed an increase in TPO mRNA expression in stromal cells
from patients with aplastic anemia and idiopathic thrombocytopenic
purpura.6
The BM microenvironment plays a critical role in the regulation of
hematopoiesis through direct cell-cell interactions and the release of
hematopoietic growth factors.16-18 The stroma is composed
of a mixed population of fibroblasts, endothelial cells, macrophages,
and adipocytes.17,19 These cells and their cell-derived matrices provide attachment sites for hematopoietic progenitor cells.20 The establishment of long-term BM culture (LTBMC)
systems, which are thought to mimic hematopoiesis in vivo, has greatly facilitated analysis of this microenvironment.21 LTBMC were initially generated from murine BM by Dexter et al,16 and
the system was later adapted to human BM cells by Gartner and
Kaplan.22 Stromal cells constitutively produce a variety of
cytokines, including interleukin (IL) 1 The peptide growth factors PDGF and FGF are prime candidates for
cytokines that may affect the production of hematopoietic growth
factors. Both have a broad specificity for a number of cells, including
fibroblasts, microvascular endothelial cells, and smooth muscle cells,
and they induced the synthesis and release of macrophage
colony-stimulating factor (M-CSF) in murine stromal cells.28 PDGF also stimulated the expression of collagenase in human skin fibroblasts.29 However, the effect of these
growth factors on TPO mRNA expression in human BM stromal cells has not been investigated. Besides positive effectors, inhibitory influences may also regulate TPO expression. Platelet factor 4 (PF4),
thrombospondin (TSP), and TGF- In this study, we provide evidence that platelet Stimulating and inhibiting agents and antibodies
BM specimens
Initiation and maintenance of culture Freshly isolated mononuclear cells (8-10 × 106/mL) were seeded in 25-cm2 tissue-culture flasks (Costar, Cambridge, MA) in an 8-mL total volume of LTBMC medium. This consisted of MEM supplemented with 12.5% fetal bovine serum (FBS) (Trace Biosciences, Victoria, Australia), 12.5% horse serum (Multicell; Trace Biosciences), 10 6
mol/L hydrocortisone hemisuccinate (Sigma), and 1% glutamine solution
with penicillin-streptomycin (10 000 U penicillin and 10 mg/mL
streptomycin; Sigma).19,22 The cultures were incubated at
37°C in a 5% carbon dioxide (CO2) humidified
atmosphere. A layer of adherent cells was obtained in 3 to 4 weeks.
Each week, half of the medium was replaced with fresh medium. The
adherent layers were subjected to passage at confluence by
trypsinization (0.4% trypsin, Trace Biosciences) and cells were
analyzed at low passage numbers (between passage 2 and 3).
In situ hybridization for mRNA regulation studies A quantitative in situ hybridization (QISH) procedure enabling hybridization to be carried out directly on cells in tissue-culture plates was adapted from previous work.38-40 The adherent confluent cell layer was detached, and the cells were resuspended in complete LTBMC medium and seeded into 24-well flat-bottomed plates (Nunc, Naperville, IL) at a cell density of 5 × 104 cells/mL. The plates were incubated at 37°C and 5% CO2 in a humidified atmosphere. Preliminary studies carried out to optimize the conditions for maximal TPO mRNA stimulation and suppression in these cells found that PDGF and FGF had stimulatory effects, whereas PF4, TSP, and TGF- had inhibitory effects.
Time-course and dose-response assay At time 0, PDGF, FGF, or PMA (as a positive control) was added to the growth-arrested cells at the appropriate concentrations. The assay was terminated at 2, 4, 7, 22, and 24 hours after the addition of the growth factors or PMA by gently aspirating the medium, washing the cells 3 times with ice-cold sterile phosphate-buffered saline (PBS), and fixing the cells in formalin. PF4, TSP, or TGF- at the
appropriate concentrations was added to cells in medium containing 25%
serum. The assay was terminated at 0.25, 0.5, 2, 4, and 8 hours after
the addition of the platelet proteins by washing with sterile PBS and
fixing the cells in formalin as described previously. To investigate
dose response, PDGF or FGF was added to the cells (at time 0) at
increasing concentrations in the presence of medium containing 1%
serum, whereas PF4, TSP, or TGF- was added to cells (at time 0) in
complete medium. The assay was terminated after 4 hours, and the cells
were washed and fixed in formalin.
Fixation and pretreatment of cells After termination of the assay, the cells were fixed by immersion of plates in 10% (vol/vol) analytical-grade formalin (BDH, Sydney, Australia) in PBS (pH 7.0) for 30 minutes at room temperature. The cells were then treated to render the cell membrane permeable for probe penetration by washing twice with PBS containing 0.25% (vol/vol) Triton X-100 (Sigma) and 0.25% (vol/vol) Nonidet P40 (Sigma) for 5 minutes for each wash. The plates were rinsed quickly in fresh PBS and placed in 20% (vol/vol) acetic acid in water for 30 seconds. Plates were then washed rapidly in 3 changes of sterile distilled water and placed in 100% ethanol for 5 minutes, the ethanol was decanted, and the plates were dried in a fan-forced nonhumidified oven at 42°C before the probes were added.Complementary DNA (cDNA) probes and labeling A 1.5-kb HindIII-BamHI fragment corresponding to human TPO cDNA (a gift from Dr J. Rasko and Prof D. Metcalf of the Walter and Eliza Hall Institute of Medical Research, Victoria, Australia) was labeled with biotin by using Photobiotin (Bresatec, Adelaide, South Australia) according to the manufacturer's instructions. The plasmid vector pBR322 was also labeled with biotin and used as a negative control. cDNA of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a positive control.Hybridization conditions Hybridization was performed as described previously.6,38 Two hundred microliters of the denatured probe was added to each well containing cells. The 24-well plates were sealed with plastic film wrap and incubated in a humidified chamber overnight at 42°C.Posthybridization and detection The hybridization buffer was decanted from the plates and nonhomologous bound sequences were removed by incubating the plates in 2 × trisodium citrate (SSC) containing 50% (vol/vol) formamide for 15 minutes at 42°C. This was followed by 2 sequential washings with 2 × SSC-0.1% (wt/vol) sodium dodecyl sulfate (SDS) and 0.4 × SSC-0.1% (wt/vol) SDS at 42°C for 15 minutes each. The plates were then washed with 0.4 × SSC to remove the SDS. Biotin was detected by using an in situ hybridization detection kit (Dakopatts, Carpinteria, CA) with a slight modification of the manufacturer's instructions.
RNA extraction and reverse transcription Total cellular RNA was extracted from the treated stromal cells by using Trizol reagent (Gibco BRL). First-strand cDNA was generated by using the Superscript II reverse transcriptase (RT) enzyme (Gibco BRL). Briefly, 1 to 5 µg of total RNA and 1 µL oligo-d(T)15 primer (0.5 mg/mL) in a volume of 12 µL were heated to 70°C for 10 minutes. Then, 1 × RT buffer (250 mmol/L Tris-hydrochloric acid [HCl] at pH 8.3, 375 mmol/L potassium chloride [KCl], and 15 mmol/L MgCl2), 10 mmol/L diethylnitrophenyl thiophosphate (dNTP) mix, 0.1 mol/L dithiothreitol, and 2500 U RNase inhibitor were added and incubated at 42°C for 2 minutes. Two hundred units of Superscript II RT enzyme was added and the reaction was continued at 42°C for 60 minutes and then 95°C for 5 minutes.Semiquantitative polymerase chain reaction (PCR) Sense and antisense primers for human TPO and GAPDH were used as follows: TPO forward, 319-5' CTGCTTCGTGACTCCCATGTC 3'-340; TPO reverse, 695-5' CGCACCTTTCCTCGGAGCAG 3'-714; GAPDH forward, 280-5' ATCACCATCTTCCAGGAGCG 3'-300; and GAPDH reverse, 565-5' GGTATCGTGGAAGGACTCATG 3'-585. Before the quantitative analysis, PCR was carried out at increasing cycle numbers and the intensity of the PCR products on the autoradiograph was measured. The relative band intensity was then plotted against the number of cycles to obtain a linear relation. The optimal cycle number was chosen in the midlinear region of the curve to avoid the plateau region of the reaction. The final conditions for the PCR reactions were 1 × PCR buffer (10 mmol/L Tris-HCl [pH 8.3] and 50 mmol/L KCl), 0.4 mmol/L dNTP, 10 µmol/L of each primer for each set, 1.5 mmol/L MgCl2, 2.5 U Taq DNA polymerase (Sigma), and 2 µL of first-strand cDNA. The mixture was heated to 95°C for 30 seconds, 61°C (TPO primers) for 1 minute, and 72°C for 1 minute for a total of 31 cycles, dependent followed by a final extension at 72°C for 3 minutes. The amplification procedure for the GAPDH primers consisted of denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 90 seconds for a total of 19 cycles. A negative control that consisted of all PCR components except cDNA template was included in each reaction.
Cell-proliferation assay Tritium-thymidine incorporation into the stromal cells was used as a measure of DNA synthesis. The stromal cells were seeded at a density of 1.5 × 104 cells/well in a 96-well microtiter plate and grown to subconfluence. To investigate the stimulatory effects of PDGF and FGF, the cells were made quiescent in medium containing 1% serum for 24 hours. To study the inhibitory effects of PF4, TSP, and TGF-, cells were left in complete medium. The cells were then
incubated in the absence or presence of PDGF, FGF, PF4, TSP, or TGF-
for 18 hours, then pulsed for 6 hours with 100 000 cpm
(24.8 × 1010 Bq/mmol)
tritium-thymidine (NEN Life Sciences, Boston, MA). The assay was
terminated by gently aspirating the medium and washing the cells with
ice-cold sterile PBS. The PBS solution was carefully removed, and
ice-cold 5% trichloroacetic acid was added to the cells to precipitate
proteins and nucleic acids. Cells were solubilized by adding 0.1 mol/L
NaOH, and isotope uptake was determined by liquid scintillation
counting.42
Preparation of whole-platelet lysate One unit of fresh blood (500 mL) was obtained with informed consent from patients undergoing regular venesection for hemachromatosis at a time when the patients' serum iron and ferritin levels were normal. The blood was collected in acid citrate dextrose and centrifuged for 10 minutes at 1200g to obtain platelet-rich plasma. The plasma was centrifuged for 15 minutes at 3000g to obtain a platelet pellet that was washed 3 times in PBS-1% EDTA and the platelets counted. The platelets were then resuspended at a concentration of 10 × 109 platelets/mL in PBS-EDTA. After 5 cycles of freezing and thawing, the platelet lysate was centrifuged for 30 minutes at 13 000g to remove cell debris. The protein concentration in the supernatant was determined by using bicinchoninic acid (BCA) protein assay reagents (Pierce, Rockford, IL) with BSA as reference. Serial dilutions of the platelet lysate equivalent to 1 × 109, 1 × 108, 1 × 107, and 1 × 106 platelets/mL were added to the stromal cells and incubated for 4 hours. Anti-PF4 antibody (50 µg/mL) or the nonimmune IgG control (50 µg/mL), together with lysate equivalent to 1 × 109 platelets/mL, was also added to the cells and incubated for 4 hours. TPO mRNA expression levels were then measured with the QISH assay.Identification of PF4 and TSP proteins in the platelet lysate Equivalent amounts of platelet protein were subjected to SDS-polyacrylamide gel electrophoresis44 using either a 15% linear gel or a 4% to 15% gradient gel. Proteins were electrophoretically transferred to a polyvinylidene difluoride membrane (Millipore, Bedford, MA), and Western blot analysis was carried out. Nonspecific binding sites were blocked with 1% skim milk in PBS Tween
20 for 30 minutes at room temperature before the membranes were probed with a rabbit antihuman polyclonal anti-PF4 (2 µg/mL) and mouse monoclonal anti-TSP antibody (2 µg/mL). Immunostained proteins were
detected with a horseradish peroxidase-labeled secondary antibody by
using the enhanced chemiluminescence reagent (NEN Life Sciences,
Boston, MA) according to the manufacturer's instructions.
TPO enzyme-linked immunosorbent assay (ELISA) The supernatants from stromal cell cultures exposed to PDGF, PF4, and TSP were collected for protein measurement. A solid-phase sandwich ELISA was used to measure the TPO in the culture supernatants.45
Stimulation of TPO mRNA expression To study the stimulatory effects of PDGF-BB and FGF-2 on TPO mRNA expression, time-course and dose-response experiments were carried out. PDGF-BB (50 ng/mL) or FGF-2 (20 ng/mL) was added to growth-quiescent stromal cells and incubated for 2, 4, 7, 22, or 24 hours. The maximum poststimulatory peak in TPO mRNA expression was observed 4 hours after the addition of either growth factor (Figure 1A and 1B). There was at least a 2-fold induction in TPO expression with the addition of PDGF and a 1.5-fold induction with the addition of FGF-2 (P < .05 compared with controls). Because PMA is a potent pharmacologic agent capable of inducing differentiation in a variety of cell lines in vitro by triggering growth-factor-dependent signaling pathways,46 we used it as a positive control in our system. Figure 1C shows that TPO mRNA expression was induced in a time-dependent fashion in response to the addition of PMA. As expected, GAPDH mRNA levels remained unchanged in cells exposed to PDGF (Figure 1D), FGF, or PMA (data not shown). Figure 2 shows that TPO mRNA expression was specifically up-regulated in response to PDGF (50 ng/mL), whereas IL-3 expression was not altered. The dose-response curve for the effect of PDGF and FGF is shown in Figure 3. Quiescent cells were exposed to increasing concentrations of PDGF (0, 25, 50, and 100 ng/mL) or FGF (0, 2, 5, 10, 20, and 50 ng/mL) and incubated for the optimal time of 4 hours. TPO mRNA expression was significantly stimulated with 50 ng/mL PDGF (Figure 3A) and 20 ng/ml FGF (Figure 3C) (P < .05 compared with controls).
Suppression of TPO mRNA expression In contrast to the results with PDGF, FGF, and PMA, TPO mRNA expression was inhibited by the addition of PF4, TSP, or TGF-. PF4
and TSP were added to the stromal cell cultures and incubated for 0.25, 0.5, 1, 2, 4, and 8 hours (Figure 4A and
4B). A significant inhibition of TPO mRNA expression was observed 4 hours after the addition of these platelet proteins. Figure
5 shows the dose-dependent effects of PF4,
TSP, and TGF-. A significant inhibition in TPO mRNA expression was
found with a PF4 or TSP dose ranging from 1 to 2 µg/mL and a TGF-
dose of 50 to 100 ng/mL (P < .05 compared with controls).
GAPDH mRNA expression did not vary in cells exposed to PF4 (Figure 4D),
TSP, or TGF- (data not shown).
Confirmation of modulation in TPO mRNA expression by semiquantitative RT-PCR Semiquantitative RT-PCR was used to verify the QISH results. Total RNA was extracted from untreated stromal cells or cells treated with PDGF, FGF, PF4, TSP, or TGF-, and RT-PCR was performed. First, the
optimal numbers of PCR cycles to allow quantitation of TPO and GAPDH
transcripts were determined. The relative band intensity of each PCR
product was plotted against the increasing cycle numbers (Figure
6A and 6B). The optimal cycle number for TPO transcripts was determined to be 31; that for GAPDH transcripts was
found to 19. Second, PCR with GAPDH primers was carried out to
ascertain whether equivalent amounts of high-quality cDNA were used in
the experiments. We confirmed that TPO mRNA expression could be
up-regulated by PDGF and FGF (Figure 7A
and 7B). We also confirmed a significant inhibition in TPO expression
with PF4, TSP, or TGF- (Figure 7C, 7D, and 7E).
Changes in mRNA expression not a consequence of cell proliferation Our thymidine-incorporation study and MTS assay (data not shown) demonstrated that the addition of individual platelet proteins to either quiescent cells or cells cultured in 25% serum had no significant effects on cell growth (Figure 8). Trypan blue exclusion and morphologic assessment showed no decrease in cell viability and no toxicity changes. Therefore, the increase in TPO expression with the addition of PDGF or FGF was not associated with an increase in cell number, and the changes in TPO mRNA expression observed with the addition of the negative regulators (PF4, TSP, and TGF-) were not a result of cell
toxicity.
Suppression of TPO mRNA expression by whole-platelet lysate PDGF, FGF, PF4, TSP, and TGF- do not act individually in vivo
because they are stored and released together by the  granules of
platelets. Therefore, to study the effect of the combination of these
growth factors on TPO mRNA expression, platelets were freeze-thawed to
release their contents. Using Western blot analysis, we confirmed the
presence of PF4 and TSP proteins in the platelet lysate (Figure
9A and 9B). The addition of the platelet
lysate to the cultured cells resulted in inhibition of TPO mRNA
expression in a dose-dependent manner. Lysate from
1 × 109 platelets/mL suppressed TPO mRNA expression
levels by 50% (Figure 9C). Anti-PF4 antibody, when incubated together
with the lysate from 1 × 109 platelets, partly
reversed the inhibitory effect of the lysate (Figure 9D), whereas the
nonimmune IgG control had no effect. Surprisingly, the antibody to TSP
failed to rescue lysate inhibition of TPO expression (data not shown).
This may have been because of the nonneutralizing nature of the
anti-TSP antibody. GAPDH mRNA levels remained unchanged in response to
incubation of the cells with the platelet lysate and antibodies (Figure
9C and 9D).
TPO ELISA The protein concentration of TPO was measured in supernatants of stromal cells treated with and without PDGF, PF4, or TSP. A significant inhibition in TPO protein levels was observed in cells treated with PF4 or TSP (Figure 10). These data are consistent with the suppression of TPO mRNA in stromal cells treated with either PF4 or TSP. Unfortunately, results with supernatant collected from cells treated with PDGF were not significant because the basal levels of TPO protein expression (in growth-quiescent cells) were below the detection limit of the assay (data not shown).
The current study demonstrated that TPO mRNA expression in primary BM stromal cells may be regulated both positively and negatively. We confirmed these results with 2 independent methods. The first method involved a QISH assay. This assay was previously applied in studies of the expression of Fc IgG receptors38,47 and of connective-tissue proteins in bone cells derived from humans.39 The quantitative aspects of this assay were demonstrated by a study of the effect of increasing cell numbers compared with the absorbance obtained.39 The QISH assay provides a quantitative determination of changes in gene expression where a direct log-linear relation between absorbance values and mRNA expression has been found.38-40 The second method we used was semiquantitative RT-PCR. Results obtained with this well-established technique12,15 were consistent with the QISH data, indicating that TPO gene expression by the stromal cells of the BM could indeed be modulated.
We thank Drs Tee Beng Kang, Aseem Lal, and Daniel Owens for their efforts in collecting the bone marrow samples, Dr Linda Bendall (ICPMR, Westmead Hospital, Sydney Australia) for technical advice on the LTBMC techniques, and Dr Melissa Holmes for helpful discussions and critical evaluation of the manuscript.
Submitted March 23, 1999; accepted January 5, 2000.
Funded in part by a program grant from the National Health and Medical Research Council of Australia and an infrastructural grant from the New South Wales state government.
Reprints: B.H. Chong, Department of Haematology, Prince of Wales Hospital, High Street, Randwick, NSW 2031, Australia; e-mail: b.h.chong{at}unsw.edu.au.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
1. Lok S, Kaushansky K, Holly RD, et al. Cloning and expression of murine thrombopoietin cDNA and stimulation of platelet production in vivo. Nature. 1994;369:565[Medline] [Order article via Infotrieve]. 2. Kaushansky K, Lok S, Holly RD, et al. Promotion of megakaryocyte progenitor expansion and differentiation by the c-Mpl ligand thrombopoietin. Nature. 1994;369:568[Medline] [Order article via Infotrieve]. 3. Desauvage FJ, Hass PE, Spencer SD, et al. Stimulation of megakaryocytopoiesis and thrombopoiesis by the c-Mpl ligand. Nature. 1994;369:533[Medline] [Order article via Infotrieve]. 4. Wendling F, Maraskovsky E, Debili N, et al. cMpl ligand is a humoral regulator of megakaryocytopoiesis. Nature. 1994;369:571[Medline] [Order article via Infotrieve].
5.
Foster DC, Sprecher CA, Grant FJ, et al.
Human thrombopoietin-gene structure, cDNA sequence, expression, and chromosomal localization.
Proc Natl Acad Sci U S A.
1994;91:13,023
6.
Sungaran R, Markovic B, Chong BH.
Localization and regulation of thrombopoietin mRNA expression in human kidney, liver, bone marrow, and spleen using in situ hybridization.
Blood.
1997;89:101
7.
Kuter D, Beeler DL, Rosenberg RD.
The purification of megapoietin: a physiological regulator of growth and platelet production.
Proc Natl Acad Sci U S A.
1994;91:11,104
8.
Kuter DJ, Rosenberg RD.
The reciprocal relationship of thrombopoietin (c-Mpl ligand) to changes in the platelet mass during busulfan-induced thrombocytopenia in the rabbit.
Blood.
1995;85:2720 9. Fielder PJ, Gurney AL, Stefanich E, et al. Regulation of thrombopoietin |
-granular proteins in the regulation of
thrombopoietin messenger RNA expression in human bone marrow stromal
cells
Top
Abstract
Introduction
-granular proteins. We showed that
platelet-derived growth factor (PDGF) BB and fibroblast growth factor
(FGF) 2 stimulated TPO mRNA expression in both a dose-dependent and
time-dependent manner. The addition of 50 ng/mL of PDGF and 20 ng/mL of
FGF resulted in maximal induction of TPO mRNA expression in 4 hours. We
also found that platelet factor 4 (PF4), thrombospondin (TSP), and
transforming growth factor-beta (TGF-
in 5 mL diethanolamine buffer) was added to each
well.
80°C with
an intensifying screen, and the film was developed in an automated
developer (Curix-60; Agfa, Australia).
, 1% serum; 
, 1% serum plus PDGF.
